ID: 1146454576

View in Genome Browser
Species Human (GRCh38)
Location 17:32998923-32998945
Sequence CTGAATTAGGTGGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146454576_1146454591 21 Left 1146454576 17:32998923-32998945 CCATCCTCCTCCACCTAATTCAG No data
Right 1146454591 17:32998967-32998989 CAGCATACACCAGAGGGGCGTGG No data
1146454576_1146454587 14 Left 1146454576 17:32998923-32998945 CCATCCTCCTCCACCTAATTCAG No data
Right 1146454587 17:32998960-32998982 TCCGGGTCAGCATACACCAGAGG No data
1146454576_1146454589 15 Left 1146454576 17:32998923-32998945 CCATCCTCCTCCACCTAATTCAG No data
Right 1146454589 17:32998961-32998983 CCGGGTCAGCATACACCAGAGGG No data
1146454576_1146454581 -4 Left 1146454576 17:32998923-32998945 CCATCCTCCTCCACCTAATTCAG No data
Right 1146454581 17:32998942-32998964 TCAGCCACCCTGAATGCCTCCGG No data
1146454576_1146454590 16 Left 1146454576 17:32998923-32998945 CCATCCTCCTCCACCTAATTCAG No data
Right 1146454590 17:32998962-32998984 CGGGTCAGCATACACCAGAGGGG No data
1146454576_1146454582 -3 Left 1146454576 17:32998923-32998945 CCATCCTCCTCCACCTAATTCAG No data
Right 1146454582 17:32998943-32998965 CAGCCACCCTGAATGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146454576 Original CRISPR CTGAATTAGGTGGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr