ID: 1146450648

View in Genome Browser
Species Human (GRCh38)
Location 17:32971430-32971452
Sequence CTGTGCAAACAGCTGAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 9, 3: 15, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146450641_1146450648 24 Left 1146450641 17:32971383-32971405 CCCAAGCTGGGAAGGTCCTTATC 0: 3
1: 6
2: 9
3: 29
4: 141
Right 1146450648 17:32971430-32971452 CTGTGCAAACAGCTGAATGGGGG 0: 1
1: 0
2: 9
3: 15
4: 167
1146450642_1146450648 23 Left 1146450642 17:32971384-32971406 CCAAGCTGGGAAGGTCCTTATCA 0: 3
1: 7
2: 8
3: 29
4: 180
Right 1146450648 17:32971430-32971452 CTGTGCAAACAGCTGAATGGGGG 0: 1
1: 0
2: 9
3: 15
4: 167
1146450644_1146450648 -6 Left 1146450644 17:32971413-32971435 CCTGAGCACTGAGACAGCTGTGC 0: 1
1: 0
2: 7
3: 29
4: 195
Right 1146450648 17:32971430-32971452 CTGTGCAAACAGCTGAATGGGGG 0: 1
1: 0
2: 9
3: 15
4: 167
1146450643_1146450648 8 Left 1146450643 17:32971399-32971421 CCTTATCAAGTGCTCCTGAGCAC 0: 1
1: 7
2: 10
3: 30
4: 167
Right 1146450648 17:32971430-32971452 CTGTGCAAACAGCTGAATGGGGG 0: 1
1: 0
2: 9
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146450648 Original CRISPR CTGTGCAAACAGCTGAATGG GGG Intronic
901114871 1:6835308-6835330 CTGTGCAGACAGTTTATTGGTGG + Intronic
905294988 1:36948662-36948684 CTGTGCACACAGCTCCATGCCGG + Intronic
905868511 1:41389679-41389701 GTGTGCAAACATCTGCCTGGGGG - Intergenic
909113610 1:71508260-71508282 CTATGCAAACAGTTGAATGCAGG + Intronic
910912087 1:92246622-92246644 ATGTGAAAAGAGCTGAATGCAGG + Exonic
911671490 1:100613520-100613542 CTGTGCACAGAGCAGAAAGGAGG + Intergenic
912440016 1:109690611-109690633 CTGGGAAAACATCTGAAAGGAGG - Intronic
913165256 1:116179095-116179117 CTTTGCAAACAGGTGTAGGGAGG - Intergenic
913315073 1:117542927-117542949 TTGTGCAGACACCTGAATGGAGG + Intergenic
922689531 1:227677335-227677357 ATGTGCAAACAGCTGAACAAAGG + Intronic
923899608 1:238311498-238311520 CTGTGGAAATACCTGAGTGGTGG - Intergenic
924805438 1:247357925-247357947 CCCTGCGAACAGCTGAATGGGGG + Intergenic
1064104214 10:12487754-12487776 CTGTTCTAACAGCAGAATGTTGG + Intronic
1066353057 10:34655288-34655310 TTGTGAAAAAAGCTAAATGGGGG - Intronic
1067671912 10:48331546-48331568 CTGTGCAAACAGCTGAACAGGGG - Intronic
1068252135 10:54456235-54456257 CTGTGAAAGCAGCTGAAGGGGGG + Intronic
1068807758 10:61218357-61218379 CTGTGCCAACAAGTGAAGGGAGG - Intergenic
1070792011 10:79195244-79195266 CTTTGCAGACAGCGAAATGGAGG + Intronic
1074055612 10:109921098-109921120 CTGTCCAAACAAGTGAAAGGTGG - Intronic
1074182242 10:111075842-111075864 CTGTGTGTACATCTGAATGGGGG + Intergenic
1076161679 10:128248403-128248425 CTGTGCTAACTGCGGAATGCAGG - Intergenic
1080767170 11:35307698-35307720 CTGTGGAAATAACTCAATGGAGG - Intronic
1081124548 11:39306941-39306963 CTCTGCAAACAATTGCATGGAGG - Intergenic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1084974205 11:72787708-72787730 CTGAGCACAGAGCTGAAGGGAGG - Intronic
1085940333 11:81199975-81199997 CCATGCAAACAGCTGAAAGTGGG + Intergenic
1089692587 11:120196109-120196131 CTGTGCAAAGAGCTGGTCGGGGG - Intergenic
1090806083 11:130203179-130203201 CAGGGCAAAGAGCTGGATGGGGG + Intronic
1093731704 12:22572746-22572768 CTTTGCAAACAGTTAAATGGTGG + Intergenic
1098416488 12:70241012-70241034 CTGAGCAAATAAGTGAATGGTGG + Intergenic
1099911400 12:88838678-88838700 CTGTGAAAGCAGCTGAGAGGGGG - Intergenic
1105207968 13:18238895-18238917 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1105747360 13:23390861-23390883 CAGTGTAAACACCTGAATGAGGG - Intronic
1107835995 13:44413053-44413075 ATCTTCAAACAGCAGAATGGTGG - Intergenic
1107861997 13:44670018-44670040 CTCTGGAAACAGTTGACTGGTGG + Intergenic
1107932563 13:45318400-45318422 GTGTGCAAGCAGGTCAATGGGGG + Intergenic
1108267803 13:48730007-48730029 GTGTGCAAACAGCAGGGTGGTGG - Intergenic
1108935188 13:55873793-55873815 CCATGTGAACAGCTGAATGGGGG - Intergenic
1109054800 13:57533783-57533805 CTGTCCAACAAGCTGCATGGGGG + Intergenic
1109798124 13:67342760-67342782 CCGTGCAAACAGCTGAATAGGGG - Intergenic
1112928136 13:104702671-104702693 ATGTGCAAATATATGAATGGTGG - Intergenic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1117570299 14:57041806-57041828 CTGTGCAAGCATCTGTATAGTGG - Intergenic
1121417960 14:93791974-93791996 CTGTGGTAGCAACTGAATGGAGG + Intergenic
1123108992 14:105856534-105856556 CAGGGCAGCCAGCTGAATGGTGG - Intergenic
1125732242 15:41899617-41899639 CTGTGGACACAGGTGAATGAGGG - Exonic
1125834139 15:42735974-42735996 CTGGGGACACAGCTGATTGGGGG + Exonic
1129367771 15:75067367-75067389 CCCTGCAAACAGCTGAATGGAGG + Intronic
1134456757 16:14400691-14400713 CTGAACGAACAGATGAATGGGGG - Intergenic
1135069669 16:19340883-19340905 CTGACCAAACAGCTGTATGTTGG - Intergenic
1139001933 16:62521348-62521370 CTGTAATAACAGCTGAATGTTGG + Intergenic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1146290045 17:31600307-31600329 CTGTGGAAATAGCCGAAGGGTGG + Intergenic
1146450648 17:32971430-32971452 CTGTGCAAACAGCTGAATGGGGG + Intronic
1147551218 17:41443321-41443343 TTGTGCACACAGGTGAATGAAGG - Intergenic
1147608864 17:41789696-41789718 CTGTGCAGACAGCTGAGTCTAGG - Intergenic
1147899136 17:43772479-43772501 CTGGGAAAACAGCTTCATGGAGG - Intronic
1148505796 17:48126175-48126197 CTGTTCAAAACGCTGAAAGGCGG + Intergenic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1154365231 18:13701992-13702014 CTGCCCAACCAGCTGCATGGGGG - Intronic
1157370628 18:47108303-47108325 CTGTGAAGAAAGTTGAATGGTGG - Exonic
1159492716 18:69159228-69159250 CTGTGCACACAGCAGAATAAAGG + Intergenic
1163894253 19:20043658-20043680 CTGTGTAAACAACTGAATTTTGG - Intergenic
1164437394 19:28242751-28242773 TTGGGCAAACAGCTCTATGGCGG - Intergenic
1164509137 19:28883266-28883288 CTGTGCAAGCAGCTGACTTCAGG + Intergenic
1166240083 19:41485107-41485129 CTGAGCAATCACCTGAAGGGAGG - Intergenic
1166265996 19:41684826-41684848 CTGTGCAGTCAGCAAAATGGAGG + Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
926012502 2:9420026-9420048 CTGTGCAGACCGCTGTATGTGGG - Exonic
926299156 2:11589835-11589857 CTGAGCAGCCAGGTGAATGGTGG + Intronic
926811071 2:16755873-16755895 CTATGCAAACAGCTGAAGATGGG + Intergenic
926935685 2:18084939-18084961 CCATACAAACAGCTGAATGGGGG - Intronic
931786324 2:65622396-65622418 CTGTGCAACCAGCTGAATGCAGG + Intergenic
936970862 2:118175171-118175193 TTGTACATACAACTGAATGGGGG + Intergenic
939993624 2:148899873-148899895 CTGTGTTCACAGCTGAATGTAGG + Intronic
940494350 2:154406340-154406362 CTGTGCAAAGAGCAGATTAGAGG - Intronic
940985790 2:160050846-160050868 CTGTGTGAACAGCAGACTGGAGG + Intronic
1172269420 20:33645516-33645538 CTGTGCAAATAGCCAAGTGGTGG - Exonic
1172793553 20:37522470-37522492 CTGTGCTGAGAGCTGCATGGCGG - Intronic
1172972755 20:38885471-38885493 CTGTGCTGACAGCTGATTTGGGG - Intronic
1173450747 20:43161663-43161685 CTGTGCACACAACTGAAAGCTGG + Intronic
1174116560 20:48230444-48230466 CTGTGCAAACAGCCTGATGATGG - Intergenic
1174342175 20:49904894-49904916 ATGTGCAAACAACAGAAAGGGGG + Exonic
1177522139 21:22239448-22239470 CTGTGAAAACAGCTGGCAGGGGG + Intergenic
1178375036 21:32059628-32059650 GTGTGCAAAGAGCTGAAGGACGG + Intergenic
1179556318 21:42179516-42179538 CTCAGCCAACAGCTGCATGGGGG - Intergenic
1180758533 22:18180780-18180802 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180777492 22:18497823-18497845 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180810214 22:18755133-18755155 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181196356 22:21189385-21189407 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181937656 22:26450226-26450248 GTGTGCAGTGAGCTGAATGGTGG - Intronic
1182364585 22:29769758-29769780 CTGGGCAAACAGCTGCTGGGTGG - Exonic
1183208158 22:36433433-36433455 CTGAGCAAACAGGGGAGTGGGGG - Intergenic
1185125678 22:49009468-49009490 CTGTGTAATGGGCTGAATGGGGG - Intergenic
1203230442 22_KI270731v1_random:105456-105478 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1203276838 22_KI270734v1_random:93706-93728 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
949554792 3:5143600-5143622 CCGTGCAAACGGCTGAACAGGGG - Intronic
949973791 3:9435292-9435314 CTGTGAAAAGAGCTGGCTGGGGG - Intronic
950009485 3:9712732-9712754 GTTTGCACACAGCTGCATGGTGG - Exonic
951471630 3:23062683-23062705 CTGTGCCAAGAACTGCATGGTGG - Intergenic
952062327 3:29525459-29525481 CTGTGCAAACAGCTTGATGGAGG - Intronic
952252629 3:31669699-31669721 CTGTGCAGAAAGCTCAGTGGTGG - Intronic
952591161 3:34955756-34955778 CAGTCCAAACAGTTGAAAGGTGG + Intergenic
953811111 3:46113653-46113675 CCGCGCAAACAGCTGAACAGGGG - Intergenic
956881648 3:73517080-73517102 CAGTCCAAACATCTGAAAGGAGG + Intronic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
957909550 3:86603959-86603981 CTGTGAAAGCAGCTGAGAGGGGG + Intergenic
959515886 3:107266687-107266709 CTGGGCCAGCAGCTGAATGATGG + Intergenic
960425280 3:117499411-117499433 CTGAGTACACAGCTGAATGTGGG + Intergenic
962503683 3:136023349-136023371 TTCTGCAAATAGCTGAATAGAGG - Intronic
963518483 3:146336714-146336736 CCATGCGAACAGCTGAATGGGGG + Intergenic
966617707 3:181929841-181929863 CTGGGCAAACACCTGAAGTGAGG - Intergenic
967630725 3:191740807-191740829 CCATGCAAACAGCTGAATGGGGG - Intergenic
969459015 4:7317815-7317837 TTGTAGAATCAGCTGAATGGTGG - Intronic
969974645 4:11086007-11086029 CTGACCAAACAGATGAATGGAGG - Intergenic
975493230 4:75011406-75011428 CTGCGCAACCGGGTGAATGGGGG + Intronic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
979707765 4:123740696-123740718 TAGTGCAAAAGGCTGAATGGTGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980522253 4:133949628-133949650 GAGTGCAAAGAGCTGAATGAGGG - Intergenic
983766402 4:171489724-171489746 GTGTGAAAACAGCTGGGTGGGGG + Intergenic
984112323 4:175633011-175633033 ATGTGCCAACAGCTTGATGGTGG - Exonic
985225072 4:187751316-187751338 CTGTGAAAGCAGCTGGGTGGGGG + Intergenic
989243269 5:39224285-39224307 CTGTGCTAAAGGCTGACTGGAGG - Intronic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
994689481 5:102999368-102999390 CTGTGAAAGCAGCTGAGAGGAGG - Intronic
996655186 5:125926539-125926561 CCATACAAACAGCTGAAAGGGGG + Intergenic
997064320 5:130544292-130544314 CCATGAGAACAGCTGAATGGGGG - Intergenic
999693490 5:154168573-154168595 CTCTGCAAACAGCTGAATCTTGG + Intronic
1001902392 5:175443189-175443211 CTGTGCAAAGTGCTGCCTGGTGG - Exonic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1004739660 6:18446498-18446520 CTCTGGAAACACCTGAATGTAGG + Intronic
1005153645 6:22779700-22779722 CTGTGAAAGCAGCTGAGAGGGGG + Intergenic
1005451192 6:25974314-25974336 ATGTGCAAAGAGCTGAGGGGTGG - Intronic
1005715436 6:28542916-28542938 AAGTACAAACAGCTGAAAGGTGG + Intergenic
1005869987 6:29967708-29967730 CTGTACAAACAGCTGATCAGGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1011818537 6:91222903-91222925 CTGTGCAAATAGTTGGGTGGAGG + Intergenic
1012057914 6:94438665-94438687 CTTTGCAAACGGTTGAATTGTGG - Intergenic
1016690009 6:146926621-146926643 CTGTAAAAATAGCTGAATGTTGG + Intergenic
1017669001 6:156752277-156752299 CTGTGCAAACAGCCTTATTGGGG - Intergenic
1018951730 6:168382775-168382797 CTGTGTCCACAGCTGGATGGGGG - Intergenic
1019862731 7:3675276-3675298 CAGTGAAAACAGCTAAATGTTGG - Intronic
1021522292 7:21550188-21550210 CTGTGCAAACAGCTAAACTGGGG - Intronic
1021622863 7:22565141-22565163 CAGTGCATACAGGTGAATGTTGG + Intronic
1024042436 7:45565681-45565703 CTGTGGACACAGCCCAATGGAGG - Intergenic
1024150500 7:46567343-46567365 ATGTGCTTACAGCTCAATGGAGG - Intergenic
1026981339 7:74528655-74528677 TTGAGCAAACACCTGAAAGGAGG + Intronic
1027929008 7:84507059-84507081 CTTTGAAAACACCTGAATGGAGG + Intergenic
1028071957 7:86461280-86461302 GTGTCCAAACTGCTGAAGGGAGG - Intergenic
1028630764 7:92931480-92931502 CTGTAGAAGCAGCAGAATGGTGG + Intergenic
1030490436 7:110226106-110226128 CTATACAGACAGCTGGATGGTGG + Intergenic
1031202450 7:118705184-118705206 GTGTGCCCACTGCTGAATGGAGG - Intergenic
1033594077 7:142841970-142841992 ATGTGCAAACTGATGTATGGAGG - Intergenic
1035412758 7:158658326-158658348 CAGAGCAAATACCTGAATGGGGG + Exonic
1038569815 8:28651262-28651284 TAGTGCAAACAGCAGCATGGTGG - Intronic
1039698389 8:39937200-39937222 CTGTGGATACAGTTGAATGATGG + Intronic
1040745895 8:50642122-50642144 CTTTGCAATCAGAAGAATGGAGG - Intronic
1042081680 8:65060636-65060658 CTTTTTAAACAGCTGCATGGTGG - Intergenic
1042216623 8:66434703-66434725 CTGCGCTGACAACTGAATGGAGG + Intronic
1045067273 8:98460099-98460121 CTGTGAAAGCAGCTGAGAGGAGG + Intronic
1047252683 8:123192600-123192622 CTGGGTGAACAGCTGATTGGTGG + Intronic
1047561525 8:125992069-125992091 CTGTATGAACAGCTGAATGGGGG + Intergenic
1048472334 8:134714329-134714351 CTGTGCAAACAGAGAAGTGGGGG - Intergenic
1051915088 9:22198527-22198549 CTGTGAAAGCAGCTGAGAGGTGG + Intergenic
1056124476 9:83521696-83521718 CTGTGCAGACAGTGGAGTGGGGG - Intronic
1057195358 9:93113375-93113397 CTGTGCCAGCAGCTGGATGTGGG - Intergenic
1057438794 9:95066600-95066622 CTGTGCAAACAGCAGACGGCAGG - Intronic
1057447211 9:95125122-95125144 CTGCGTAAACACCTGAATAGTGG + Exonic
1057471860 9:95364747-95364769 TTGGGCAAAGAGCTGAATGATGG - Intergenic
1058620629 9:106879200-106879222 CTGGGCAAGCAGCAGCATGGGGG + Intronic
1059388079 9:113980765-113980787 GTGAGCAACCAGCTGGATGGAGG + Intronic
1059564830 9:115373459-115373481 CTAAGCGAAAAGCTGAATGGAGG + Intronic
1061922368 9:133789136-133789158 CTGTGGAAAGAGCTGCCTGGCGG - Intronic
1061932578 9:133840854-133840876 CTGTGCCTACAGCTGCATGGTGG + Intronic
1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG + Intergenic
1062558348 9:137127446-137127468 CTGTGGGAAAAGCTGAGTGGGGG - Intergenic
1186704578 X:12128019-12128041 CTGTGGAAACAGCTGGGAGGTGG - Intergenic
1187168260 X:16825359-16825381 CTGTGCAAACATCAGAAATGAGG - Intronic
1188394306 X:29661725-29661747 TTGAGCAAACACATGAATGGTGG - Intronic
1188506970 X:30893306-30893328 ATTTGCAAACTCCTGAATGGTGG + Intronic
1190757437 X:53413139-53413161 CTGTGCAAACAGGGGAATGGTGG + Intronic
1191693479 X:63964428-63964450 CTGTGTAAATAGCTGAAGGAAGG - Intergenic
1193049396 X:77084539-77084561 CCGTACAAACAGCTGAATGGGGG + Intergenic
1193527872 X:82616300-82616322 CTGTGCAAGGAACTGAATGGAGG - Intergenic
1194993586 X:100570414-100570436 CCGTGTGAACAGCAGAATGGGGG - Intergenic
1199070361 X:143468840-143468862 CTGTGAAAGCAGCTGGGTGGGGG - Intergenic
1201511346 Y:14767895-14767917 CTGTGTCAACATCTGAATGTAGG - Intronic