ID: 1146460328

View in Genome Browser
Species Human (GRCh38)
Location 17:33041109-33041131
Sequence CTGTGTGGGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1140
Summary {0: 1, 1: 1, 2: 16, 3: 139, 4: 983}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146460328_1146460338 -9 Left 1146460328 17:33041109-33041131 CCCTCCTCCTCCTGCCCACACAG 0: 1
1: 1
2: 16
3: 139
4: 983
Right 1146460338 17:33041123-33041145 CCCACACAGCTGAGGGGTGGTGG 0: 1
1: 0
2: 2
3: 37
4: 406
1146460328_1146460341 13 Left 1146460328 17:33041109-33041131 CCCTCCTCCTCCTGCCCACACAG 0: 1
1: 1
2: 16
3: 139
4: 983
Right 1146460341 17:33041145-33041167 GGAAGAACTGATGAGCTGTGTGG 0: 1
1: 0
2: 3
3: 19
4: 244
1146460328_1146460340 -8 Left 1146460328 17:33041109-33041131 CCCTCCTCCTCCTGCCCACACAG 0: 1
1: 1
2: 16
3: 139
4: 983
Right 1146460340 17:33041124-33041146 CCACACAGCTGAGGGGTGGTGGG 0: 1
1: 0
2: 2
3: 29
4: 280
1146460328_1146460342 19 Left 1146460328 17:33041109-33041131 CCCTCCTCCTCCTGCCCACACAG 0: 1
1: 1
2: 16
3: 139
4: 983
Right 1146460342 17:33041151-33041173 ACTGATGAGCTGTGTGGTCTTGG 0: 1
1: 3
2: 15
3: 224
4: 1017

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146460328 Original CRISPR CTGTGTGGGCAGGAGGAGGA GGG (reversed) Intronic
900029296 1:359295-359317 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900049898 1:588067-588089 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900427054 1:2585708-2585730 CTGGGCGGGCTGGAGAAGGAAGG - Intergenic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900996134 1:6124611-6124633 CTGTGTGAGCCGGGGGCGGATGG - Exonic
901001710 1:6152078-6152100 CCATTTGGGCAGGAGGTGGAGGG - Intronic
901028733 1:6293749-6293771 CTTTGTGGTAAGGAGAAGGAAGG - Intronic
901142003 1:7041048-7041070 GTGTGGGCGCAGGAGGCGGAGGG + Intronic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901689285 1:10962060-10962082 GTCTGTGAGGAGGAGGAGGAAGG - Intronic
901738115 1:11325160-11325182 CAGGGTGGGCGGGAGGCGGACGG - Intergenic
901771845 1:11534567-11534589 CTGGGTGGGCAGGAGGCAGAGGG + Intronic
901875812 1:12166723-12166745 CTGGGAGGGCAGGTGGAGGCCGG + Intergenic
901876509 1:12169825-12169847 CTGTCTGGGGAGGAGGATGAGGG + Intronic
901921347 1:12539992-12540014 CCGTGTGAGCAGGAGGTGGGTGG + Intergenic
902194961 1:14791584-14791606 CTTTGTGGGCAAGTGGAGGGAGG - Intronic
902517166 1:16995810-16995832 CAGTGAGGGCAGGAGTGGGATGG + Intronic
902548932 1:17208004-17208026 CTGGGCTGGCAGCAGGAGGAAGG + Intronic
902648713 1:17822740-17822762 CTGAGTGGGCAGGAGGGGTGGGG + Intronic
902697283 1:18148895-18148917 TTGTGTGTGCAGGGGCAGGAGGG - Intronic
902862433 1:19256052-19256074 GTGAGCGGGCAGGGGGAGGAAGG + Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903027230 1:20438125-20438147 CTTGGTGGGCAGGAGGTGGGAGG - Intergenic
903192337 1:21663731-21663753 CTGTGGGGGCAGCAGAGGGAAGG - Intronic
903226552 1:21897048-21897070 CTATGTGGGCCGGAGCAGAAGGG + Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903488292 1:23707843-23707865 GTGAGAGGGCAAGAGGAGGAGGG + Intergenic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
903603630 1:24559380-24559402 CTAGGTGGGCAGGAGGCGGCAGG + Intronic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
903832822 1:26184688-26184710 CTGTGTGGGAAGGATGGGGGTGG - Intronic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904382850 1:30123264-30123286 GTGTGTGGGCAGGAGAGGAAAGG - Intergenic
904453091 1:30629096-30629118 CTGTGTTCTCAGGAGCAGGAAGG - Intergenic
904592300 1:31621628-31621650 CTGTGTGGGCTGGGGGTGGGAGG + Intronic
904865423 1:33575121-33575143 TCCTGTGGGTAGGAGGAGGAGGG + Intronic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
905212188 1:36381980-36382002 TCCTGGGGGCAGGAGGAGGATGG - Intronic
905365684 1:37450127-37450149 ATGTGTGGGCAAGGGAAGGAGGG - Intergenic
905474954 1:38219504-38219526 ATGTGCAGGCAGGAAGAGGAAGG + Intergenic
905923104 1:41732133-41732155 CTATGTGGGGAAGATGAGGAAGG + Intronic
906150167 1:43582963-43582985 CTGTGTGGGCAGATGAAGGTTGG + Intronic
906274891 1:44508129-44508151 CTGTGTGGAGCAGAGGAGGAGGG + Intronic
907291152 1:53413832-53413854 CTGTGTGCTCAGGAGGTGGGAGG - Intergenic
907486969 1:54784834-54784856 CTGTGTGGGCTCTAGGAGGCAGG + Intronic
907962589 1:59297067-59297089 CTAAGCGGCCAGGAGGAGGAAGG - Exonic
908316392 1:62937024-62937046 TTGTGTTGACAGTAGGAGGAAGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908816740 1:68042962-68042984 TTGCGTGGGCAGCAGGAGGTGGG - Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
909736005 1:78962494-78962516 CTGGGTCGGCAGGAGGAAGGGGG - Intronic
909960505 1:81835051-81835073 GTTTGTGGGAAGGAGGAGGAAGG - Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
909975505 1:82042053-82042075 GTTTGGGGGCTGGAGGAGGAAGG - Intergenic
910271072 1:85395304-85395326 CTGTGTGGTCAGAAAGATGAGGG + Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910359437 1:86400417-86400439 GTGTGTGGGCTAGGGGAGGATGG - Intergenic
910669870 1:89762334-89762356 GTGTGTGGGCAGGGCTAGGAAGG - Intronic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911344623 1:96681530-96681552 CTCTGTGAGGAAGAGGAGGAAGG - Intergenic
912702552 1:111888993-111889015 GTGCGAGGGCAGCAGGAGGAGGG + Intronic
912713236 1:111964417-111964439 CTGTGGGGGCCGGGGGAGGGAGG - Intronic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
913111177 1:115658656-115658678 CTGTGGGGGCAGGAGGCTGAGGG + Intronic
913199427 1:116484058-116484080 ATGTGGGGGCAGGAGGGGGAGGG + Intergenic
914909882 1:151776271-151776293 GTATGTGGGGAGGAGGAGAAAGG + Intronic
915014312 1:152719075-152719097 TTGTCTGGGCAGAAGGAAGAAGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915117503 1:153609932-153609954 GGGTTTGGGCAGGCGGAGGAGGG - Intronic
915269303 1:154742291-154742313 GTGTGTGGGCAGTAGGTGGATGG - Intronic
915364184 1:155304960-155304982 CTGTGGGGCCAGGAGGCTGACGG + Intergenic
915435022 1:155897875-155897897 ATGTTTGGGGAGGAGGAGGGGGG - Intronic
915444475 1:155966960-155966982 CTGTGTGGCCAGGAGGAGATGGG - Intronic
915460555 1:156068247-156068269 CTGGGTGGGAATGAGAAGGATGG - Intronic
915772406 1:158441538-158441560 CTGGGTGGCAATGAGGAGGAAGG - Intergenic
915980854 1:160419183-160419205 CAGTGGGGGCAGCAGCAGGAAGG - Exonic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916353083 1:163874358-163874380 CACTTTGGGCAGGAGGAGGGAGG + Intergenic
916472423 1:165137274-165137296 CTCTGTGGGCAGGTGGTGGGAGG + Intergenic
916787262 1:168095684-168095706 ATCTGTGAGGAGGAGGAGGATGG + Intronic
917414147 1:174790779-174790801 GTGTGTGGGCAGGGGGCGGGGGG + Intronic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
918047576 1:180950811-180950833 CTTTGTTGGCAGGGGGAGAAGGG + Exonic
918106417 1:181419208-181419230 CTGGCTGGGCAGGGGGAAGAGGG - Intronic
918771190 1:188562527-188562549 CAGTGTGGGTGTGAGGAGGAGGG - Intergenic
919758234 1:201079360-201079382 CTGGGAGGTCAGGAGCAGGAGGG - Intronic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
920034470 1:203056887-203056909 CTGTTTGGGAAGAAGGAGAAGGG + Exonic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920076715 1:203342495-203342517 CTGTGGGGACAAGAGGAGCACGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920399396 1:205667872-205667894 CTATCTGGGCTGTAGGAGGATGG - Intronic
920399568 1:205668677-205668699 AGGAGTGGGCAGGAAGAGGAAGG + Intronic
920400471 1:205673060-205673082 GTGTGTGGGCAGGTGAAGGATGG - Intronic
920411311 1:205763258-205763280 CTGGGTGGGGAGGCGGGGGAGGG - Intergenic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
921939619 1:220826607-220826629 CTGGGTGGGAAGGAGGTGGGCGG + Intergenic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922412138 1:225387236-225387258 ATGTGTGGGGGGGAGGGGGAGGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922459349 1:225803124-225803146 CTGTGTGGGCAAGGAGAGCAGGG - Intergenic
922480587 1:225937805-225937827 CTGTGTGGGCAAGGAGAGCAGGG + Intronic
923015144 1:230120732-230120754 GTGTGTGCGGAGGAGGATGAGGG - Intronic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
923429365 1:233905481-233905503 GTGGGTGGGCAGGGGGAGCATGG - Intronic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
924565882 1:245198055-245198077 ATGTGTGGGTGGTAGGAGGAAGG - Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1062981205 10:1724520-1724542 TTGTGTGCGCAGCAGCAGGAGGG + Intronic
1062982997 10:1741121-1741143 CTGTGTGGTCAGCCGCAGGAAGG - Intergenic
1063000928 10:1921713-1921735 CTGGGTGGGCATGAGAAAGAGGG + Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1063977676 10:11430165-11430187 CTGTGTGGTCATGTGGTGGAAGG - Intergenic
1064302318 10:14133610-14133632 CTTTGCTGGCTGGAGGAGGAAGG + Intronic
1064680153 10:17803195-17803217 CTGAGTGGGTAGGAGGTGGCTGG + Intergenic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1065773775 10:29101178-29101200 CTGTGAGGTCAGGAGGGGGCAGG + Intergenic
1065773801 10:29101264-29101286 CTGTGAGGTCAGGAGGGGGCAGG + Intergenic
1065901989 10:30216360-30216382 ATGAGTGGGAAGGAGTAGGATGG + Intergenic
1066048909 10:31617893-31617915 CTGAGTGGGAGGGAGGAAGAGGG - Intergenic
1066543030 10:36469758-36469780 CTATGTGTGCAGGAGGGAGAGGG - Intergenic
1066650693 10:37652162-37652184 GTGTGTGCGCTGGAGAAGGAAGG - Intergenic
1067187665 10:44044156-44044178 CAGTGTGGGGAGGAGGAGATGGG + Intergenic
1067487816 10:46668491-46668513 CTGGCTGGGGAGGAGGAGCAGGG - Intergenic
1067606991 10:47673518-47673540 CTGGCTGGGGAGGAGGAGCAGGG + Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1068505174 10:57891273-57891295 TTGTCTGGGGAGGAAGAGGAGGG + Intergenic
1068561512 10:58519929-58519951 ATGTGTGGACAGTGGGAGGAGGG - Intronic
1068884381 10:62083500-62083522 GAGTGTGGGAAGGAGGAGGAGGG - Intronic
1069333480 10:67321007-67321029 TTGTGTGGGGTGGAGCAGGAGGG - Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069683498 10:70301330-70301352 CTGGGTGGGCATGAGGAGGGTGG + Exonic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1069751559 10:70748446-70748468 CTGGGTGGGCAGGAGGCGAGGGG + Intronic
1070122295 10:73589841-73589863 CTGTAGGGGCAGGAGGTGAAGGG + Intronic
1070204288 10:74241275-74241297 GTGTGAGGGCAGGAGGATTATGG - Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070605923 10:77898550-77898572 CTCTATTGGCAGGAGGAGGCAGG - Intronic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1071146588 10:82581561-82581583 ATGTGTGGGGATGAGGAGAATGG + Intronic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1072271038 10:93776856-93776878 CTGTGTGCAAAGGAGGAGGTTGG + Intronic
1072335165 10:94391396-94391418 CTTTATGGGCAGTAGGAAGAAGG - Intergenic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072552987 10:96493463-96493485 CTGTCAGGGCAGGAGCAGGAGGG + Intronic
1072578541 10:96720777-96720799 GGGTGTGGGGAGGAGGCGGAGGG + Intergenic
1072610444 10:97014159-97014181 CTGTGCGGGGAAGGGGAGGATGG + Intronic
1072619148 10:97068273-97068295 ATGTATGGCCAGGAGGGGGAGGG - Intronic
1072620376 10:97075402-97075424 CTCTGTAGGGAGGAGGAGGGAGG + Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1073058933 10:100721620-100721642 CTGTAGGGGCAGGAGGAGTTGGG - Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073073594 10:100809760-100809782 CTCTCTGGGAAGCAGGAGGAAGG - Intronic
1073124673 10:101141911-101141933 CTGTAGGGGCTGGGGGAGGAGGG - Intergenic
1074078823 10:110151960-110151982 GGGAGAGGGCAGGAGGAGGAAGG - Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074234064 10:111567016-111567038 GTGTGTGGGGAGGTGGGGGAGGG + Intergenic
1074527925 10:114277854-114277876 ATGAGGGGGCAGGAGGAGGGTGG + Intronic
1074681166 10:115909168-115909190 CTGACTGGGCATGAAGAGGAAGG - Intronic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075717554 10:124565857-124565879 CAGTGGGGACAGGAGGGGGAAGG + Intronic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1076519654 10:131073648-131073670 CTGGATGGGCAGGATGTGGATGG + Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1076732777 10:132446721-132446743 TGGGGTGGGCAGGAGGAGGTGGG + Intronic
1076818494 10:132926287-132926309 CCGTGGGGGCTGCAGGAGGAGGG + Intronic
1076819216 10:132930474-132930496 CTGTGTGGGGAGTATGGGGAAGG - Intronic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077015992 11:399409-399431 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077016021 11:399482-399504 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077138086 11:1011499-1011521 CTGTGTGGTCAGGAAGTGAAGGG + Exonic
1077192603 11:1261729-1261751 CGGGGTGGGCAGCAGGAGCACGG - Exonic
1077252514 11:1566837-1566859 CCGGGTGGGCAGGTGGAGTAGGG + Intronic
1077358047 11:2127682-2127704 CAGTGGGGACAGGAGCAGGAGGG + Intergenic
1077472953 11:2772850-2772872 CGGTGTGGGCAGGTGAAGGGAGG - Intronic
1077490827 11:2860234-2860256 CTGTGTGGACAGGCGCTGGAGGG - Intergenic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078567615 11:12430479-12430501 CTGTGTGTCCAGGAGGGGCAAGG - Intronic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1078854736 11:15197802-15197824 GTGTGTGGGCTGGTGGTGGAAGG - Intronic
1079117276 11:17647823-17647845 CCATGTGGGAAGGAGAAGGAGGG + Intergenic
1079444183 11:20545063-20545085 TAGTGTGGGCAGGAAGAGGAGGG - Intergenic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1081642107 11:44763201-44763223 CTCTGAGGGCAGGAGGAGCCTGG + Intronic
1082834686 11:57642939-57642961 CTGTCTGGGCAGGAGAAAGGAGG - Intergenic
1083049309 11:59762731-59762753 AAGTGTGGGGTGGAGGAGGAAGG + Intronic
1083205538 11:61146573-61146595 CTGGGAGGGGAGGAGGAGGGAGG + Intronic
1083256108 11:61496363-61496385 CTGCGTGGGGAGGCTGAGGACGG + Intergenic
1083290693 11:61688503-61688525 CTGTGTGGCCAGGAGTGGGGCGG + Intronic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1083365785 11:62140795-62140817 CTGGCTGGGCAGGGTGAGGAAGG - Exonic
1083489962 11:63008988-63009010 TTATGTGCGCAGGAGGAGGTGGG - Intronic
1083581917 11:63830483-63830505 CTGGGAGGGCAGGAGGTGGCTGG - Intergenic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084331523 11:68433214-68433236 GTGTGTTGCCGGGAGGAGGAAGG + Intronic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1084852723 11:71955892-71955914 CAGTGTGGGTAGGAAAAGGAAGG + Intronic
1084904174 11:72333382-72333404 CTCTGTGTGCAGGATGATGAAGG + Intronic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1084943488 11:72626627-72626649 GAGTGTGGGCAGGAGTGGGAGGG - Intronic
1085076805 11:73598479-73598501 GTGTGTGGGCGGGGGGAGGGGGG - Intergenic
1085243751 11:75080436-75080458 AGGTGGGGGCAGTAGGAGGAGGG - Intergenic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1086030483 11:82349336-82349358 CTATGTTGGCAGGAGTAGGTCGG - Intergenic
1086215204 11:84370892-84370914 ATGTGTGGGCAGGTGGTGGGAGG + Intronic
1086861006 11:91924845-91924867 GAGTGAGGGCAGGAGGAGCAGGG + Intergenic
1086929925 11:92681835-92681857 CAGTGTGGGAGGGAGGAGGAGGG + Intronic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1088326896 11:108609917-108609939 CTGTGTGGGATGGAGCAGGATGG + Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089373284 11:117976843-117976865 GTCTTTGGGCAGGAAGAGGAAGG + Intergenic
1089737092 11:120557009-120557031 TTCTGTGGGCAGGAGGAGACTGG - Intronic
1089846315 11:121461259-121461281 ATGGGTGGGCTGGAGGGGGACGG + Intronic
1090104792 11:123841270-123841292 CAGTGAGGTCAGGAGGATGAGGG + Intergenic
1090355945 11:126140437-126140459 CTGGGTGGAAAGGAGGAGTAAGG + Intergenic
1090647515 11:128777681-128777703 CTGAGTGTGCAGGAGCGGGAGGG - Intronic
1090748439 11:129725792-129725814 ATGGGTGGGCAGGAGGATGGTGG - Intergenic
1090789348 11:130076944-130076966 GCATGTGGCCAGGAGGAGGAGGG + Intronic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1090941783 11:131393584-131393606 TGGTGGGGGCAGTAGGAGGAGGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091274859 11:134343074-134343096 CTCTGTGGTGGGGAGGAGGAGGG - Intronic
1091394386 12:144570-144592 CTGTGCGGAAAGGAAGAGGAGGG + Intronic
1091406024 12:210014-210036 CTGGGTGGGCAGGATGACGAGGG + Exonic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091670316 12:2447721-2447743 CTGGCTAGGCAGGAGGAGGTGGG + Intronic
1091972288 12:4797414-4797436 CTGAGAGTGCTGGAGGAGGAGGG + Intronic
1092103028 12:5901789-5901811 CCTTGTGGGCCTGAGGAGGAGGG - Intronic
1092393629 12:8104721-8104743 CTGAGTGGGGAGGGGGAGAAGGG - Intergenic
1092865718 12:12759075-12759097 CTGTGCGGGAGGGAGCAGGATGG + Intronic
1092892428 12:12981186-12981208 CAGGGTGGGTAGGAGGAGGGAGG + Intronic
1093465253 12:19441719-19441741 CTGTGTAGGCATGGGTAGGAAGG + Intronic
1093847746 12:23994671-23994693 GTGTGTGGGCAGGAGGAGAGAGG + Intergenic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1094749529 12:33389824-33389846 TTGTGTGGGCAGGTGGATGAAGG - Intronic
1095854345 12:46843855-46843877 CTTTTATGGCAGGAGGAGGAAGG - Intergenic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096523750 12:52198639-52198661 CTGGGTGGAGAGGAGCAGGAAGG + Intergenic
1096596856 12:52701380-52701402 GTGTGTGAGCGGGCGGAGGAGGG - Intronic
1097680868 12:62647768-62647790 CTGTGTGGGCTGGAGGAGGTGGG + Exonic
1097879183 12:64671646-64671668 CTTCCTTGGCAGGAGGAGGAAGG + Intronic
1098041284 12:66356046-66356068 CTGTGTGGACACGAGAGGGAGGG + Intronic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1099145269 12:79035608-79035630 CTTTGTGGGCAGGAAGTGGTGGG - Intronic
1100272868 12:93043136-93043158 TTGTGTGGGCAGGAGTTGGGTGG + Intergenic
1100295503 12:93257316-93257338 CTATGTGGGCAGGAGGGAAAAGG - Intergenic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1101719145 12:107335960-107335982 TTGTCGGGGCAGGAGGAGGAAGG - Intronic
1102077636 12:110072834-110072856 GCGTGTGGGCAGGTGGAGGCAGG + Intronic
1102540748 12:113617531-113617553 GTAAGGGGGCAGGAGGAGGAAGG + Intergenic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103443656 12:120980462-120980484 CTGACTTGGCAGGAAGAGGAGGG + Intronic
1103844409 12:123891560-123891582 CTGAGAGGGCAGGCGGAGCACGG + Intronic
1104010826 12:124928920-124928942 CTGTGGGGGCAGCAAGAGAAGGG + Intergenic
1104064434 12:125295370-125295392 CTGTTGGGGCAGGAGCTGGAAGG + Intronic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104653625 12:130556795-130556817 CAGTGTGGAGAGGAGCAGGAAGG + Intronic
1104960969 12:132488641-132488663 CTGGGTGGACTGGAGGAGGCTGG + Intergenic
1104964749 12:132503895-132503917 CAGTGGGGGCAGGAGGCTGAGGG - Intronic
1104972900 12:132539817-132539839 CTGTGTGGGCATGGGGCTGAAGG - Intronic
1104973062 12:132540267-132540289 CTGTGTGGGCATGGGGCTGAAGG - Intronic
1105016287 12:132787972-132787994 CTGCGAGGGCAGGAGCAGGTCGG - Intronic
1105967990 13:25402172-25402194 CTAGGTGGGAAGGAGCAGGATGG + Intronic
1106570039 13:30918583-30918605 CATTCTGAGCAGGAGGAGGAAGG - Intronic
1106872590 13:34037801-34037823 CTGTGTGTCCTGGAAGAGGAGGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107908755 13:45085681-45085703 GTGTGGGGGCAGGTGGTGGATGG - Intergenic
1107996801 13:45869175-45869197 GTGTGAGGACAGGAGAAGGAAGG - Intergenic
1108617149 13:52144521-52144543 CATTGTGGGCGGGAAGAGGAAGG + Intronic
1110504189 13:76266144-76266166 GTGTGTGGGCGGGGGGAGGGGGG - Intergenic
1111666633 13:91277774-91277796 CTGGGTGGGATGGAGCAGGATGG + Intergenic
1112415066 13:99197334-99197356 TACTGTGGGCAGGAGGAGGGGGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113449574 13:110397717-110397739 CTTTGTGGGCAGGAAGGAGAGGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113823352 13:113231434-113231456 CTGTGTGGGGAGTGGGAGGTGGG + Intronic
1114210674 14:20611545-20611567 GTGAGTGAGAAGGAGGAGGAGGG + Intergenic
1114614092 14:24059247-24059269 CTGTGTGGGCAAGGGGCGGTTGG - Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114660020 14:24338128-24338150 ATGTGGGGGCACGAGGAGGGAGG + Intronic
1114661001 14:24344816-24344838 CTGAGTCGGCAGGGGGTGGAAGG - Intergenic
1115791155 14:36880056-36880078 CTGAGTGGCCAGGAAGAAGAGGG - Intronic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1117292201 14:54344759-54344781 CAGAGTGGGGAGGAGGAGCATGG - Intergenic
1117340617 14:54788476-54788498 TGGTGCTGGCAGGAGGAGGAGGG - Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1118384284 14:65242786-65242808 CTTAGAGGGCAGGAGGAGGGAGG + Intergenic
1118500389 14:66356844-66356866 TTGTCTGGGGAGGAGGAGGGTGG - Intergenic
1118751559 14:68811386-68811408 CTGTGTGGGTGGGAGGACGCAGG + Intergenic
1119019569 14:71096985-71097007 CGGGGTGGGGAGGAGGAGGGAGG - Intronic
1119163379 14:72471702-72471724 CTGGGTGGTCAGGAGGTGGCTGG - Intronic
1119320170 14:73725921-73725943 GGGTGGGGGCGGGAGGAGGAGGG - Intronic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119529192 14:75347784-75347806 CTGCTTGGGCAGGAGGTGGATGG + Intergenic
1120248840 14:82037574-82037596 CTAAGATGGCAGGAGGAGGATGG - Intergenic
1120954003 14:90065670-90065692 CTGTCTGGGGAGGATGAGAAAGG + Intronic
1121416644 14:93783863-93783885 CTGATTGGCCAGGAGTAGGATGG - Intronic
1121416651 14:93783896-93783918 CTGATTGGCCAGGAGTAGGATGG - Intronic
1121416658 14:93783929-93783951 CTGATTGGCCAGGAGTAGGACGG - Intronic
1121764092 14:96470542-96470564 CTGCTTGGGAAGGATGAGGAGGG - Intronic
1122118102 14:99537592-99537614 GTGACTGGGCTGGAGGAGGAGGG - Intronic
1122133363 14:99618905-99618927 CTGGCCGGGCAGGAGGAGCATGG + Intergenic
1122635028 14:103125806-103125828 GGGTCTGGGCAGGAGGAGGCTGG + Intronic
1122778784 14:104134936-104134958 CTGTGGGGGAGGGAGGAGGGTGG + Intergenic
1122820909 14:104344337-104344359 ATCTGTGGGCAGGAGCTGGAAGG - Intergenic
1122941020 14:104981418-104981440 CAGAGTGGGCAGGAGAAGGGAGG - Intergenic
1122969791 14:105147889-105147911 CTGTAAGGAGAGGAGGAGGAGGG + Intronic
1123068085 14:105628176-105628198 GTGGGGGGGCAGGAGGAGCAGGG - Intergenic
1123116889 14:105898945-105898967 AGTTGTGGGCAGGAGGAGGTAGG + Intergenic
1123118940 14:105908221-105908243 AGCTGTGGGCAGGAGGAGCACGG + Intergenic
1123121169 14:105917810-105917832 AGTTGTGGGCAGGAGGAGGCAGG + Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1124186652 15:27535912-27535934 GTGTGTGGGCACGAGGTGCAAGG + Exonic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124365586 15:29069021-29069043 CTGTGGGGGCTGGGGGCGGAGGG - Intronic
1124400497 15:29343703-29343725 GTGTGTGGGAAGGATGAGGGAGG + Intronic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1126508815 15:49441854-49441876 CTCAGTGGTCAGTAGGAGGAGGG + Intronic
1127682230 15:61309060-61309082 GTGTGTGGGGTGGAGGGGGAGGG + Intergenic
1127914552 15:63444700-63444722 CTGTGTGTGCAGGGAGAGGGTGG + Intergenic
1128070059 15:64789947-64789969 CTGAGGGGGCAGGAGGAAAAGGG - Intergenic
1128261506 15:66236192-66236214 CTGTGTGTTCTGGAGGAGGGAGG + Intronic
1128760271 15:70212065-70212087 CTGTGTGGCCATGAAAAGGAAGG + Intergenic
1128782976 15:70375178-70375200 GTGTGCGGGGAGGTGGAGGAGGG - Intergenic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129678097 15:77643264-77643286 CTGTGTGGGCTGGACTAGGCAGG + Intronic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1129759613 15:78121874-78121896 CTGTGTGGGGAAGAGGAGAGAGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1129891784 15:79076429-79076451 CTGAGAGGGCATGAGGAGCAGGG - Intronic
1130069496 15:80634619-80634641 CTGTGAGGGCACCAGGAGGCTGG + Intergenic
1130260988 15:82354210-82354232 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130280247 15:82514808-82514830 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130471622 15:84230994-84231016 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130479116 15:84345565-84345587 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130492655 15:84442566-84442588 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130593918 15:85235622-85235644 TTGGCTGGGAAGGAGGAGGAGGG + Intergenic
1130613135 15:85379605-85379627 TTGGCTGGGAAGGAGGAGGAGGG - Intergenic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1131461336 15:92619667-92619689 CTGTGTGGGGAGCTGGGGGAGGG - Intronic
1132069780 15:98766010-98766032 GGGTTAGGGCAGGAGGAGGAAGG + Intronic
1132574734 16:659200-659222 ATGTTTGGGAAGGAAGAGGAAGG - Intronic
1132774056 16:1582040-1582062 CTGTGTGGGCAGGCGGCTGAGGG + Intronic
1132882214 16:2167464-2167486 ACGTGTGGGCAGGAGGAGGGAGG + Intronic
1133288116 16:4700466-4700488 CTGTGTGGGCAGAAGAGGCACGG - Intronic
1133401263 16:5489133-5489155 CTCTGTGGGCAGCAGAGGGAAGG + Intergenic
1133624989 16:7562729-7562751 CAGTGGGGGAAGGAGGAGGAAGG + Intronic
1133888109 16:9850923-9850945 GTGTGGGAGCAGGAGGAGAAGGG - Intronic
1134175734 16:12004559-12004581 CTGTGTGGGAAGGAAAGGGAAGG + Intronic
1134190842 16:12120033-12120055 CTGGGTGGGCTAGGGGAGGAGGG + Intronic
1135113359 16:19707663-19707685 CTGTGTAGGGAGGTGGGGGAGGG - Intronic
1135294115 16:21264494-21264516 GTGTGGGGGCAGGAGGAGGGAGG + Intronic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1135520451 16:23172838-23172860 CTGTGTGGCAAGGACCAGGAAGG + Intergenic
1135572017 16:23557091-23557113 CAGAGTGGGCGGGCGGAGGAGGG - Intronic
1135662078 16:24305645-24305667 CTGGGTGGGGAGCAAGAGGAGGG + Intronic
1136090959 16:27919680-27919702 CTGTGTGGTCAGGGTGAGGCTGG - Intronic
1136254746 16:29030419-29030441 CTGTGTGGGCAGGAGAGAGATGG - Intergenic
1136550269 16:30979247-30979269 GGGTGGGGGCAGGAGGGGGATGG - Exonic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1137603931 16:49774724-49774746 CAGTCTGGGCAAGGGGAGGAGGG + Intronic
1138333264 16:56231978-56232000 ATGTGGGGGCTGGAGGAGGGGGG + Intronic
1139593622 16:67946337-67946359 GTGTCTGGGGAGGAGGAGCACGG + Exonic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139957696 16:70700945-70700967 ATGTGAGGGCAGGCTGAGGAGGG + Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140106828 16:71968267-71968289 CTAAGTGGGAAGGAGGTGGAAGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140508003 16:75486514-75486536 CTGTGTGGGCTGGGGGGGCAGGG - Intronic
1140669569 16:77263929-77263951 CTGTGTGGGGGTGGGGAGGAGGG - Intronic
1141039515 16:80660966-80660988 CTGAGAGGGCAGGAAGTGGAGGG + Intronic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141507289 16:84486267-84486289 CGGTGGGGGCAGGGGCAGGAAGG + Intronic
1141618998 16:85226809-85226831 GTGTGTGTGAAGGAGGACGAAGG + Intergenic
1141946041 16:87310782-87310804 TAGTGTGGGAAGGAGGAGGCAGG + Intronic
1141988054 16:87592870-87592892 CTGTGGGGGAAGGGGGAGGGAGG + Intergenic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1142244079 16:88961070-88961092 CGCTGTGGGCAGGTGGTGGATGG + Intronic
1142441440 16:90100882-90100904 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1142878117 17:2864592-2864614 CGGTGTGGGGAGCAGGAGGCTGG + Intronic
1142915221 17:3131095-3131117 CTGTCTTGGGAGGATGAGGAAGG - Intergenic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143124963 17:4636122-4636144 CTGAGCGGGCAGGAAGGGGAGGG - Intronic
1143178994 17:4972771-4972793 GTGTCTGGGCTGGAGGAGGGTGG + Exonic
1143780369 17:9225919-9225941 CTGCGAGGCCTGGAGGAGGAAGG - Intronic
1143861815 17:9896908-9896930 CTGAGGGGGCAGGAGGAGAGAGG - Exonic
1144472797 17:15559759-15559781 CTGACTGGGGAGGTGGAGGAAGG + Intronic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1144702678 17:17349259-17349281 CTCCCTGGGCAGGAGGAGGGAGG - Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144766917 17:17738038-17738060 GTGGGTGGGCATGAGGTGGACGG + Intronic
1144825636 17:18104202-18104224 GTGTGTGCGCACCAGGAGGATGG - Intronic
1144923682 17:18784946-18784968 CTGACTGGGGAGGTGGAGGAAGG - Intronic
1145101274 17:20079862-20079884 CTGGGTGGGCAGGAGGCGCAAGG + Intronic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146623610 17:34419395-34419417 CTGAGAGGGTAGGAGGAGGAAGG + Intergenic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1146737976 17:35255850-35255872 CTGTTTGGGGAGGAAGAGGGTGG - Intronic
1146812999 17:35918400-35918422 CAGTATGGCCAAGAGGAGGAAGG - Exonic
1146936008 17:36813136-36813158 CGGTGTCGGCAGGAGCAGGTGGG - Intergenic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147131363 17:38411405-38411427 CTGTGTGTGGAGGATGAGGCAGG + Intergenic
1147170780 17:38617555-38617577 CTGAGTGGAAAAGAGGAGGAGGG + Intergenic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147266391 17:39237300-39237322 GTGTGTGGTCAGGCAGAGGAGGG + Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147399963 17:40174780-40174802 CTGGGTGGGCAGAAAGAAGAGGG + Intergenic
1147690561 17:42312359-42312381 GTCTCTGGGAAGGAGGAGGATGG - Intergenic
1147965720 17:44193343-44193365 CAGGGTGGGCAGGAGGAACACGG + Exonic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148638476 17:49167266-49167288 CTGCATGGCCAGGAGGAAGAGGG + Intronic
1148690907 17:49526364-49526386 CTGAGTGGGCAGGAGGGAGGTGG - Intergenic
1148760526 17:49997439-49997461 CTGTGAGGGCCTGAGGAGGGAGG - Intergenic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1149671595 17:58417667-58417689 GTGTGTGAGCACCAGGAGGAGGG - Intergenic
1150412442 17:64956574-64956596 CTGTGTTGGCTGGAGAGGGATGG + Intergenic
1150645828 17:66976907-66976929 CTGAGTGGGCTGGAGACGGAGGG - Intronic
1150799453 17:68269049-68269071 CTGTGTTGGCTGGAGAGGGATGG - Exonic
1151361709 17:73593100-73593122 TGGGGTGGGGAGGAGGAGGAGGG - Intronic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1151788219 17:76287015-76287037 GTGTGTGGGCAGGGGGTGGGGGG - Intronic
1151818114 17:76481522-76481544 CATTGTGGGCAGGAGGCGGGAGG + Exonic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1152193682 17:78903653-78903675 CTGTGTGGGCAGGTGGTTGACGG - Intronic
1152261535 17:79269898-79269920 CAGTGTGGGCAGGTGGATAAGGG - Intronic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152370872 17:79887865-79887887 CTGTATTGGAAGGAGCAGGATGG - Intergenic
1152492851 17:80649420-80649442 GAGTTTGGGCAGGAGGAGGGAGG - Intronic
1152567428 17:81106550-81106572 CTTCATGGCCAGGAGGAGGAAGG + Intronic
1152642152 17:81453803-81453825 GAGTGAGGGCAGGAGGTGGAAGG - Intronic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1152950462 17:83227261-83227283 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1153073258 18:1131526-1131548 CTGTGTGTGTAGGAGGATGGAGG + Intergenic
1153202239 18:2657626-2657648 TGGAGTGGGAAGGAGGAGGAAGG - Intronic
1153226327 18:2902820-2902842 TTGTGTGTGAAGGAGCAGGAGGG + Intronic
1153724688 18:7942801-7942823 CTGGGTGGGGAGGAGAAGGGAGG - Intronic
1154251792 18:12750964-12750986 CTGGCTGGGAAGGAGGATGAAGG - Intergenic
1155146333 18:23086717-23086739 TTGTGTAGGCAAGAGCAGGATGG - Intergenic
1155156932 18:23165517-23165539 CTGGGGGGGCAGGAGGAACAGGG - Intronic
1155689969 18:28607906-28607928 CTGTGCGAGCAGGAAGAGAAAGG + Intergenic
1155825059 18:30431111-30431133 CTGTGTGGGGAGGCGGTGAAGGG - Intergenic
1155986861 18:32239074-32239096 CCCTGTGGCCAGGAGGGGGATGG + Intronic
1156688830 18:39681843-39681865 GTGGGTGGGCAGGCAGAGGAAGG + Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157482732 18:48065959-48065981 CTTATTGGGAAGGAGGAGGAGGG - Intronic
1158525223 18:58207267-58207289 CTGTGTGGGGATCAGGAAGAGGG + Intronic
1158561333 18:58516264-58516286 ATATGTGGATAGGAGGAGGAAGG + Intronic
1159950337 18:74478298-74478320 AGGTGGGGGCAGGAGCAGGAAGG - Intergenic
1160312770 18:77811290-77811312 CTGGGTGGGAGGGAGGAGAAAGG + Intergenic
1160698160 19:494481-494503 CAGCCTGGGCAGGAGGGGGATGG + Intronic
1160892713 19:1387717-1387739 CTGTGCGGGCAGGAGCCTGATGG + Intronic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161085478 19:2333081-2333103 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161085516 19:2333202-2333224 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161303708 19:3555840-3555862 CTGTGAGGGCAAGAAGAGCAGGG + Intronic
1161320219 19:3637628-3637650 CCGGGTGGGCCGGAGGAGGAAGG + Intronic
1161632770 19:5367171-5367193 ATGTGTTGGCAGTAGGGGGAAGG + Intergenic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1161978487 19:7618907-7618929 CTGTGTGGGCAGGAGGCAGCTGG - Intergenic
1161988097 19:7668936-7668958 CAGTAAGGGCTGGAGGAGGAAGG - Intergenic
1162043018 19:7981802-7981824 CTGGGTGGTGAGGATGAGGAAGG + Intronic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162966094 19:14156814-14156836 CTCTGGGATCAGGAGGAGGAAGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163123834 19:15233456-15233478 CTGTTGGGCCAGCAGGAGGACGG - Intergenic
1163154710 19:15433369-15433391 CTAAGTGGGCAGGAGGGGGCGGG - Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163625288 19:18386068-18386090 CTCTGCAGGCAGGGGGAGGAGGG + Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1163727509 19:18931300-18931322 GTGTGTGGGCACAAGGAGGTGGG - Intronic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164037748 19:21468907-21468929 CTGTGTGGCCAGGACCAGGTAGG - Intronic
1164800087 19:31068957-31068979 CTGCCAGGGGAGGAGGAGGAAGG - Intergenic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1165789482 19:38483055-38483077 GTGGGTGGGCAGGACGAAGACGG - Exonic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166299668 19:41906647-41906669 CTGAGTGGGCTGGGGAAGGAAGG + Intronic
1166317542 19:41997557-41997579 CAGAGTGGGCGGGAGGGGGATGG - Intergenic
1167116758 19:47493046-47493068 CTGTGTGGGGAGGAGTAGTGAGG + Intronic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167458945 19:49614331-49614353 CTGGGTGGGCAGGAGGCGACAGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167552008 19:50167817-50167839 CCGTGTGTGCATGTGGAGGAAGG - Intergenic
1167767015 19:51490336-51490358 CTGTGTGGGGAGAAAGAGGCCGG - Intronic
1167852978 19:52215983-52216005 CTCTGTGGGCAGGGAGAGGGAGG - Exonic
1168288159 19:55344662-55344684 CTGTGGTGGCAGGAGCAGGGAGG + Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
924985099 2:263906-263928 CGGTGGTGGGAGGAGGAGGACGG - Intronic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
925689842 2:6510714-6510736 CTGAGAGGGCAGGAGGAGCAGGG - Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
925909932 2:8567178-8567200 AGGTGGGGGCAGGTGGAGGAAGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927154547 2:20213879-20213901 CTGTGTGTGAAGGTGGGGGAGGG + Intronic
927576925 2:24208049-24208071 CTGTGTGGGCAGGAGCCCCAGGG + Intronic
927702062 2:25275221-25275243 CCGTGTGGGCTGGAGGAGCGAGG + Intronic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
927943193 2:27118651-27118673 CCCTGAGGGCAGGTGGAGGAAGG - Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928635638 2:33243097-33243119 ATGTCTGGGCAGGAGCTGGATGG - Intronic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
929602274 2:43211825-43211847 CTGAGTGGGCCTGAGGAGGAAGG + Intergenic
929765726 2:44842743-44842765 CTGTGAGGGCAGGTGGATGCGGG + Intergenic
929852204 2:45602736-45602758 CTGGGTTGGCAGGAGCATGATGG - Intronic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
930242380 2:48949288-48949310 CTATGTGAGTTGGAGGAGGATGG - Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930909071 2:56608460-56608482 CATTATGGGCAGGAGGAAGAGGG - Intergenic
931874213 2:66494782-66494804 CTTTGTGGGTAGAAGAAGGAAGG + Intronic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
932777866 2:74539265-74539287 CTTTGTGGGCAGCATGGGGATGG + Intronic
932813493 2:74843605-74843627 CTGAGTGGGCAGGAGGTGGGTGG - Intronic
933760237 2:85667595-85667617 CTGGATGGGCAGGAGGAGAGTGG - Intronic
934712550 2:96525521-96525543 CTGAGTGGGCACTTGGAGGAAGG - Intergenic
934965969 2:98722921-98722943 CTGTCTTGCCAGGAGGAGCATGG - Intronic
934980233 2:98833410-98833432 CTGTGTGTGCAGCAGGCTGAGGG + Intronic
935175386 2:100644199-100644221 TTGTGTCTGCGGGAGGAGGAAGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
935571983 2:104671325-104671347 CTTTGAGGGCTGGAAGAGGATGG + Intergenic
935598382 2:104897489-104897511 CTGAGTGGGCTGTAGGGGGAGGG - Intergenic
935646848 2:105344283-105344305 CTTTGTGGGAGAGAGGAGGAAGG + Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
935998342 2:108798794-108798816 AGGTGTGGAGAGGAGGAGGAAGG - Intronic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936371267 2:111904150-111904172 GTATGGGGGCAGGAGTAGGAGGG - Intronic
936642495 2:114330571-114330593 CCCTGTGGGCTGAAGGAGGATGG + Intergenic
936876156 2:117192129-117192151 CTGTGTGGGAAGGAAAGGGAAGG - Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937273684 2:120671023-120671045 CTCTGGGGGCAGGGGGAGGAGGG + Intergenic
937295570 2:120807902-120807924 CTGGGTGGGCAGGGTGGGGAGGG + Intronic
937797388 2:126039942-126039964 GTGTGTGGGCAGGGGGAGCTGGG - Intergenic
937872501 2:126796254-126796276 CTATGTGGGCAGGGAGAGGGCGG - Intergenic
937978496 2:127596582-127596604 CACTGTGGGCAGGAGTAGGCTGG - Intronic
938118976 2:128620616-128620638 CTGTGAGGGCATTAGGAGGCAGG + Intergenic
938122178 2:128641800-128641822 CTGTGTGGGCAGGCAGAGGCTGG + Intergenic
938250591 2:129812900-129812922 GTGTGTGGGCAGGTGTGGGAGGG - Intergenic
938268148 2:129944263-129944285 GTGTGTGGGCGGCAGGAGAATGG + Intergenic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
939889627 2:147721236-147721258 TTATGTGGGCAGGAAGAAGATGG - Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
941177562 2:162217385-162217407 CTGAGTGTGCAGTAGGAGAATGG - Intronic
941599456 2:167523344-167523366 ATGTGTGGGCAAGAGCAGAATGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
942959341 2:181811337-181811359 TTATGTGGGCAGGAGGAGGGGGG + Intergenic
943657965 2:190529316-190529338 CTGGGAGGGAAGGTGGAGGAGGG - Intronic
943683963 2:190796931-190796953 CTGTGTGGGAAGTCTGAGGAGGG + Intergenic
944012630 2:194992188-194992210 CTCTCTGGGCAGGTGGGGGAGGG + Intergenic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
946688512 2:222294300-222294322 CACTGGGGGCGGGAGGAGGAAGG + Exonic
946715862 2:222554706-222554728 TTGTGTGGGAAGGTGGAGAAGGG + Intronic
947370035 2:229436093-229436115 TTGAGTGGGGAGGAGGATGAGGG - Intronic
947463023 2:230319503-230319525 CTGGGTGGGGAGGAGGATGCAGG + Intergenic
947618962 2:231576473-231576495 CTTTGTGGGGAGGAAGAGGATGG + Intergenic
947937483 2:234020679-234020701 CTGTGTGGGGTAGAGGATGAGGG + Intergenic
948059102 2:235030627-235030649 CTGAGCTGGGAGGAGGAGGAGGG + Intronic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948201939 2:236135898-236135920 CTGGGAGGGCAGCAGGAGGCAGG - Intergenic
948217219 2:236240629-236240651 TTGAGTGGGCAGGGGGAGGAGGG + Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948649343 2:239430299-239430321 CTGTGTGGACAGGATGACAAAGG - Intergenic
948737522 2:240018940-240018962 TGGTGGGGGCAGGAGCAGGATGG - Intronic
948938279 2:241182552-241182574 CTGAGTGGGAAGGAGGAGGGTGG + Intronic
948995445 2:241576064-241576086 CTGGCAGGGGAGGAGGAGGAGGG - Intergenic
1168875931 20:1172106-1172128 CTCTGTGGGGGAGAGGAGGAGGG - Intronic
1169244429 20:4015045-4015067 CTGGGAGGCTAGGAGGAGGATGG - Intronic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1170534324 20:17324956-17324978 CTGTGTGGCAAGGAGAAGCATGG - Intronic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1170718230 20:18850831-18850853 CTGTGTGGGCAGTTGGGGGCTGG - Intergenic
1170734936 20:19006396-19006418 CTTTCTTGGCAGGAGGAGGTGGG + Intergenic
1171210027 20:23309829-23309851 GTGAGGGGGCAGGAGAAGGAGGG - Intergenic
1171305536 20:24102646-24102668 CTGTGTGGCCATGGGCAGGATGG - Intergenic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172235449 20:33369862-33369884 GTGTTTGGGCAGGAGGTTGAAGG - Intronic
1172803027 20:37591578-37591600 CTGTGTGGGTTTGGGGAGGAAGG - Intergenic
1172820473 20:37728838-37728860 CTGTGTGTGAGGGAGGAGGTTGG + Intronic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1173643509 20:44619464-44619486 CGATGTGGGCAGGATGAGCATGG - Intronic
1173863387 20:46298588-46298610 GTGGGTGGGCTGGAGGATGATGG + Intronic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174388748 20:50203910-50203932 ATGTGGGGGCAGGAGTGGGAGGG - Intergenic
1175394096 20:58646911-58646933 CTGTGGCTGCAGGATGAGGAGGG + Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1175801825 20:61805366-61805388 CTGTGTTGGCAGATGGAGGTGGG + Intronic
1175891483 20:62317930-62317952 GTATGAGGGAAGGAGGAGGATGG + Intronic
1175970691 20:62685234-62685256 GTGTGGGGGCAGGAGGAGGGGGG + Intronic
1176121118 20:63455023-63455045 CTGCCTGGGCAGGAGGGGGCGGG - Intronic
1176160475 20:63645158-63645180 AGGAGTGGGAAGGAGGAGGAGGG - Intronic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176598236 21:8767587-8767609 TGGGGTGGGCAGGGGGAGGAGGG - Intergenic
1177776060 21:25567609-25567631 CTGAGAGGGCAAGAGAAGGAAGG + Intergenic
1177895236 21:26849277-26849299 CTGTGAGGGCATGATGTGGAGGG - Intergenic
1178170633 21:30035764-30035786 CTGGGGGGGTAGGGGGAGGAAGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178787391 21:35666414-35666436 CTTGGTGTGAAGGAGGAGGAAGG - Intronic
1179051924 21:37895755-37895777 CTGTCAGGGCAGGAGAGGGAGGG - Intronic
1179730025 21:43362490-43362512 CTGCCTGGGCGGGAGGAGGTGGG - Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1179931673 21:44574905-44574927 CTGGGTTGGCAGGAGGAGGTGGG - Exonic
1179937077 21:44612791-44612813 CTGGGCTGGCAGGAGGAGGCAGG - Exonic
1180128574 21:45809450-45809472 GTGTGCGAGCAAGAGGAGGAAGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1181940261 22:26470339-26470361 GTCTCTGGGCAGCAGGAGGAGGG + Intronic
1181971198 22:26691365-26691387 CTGGGTAGGTTGGAGGAGGATGG + Intergenic
1182319601 22:29470157-29470179 ATGTCTGGGGAGGAGGAGAAGGG + Intergenic
1182772036 22:32802847-32802869 GTGTGTGGGGAGGGGGAGAATGG + Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183168640 22:36167130-36167152 AAGAGTGGGAAGGAGGAGGAGGG + Intergenic
1183261495 22:36798578-36798600 CTGTGTGGAATGCAGGAGGAGGG - Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183356286 22:37361512-37361534 GTGTCTGGGCAGGAGCAGGGTGG - Intergenic
1183359933 22:37378203-37378225 TTGTGTGTGCAGGGGCAGGAAGG + Intronic
1183404464 22:37623674-37623696 AGGTGGGGGCAGGAGGTGGAGGG - Intronic
1183494609 22:38135483-38135505 CAGTGTGGTAAGGAGGTGGAGGG - Intronic
1183597732 22:38822522-38822544 GTGCGTGGGCAGGCTGAGGAGGG + Exonic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183606506 22:38869583-38869605 CCATGTGGGGAGGAAGAGGAAGG - Intronic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1183936516 22:41265526-41265548 CTGTTCGTGCAGGAGGAGGGAGG + Intronic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184072124 22:42152853-42152875 GTCTGTGGGCGGGAGGAAGAGGG - Intergenic
1184325739 22:43782935-43782957 CTGTTGGGGCAGGGGGAGGCAGG - Intronic
1184412335 22:44332379-44332401 GGGAGTGGGGAGGAGGAGGAAGG - Intergenic
1184420772 22:44381758-44381780 CAGTGTGGGGAGGAAGGGGAAGG + Intergenic
1184656904 22:45946472-45946494 CGGTGGGGGCAGGAGAACGAAGG - Intronic
1184815815 22:46868923-46868945 CTGTGTGGGTAGGAGTAGGTGGG + Intronic
1184996510 22:48211028-48211050 CTGTGGGAGCAAGAGGAGAAGGG + Intergenic
1185025453 22:48407479-48407501 CGGTGTGGGCAGGAGGGAAAAGG - Intergenic
1185161078 22:49230252-49230274 CTGAGTGGGCAGGGGGACGCTGG - Intergenic
1185181842 22:49368232-49368254 CTGTTTGGGCACCTGGAGGATGG - Intergenic
949152888 3:791695-791717 CTGTCTGGGGCGGAGGAGGGTGG + Intergenic
949399209 3:3648002-3648024 GTGTGTGGGGAAGAGAAGGACGG + Intergenic
949518351 3:4827179-4827201 CTGTCGGGGCAGGAGCAGGAGGG - Intronic
950103284 3:10371548-10371570 GTGTGTGGGCAGGGGGAGTGGGG + Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950219831 3:11186043-11186065 CAAGGTGGGCAGGAGGAGCAAGG - Intronic
950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG + Intronic
950346687 3:12301727-12301749 GTGTGGTGGCAGGAGGAGAATGG - Intronic
950449747 3:13058961-13058983 CTCTGGGTGCAGGAGGTGGATGG + Intronic
950618090 3:14178465-14178487 CGGCGTGAGGAGGAGGAGGAGGG - Exonic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
950702881 3:14762181-14762203 CTGTGTGGGGAGGCTGAGGCAGG - Intronic
950961333 3:17111162-17111184 GTGTGTGGGCTGAAGAAGGAAGG - Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951502050 3:23399440-23399462 CTGTATGGGCTGGAGTAGGGTGG + Intronic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
951979284 3:28547971-28547993 ATGCATGGGCAGGAGGAGAATGG + Intergenic
952750014 3:36817425-36817447 CTGTATGTGCTGGAGGAGGTAGG - Intergenic
953027283 3:39152567-39152589 CTGGGTGGGCAGCAGGAGACGGG + Intronic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
953271389 3:41448641-41448663 CTGTAAGGGCAGGAGGATGGTGG + Intronic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954132075 3:48566018-48566040 CTGTGTGGGGAGTGGGATGATGG - Intronic
954595936 3:51824730-51824752 CTGTGCGTTAAGGAGGAGGATGG - Intronic
954683927 3:52360435-52360457 CAGTGTGGGAAGGAGCAAGAGGG - Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
955026347 3:55171335-55171357 ATGTGTGGGCAGGTGAATGAAGG + Intergenic
955589160 3:60515323-60515345 ATGTGGTGGGAGGAGGAGGAAGG + Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
955914695 3:63894960-63894982 TTGTTGGGGGAGGAGGAGGAGGG - Intronic
956470931 3:69566207-69566229 GTGTGTGGGCAAGGTGAGGAGGG - Intergenic
956932704 3:74063645-74063667 TTGTTTGGGCAGCAGCAGGAGGG - Intergenic
957193890 3:77042766-77042788 CTTTGGGGGCAGGAGAAGGGTGG - Intronic
957196284 3:77072370-77072392 TAGTGTGGGCGGCAGGAGGAGGG - Intronic
957430634 3:80101172-80101194 CATTGTAGGCAGGAGGAAGAAGG + Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
958552770 3:95637714-95637736 TTATGTGGGCAGAGGGAGGATGG + Intergenic
958630548 3:96677234-96677256 CGCTGAGGACAGGAGGAGGAGGG + Intergenic
958883483 3:99699416-99699438 ATGTGAGAGCAGGAAGAGGAAGG - Intronic
958980414 3:100712492-100712514 TTCTTGGGGCAGGAGGAGGAAGG + Intronic
959984144 3:112554437-112554459 TTTTGTGGGCAGGGGGTGGATGG - Intronic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960438168 3:117653110-117653132 GTGTGTGGGCAGGGGGTGTATGG + Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961115208 3:124323394-124323416 CCCTGTGGGCAGGGGGTGGATGG + Intronic
961387452 3:126530462-126530484 TTCTGTGGGCAGGGGGTGGAGGG - Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961740761 3:129031964-129031986 CTGGGTGGAGAGGAAGAGGAGGG + Intronic
961771728 3:129254964-129254986 CTCTGTGGGCAAAAGGAGCAGGG - Exonic
961905561 3:130259608-130259630 CTGTGTGGGCAGGAACAAGCAGG - Intergenic
962264349 3:133934829-133934851 ACCTGTGGGCAGGAGGAGGCAGG + Exonic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962756391 3:138468250-138468272 AGGTGTGTGCAGGTGGAGGAAGG + Intronic
962842543 3:139249003-139249025 ATGTGTTGCAAGGAGGAGGATGG - Intronic
962848199 3:139288948-139288970 AGGTGTGGGCTGGAGTAGGAGGG + Intronic
962941099 3:140125402-140125424 CCGGGTGGGCATGGGGAGGAGGG + Intronic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
965200603 3:165653333-165653355 CTGTGAGGGTAGGAGCAAGATGG - Intergenic
966695279 3:182783750-182783772 CAGAGGGGGCAAGAGGAGGAAGG + Intergenic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967880336 3:194297217-194297239 CGGAGGGGGCAGGAGGGGGAGGG - Intergenic
968044543 3:195616669-195616691 CTGTGTGGGCTGGACCAAGAAGG + Intergenic
968044682 3:195617361-195617383 CTGTGTGGGCTGGACCAAGAAGG + Intergenic
968060331 3:195722720-195722742 CTGTGTGGGCTGGACCAAGAAGG + Intronic
968359557 3:198137667-198137689 CTGTGTGGTCAGGAGCTGGGAGG + Intergenic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
968473466 4:792216-792238 CGCTGTGGTCAGGAGCAGGAGGG + Intronic
968555672 4:1245419-1245441 CTGTGTTGGGAAGGGGAGGAAGG - Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968751048 4:2389213-2389235 CTGTGTGGGCAGGACCTGGCTGG - Intronic
968771730 4:2511805-2511827 CTCTGTGGGTGGGAGGAGGGTGG + Intronic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969321703 4:6416780-6416802 CTGGCAGGGCTGGAGGAGGAGGG + Intronic
969409603 4:7019495-7019517 CTTTATGGGCATGTGGAGGAGGG + Intronic
969439164 4:7207329-7207351 CTGTGTGGGCGGGAGGGGCTCGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969554623 4:7898057-7898079 CTGGTTGGGAAGGATGAGGAAGG - Intronic
969810051 4:9640675-9640697 ATGGCTGGGCAGGTGGAGGAGGG - Intergenic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970240203 4:14001364-14001386 ATTTGAGGGCAGGAGCAGGAGGG - Intergenic
970539794 4:17065982-17066004 CTATCTGAGCAGGAGAAGGATGG + Intergenic
970853011 4:20624258-20624280 TTGTGAGGGGAAGAGGAGGAAGG - Intergenic
971141764 4:23932327-23932349 CCCTGGAGGCAGGAGGAGGATGG - Intergenic
971455381 4:26839507-26839529 ATGTGTGGGAAGGAGCATGAGGG + Intergenic
971555129 4:28003739-28003761 CTGTGTGGTAAGTAGGAGCATGG + Intergenic
973272571 4:48276543-48276565 CTGTCTTGGCAGGGGAAGGAGGG - Intergenic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
973982919 4:56321338-56321360 ATCTCTGGGTAGGAGGAGGAGGG - Intronic
975282057 4:72572183-72572205 CCATGTGGACAGGAAGAGGAAGG - Intergenic
975473349 4:74794554-74794576 GGGTGTGTGCAGGAGGAGGGGGG - Exonic
975663995 4:76716032-76716054 TTTTGTGGGCAAGAGGAGGAGGG - Intronic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
976211402 4:82675215-82675237 GTGTGTGGGCAGGAGGTACATGG + Intronic
976246483 4:83010832-83010854 CGGGGAGGGGAGGAGGAGGAAGG - Intronic
976656825 4:87497412-87497434 CTGCTTGGGCAGTAGGCGGATGG - Intronic
976667485 4:87612434-87612456 CTAAGTGGGCAGAAGTAGGAGGG + Exonic
977230473 4:94446574-94446596 CTGGGTGGGATGGAGCAGGACGG - Intergenic
977331321 4:95641108-95641130 ATCTATGGGCTGGAGGAGGAGGG - Intergenic
977390158 4:96399020-96399042 CTGTGTGGACAGGGGAAAGAAGG - Intergenic
977762707 4:100758913-100758935 CATTGTGGGCAGGTGGAGGTAGG + Intronic
978351590 4:107825266-107825288 CGGAGGGGCCAGGAGGAGGATGG + Intronic
978546072 4:109873931-109873953 CTGGGTGGGACGGAGCAGGATGG + Intergenic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982068025 4:151671814-151671836 CTGTGTGGGCAGGGGGAGTGAGG + Intronic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982330301 4:154174945-154174967 GTGTGTGGGCAAGCGGAAGATGG - Intergenic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
983028039 4:162761277-162761299 TTGTGTGGGCAGGAGGAACAAGG - Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984319104 4:178168499-178168521 CTGTGTGGGCATGAAGAGTTTGG + Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984675975 4:182548140-182548162 CTGTGAGCCCAGGAGGTGGAGGG + Intronic
984711649 4:182890516-182890538 CTGCGTTGGCATGCGGAGGAGGG + Exonic
984883445 4:184429805-184429827 TTGTGTGGACTGGCGGAGGAAGG - Intronic
984894892 4:184529602-184529624 TTGTGTGGGCAGGACCAGCAGGG - Intergenic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985619790 5:948135-948157 AGGCGTGGGAAGGAGGAGGAAGG + Intergenic
985630756 5:1012786-1012808 CTGGGTGGCCAGGAGGGGCAGGG - Intronic
985646908 5:1089225-1089247 CCGTGGGGGCAGGAGGGGGCAGG + Intronic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
985776745 5:1848330-1848352 CTTTGATGGCAGGAGGAGGTTGG + Intergenic
986493369 5:8316889-8316911 CTTGGTGGGCAGGAGGATGGGGG + Intergenic
986581459 5:9270701-9270723 GGGTGGGGGCAGGGGGAGGAGGG + Intronic
986658635 5:10039401-10039423 GCATGAGGGCAGGAGGAGGATGG + Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
987491264 5:18582908-18582930 CTGTGAGGCCAGGAGCAAGATGG + Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
988997119 5:36725171-36725193 GTGTGTGGGAGGGAGTAGGAAGG + Intergenic
989181056 5:38577520-38577542 GTCAGTGGGCAGGAAGAGGAGGG - Intronic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990805488 5:59656000-59656022 TTGTGTGTGTAGGAGGAGGGGGG - Intronic
991290376 5:65028217-65028239 CTGTGTTGTCGGGAGCAGGATGG - Intergenic
991594857 5:68292948-68292970 CTATGTGGGCAGGAGGAATATGG + Intronic
992013548 5:72554611-72554633 CTGAGTGGGGAGGGGCAGGAAGG - Intergenic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993909307 5:93661905-93661927 CTGAGTGGGCAGAAAGAGTAAGG + Intronic
995021748 5:107374384-107374406 CTGTTTGGAAAGGAGGAGGTGGG + Intergenic
995553084 5:113299773-113299795 AGGTGTGGGCAGGAGGTGGCAGG + Intronic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
997016768 5:129945236-129945258 CTCTGTGGGCAGGAGGAATGTGG + Intronic
998385526 5:141755017-141755039 CTGTGGGGGCTGGGGAAGGAGGG + Intergenic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
999206364 5:149851099-149851121 CTTTGCGGGCAGGAGAAGGAAGG + Exonic
999270187 5:150292171-150292193 CTATGTGGGGAGGTGGGGGAGGG + Intergenic
999438675 5:151584268-151584290 CTGTGTGGGCAGGCCGGGCAGGG - Intergenic
999475192 5:151891794-151891816 CTGTTTGGGGAGGAGCAGGGTGG + Intronic
999922356 5:156335652-156335674 CTTGGAGGGCAGGAGGGGGATGG - Intronic
1000245077 5:159442381-159442403 CTGAGAGCGCAGGAGGAGGAAGG - Intergenic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001197835 5:169689553-169689575 CTGTGTGTGCAGGAGTGAGACGG - Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001734639 5:173988713-173988735 CTGCGTGGGCTGCAGGAGTAGGG - Intronic
1001835160 5:174825375-174825397 GGGTGTGGGAAGGAAGAGGAAGG - Intergenic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002109393 5:176898103-176898125 GTGTGTGGGAATGGGGAGGAGGG - Intronic
1002169185 5:177366013-177366035 CTGAGTGGGAGGGAGGAGGGAGG + Intronic
1002211598 5:177602626-177602648 GTGTGAGGGCTGGAGCAGGAAGG + Intronic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002578714 5:180194152-180194174 CTGTGTGAGCCGGACGGGGAGGG + Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002744694 5:181461076-181461098 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1002829274 6:804514-804536 CTGCGGGGGAAGGAGGAGCATGG + Intergenic
1003087703 6:3074179-3074201 CTGAGTGGGCAGGGGCATGAAGG - Intronic
1003160758 6:3632190-3632212 CTGGGTGGGATGGAGCAGGATGG + Intergenic
1003271709 6:4613430-4613452 CTGGCTGGGAAGGAGCAGGATGG - Intergenic
1003490691 6:6618938-6618960 GTATGAGGGGAGGAGGAGGAGGG + Intronic
1003616197 6:7657364-7657386 CTGTGTGGGCTGGAGGGGTCTGG + Intergenic
1003788640 6:9516652-9516674 CTTCCTTGGCAGGAGGAGGAAGG + Intergenic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1003887662 6:10535758-10535780 CTTTGTGGGCGGTGGGAGGAAGG + Intronic
1004057787 6:12158542-12158564 TTGTGGGGCAAGGAGGAGGATGG + Intronic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004772064 6:18795449-18795471 GTGTGGGGGCAGGGTGAGGAAGG - Intergenic
1005276983 6:24229955-24229977 CTGTGTGGCCAAGAGCAGGCTGG - Intronic
1005870726 6:29972616-29972638 CTGGGAGGGCAGGAGGATGGAGG + Intergenic
1006056703 6:31390577-31390599 CTGCATGGGCACTAGGAGGATGG - Intergenic
1006069423 6:31487492-31487514 CTGCATGGGCACTAGGAGGATGG - Intergenic
1006390329 6:33754584-33754606 GTGTGTGGGCAGGCCAAGGATGG - Intergenic
1006582861 6:35086788-35086810 CCCTGGGGGCAGGCGGAGGAGGG - Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006642060 6:35494666-35494688 CTGGGCGGGGAGGAGGAGGAGGG + Intronic
1006944519 6:37776506-37776528 CTGAGTGGGCATGAGCACGAAGG + Intergenic
1007222759 6:40292118-40292140 GTGTGGAGGCAGGAGAAGGAAGG + Intergenic
1007836668 6:44679084-44679106 CCGTGTTGTCAGGATGAGGACGG - Intergenic
1007945833 6:45826092-45826114 CAGTGTGGGCTGGAGAAGTAGGG - Intergenic
1008699423 6:54080955-54080977 CTGTGAGGTCAGGGTGAGGATGG - Intronic
1010408673 6:75535656-75535678 CTGGGTGGGATGGAGTAGGATGG + Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011556247 6:88573792-88573814 CTGTGTGCTCTGGAGAAGGAGGG - Intergenic
1011586659 6:88933403-88933425 GTGTGTGGGCAGGAGGAGCATGG - Intronic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1011921797 6:92586658-92586680 CTGTAAGGGCAGGAGTGGGAGGG + Intergenic
1012394139 6:98776228-98776250 GGGTGGGGGCTGGAGGAGGAGGG + Intergenic
1013298661 6:108782330-108782352 CTCTGTGGGATGGAGGGGGAAGG + Intergenic
1014258116 6:119184572-119184594 CTGAGGAGGCAGGAGTAGGAAGG + Intronic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015464106 6:133528702-133528724 CTGTGTGGTTAGGAGAAGGAGGG - Intronic
1015496582 6:133889559-133889581 CGGCCTGGGCAAGAGGAGGAAGG + Exonic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1016984782 6:149887079-149887101 CTGTCTGGGCAGGAGCAGGCAGG - Intronic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1017513206 6:155132424-155132446 CTCTGTGTGAAGGAAGAGGAGGG - Intronic
1017810727 6:157981791-157981813 GCGAGTGGGGAGGAGGAGGAAGG + Intergenic
1018188209 6:161286377-161286399 CTGTGAGGGACGGAGGAGGCTGG + Intergenic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018678448 6:166243080-166243102 CAGTGTGGGGAGGATGAGGGAGG - Intergenic
1018792856 6:167162688-167162710 ATGTATGGGCAGGAGGGGTATGG + Intronic
1018863431 6:167729903-167729925 GTGTGAGGGCAGGAGGTGGATGG + Intergenic
1018890023 6:167976663-167976685 CTGTGCGGGGAGGAGGAGGCAGG + Intergenic
1018926436 6:168209932-168209954 CTCTGTGGGGAGCAGGAGGCCGG - Intergenic
1019060854 6:169256372-169256394 ATGTGTGCGCGGGAGGATGAGGG + Intergenic
1019079384 6:169419817-169419839 CTGTGCGGGGAGGAGGAGGTGGG + Intergenic
1019080197 6:169425104-169425126 ATCTGTGCGCAGGAGGAGGCTGG + Intergenic
1019102250 6:169641008-169641030 CTGTGCTGGTAGGAGGAGGTGGG - Intronic
1019249605 6:170734617-170734639 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1019253983 7:36864-36886 CTGTGTGGGCAACAGAAGGAAGG + Intergenic
1019260440 7:79008-79030 CTGTGTGGTCAGGAGCTGGGAGG - Intergenic
1019347861 7:539426-539448 GTGTGTGGGCAGGTAGAGGAGGG - Intergenic
1019611888 7:1940945-1940967 CTGCGGGGGGAGGAAGAGGAGGG - Intronic
1019729550 7:2622679-2622701 AGGTGGGGGCAGGAGGAGCAGGG - Intergenic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1019777110 7:2918450-2918472 CTGTGGGGGCAGCAGGGGCAGGG - Intronic
1019796551 7:3054206-3054228 CTGAGTGTGCAGGAGGAGAGTGG + Intergenic
1020152840 7:5696785-5696807 CTGGGAGGGCTGTAGGAGGACGG + Intronic
1020278378 7:6637696-6637718 CGGTCCGGGCAGGAGGCGGAGGG + Intronic
1020899176 7:13982614-13982636 GTGTGTGGGCGGGGAGAGGATGG - Intronic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1021982087 7:26064996-26065018 CTGTGTGGGGAAGGGGAGGCTGG - Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1022478470 7:30727432-30727454 CTCTGGAGGCAGGAGGAGGGAGG + Intronic
1022516382 7:30977379-30977401 CTGAGTGGGAGAGAGGAGGAGGG - Intronic
1022541474 7:31139781-31139803 AGGGGTGGGCAGGAGGGGGAGGG - Intergenic
1023125386 7:36949792-36949814 CTGGGTGGGGTGGTGGAGGAGGG - Intronic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023847208 7:44129082-44129104 GTGTGTTGGCAGCAGGAGGGAGG + Intergenic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1024217830 7:47263011-47263033 CTGTGTGGGGAGGAGGGTGTTGG - Intergenic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1024903330 7:54347386-54347408 CTGTGTGAGCCGGTGGGGGAGGG + Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1026124718 7:67569435-67569457 ATGAGTGGGTGGGAGGAGGAGGG - Intergenic
1026402414 7:70028135-70028157 CTGTGTTGGCAGGAAGGAGAGGG - Intronic
1026769277 7:73184059-73184081 TTGGGTGGGCAAGTGGAGGAAGG + Intergenic
1026897986 7:74021617-74021639 GTGGGTGGGCAGGAGGACAAAGG + Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027010147 7:74737442-74737464 TTGGGTGGGCAAGTGGAGGAAGG + Intronic
1027077895 7:75208593-75208615 TTGGGTGGGCAAGTGGAGGAAGG - Intergenic
1027163232 7:75817273-75817295 GTGTGTGGGGAGGAGGAAGTTGG + Intronic
1027226725 7:76248302-76248324 CTGTGTGGGGATGAGGGAGAGGG + Intronic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1028952599 7:96653801-96653823 CTGTGTTGTTAGGTGGAGGATGG - Intronic
1029537174 7:101163612-101163634 CTGTTCGCGGAGGAGGAGGACGG - Exonic
1029688267 7:102163719-102163741 CGGGCTGGGCAGGAAGAGGAGGG + Intronic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1032537644 7:132678103-132678125 ATGAGTGGGGAGGTGGAGGAAGG - Intronic
1032628131 7:133615264-133615286 ATGAGGGGGGAGGAGGAGGAGGG - Intronic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1032667795 7:134054295-134054317 CTGGGTGGCGAGGAGGAGGTGGG - Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033208794 7:139445021-139445043 CTTAGTGGAAAGGAGGAGGAAGG - Intergenic
1034014669 7:147569279-147569301 CAGTGTGGGCAGGAGGAAATGGG + Intronic
1034271770 7:149806566-149806588 CTGTGAGGGTAGGGGCAGGAGGG + Intergenic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034343801 7:150373547-150373569 CTCTTTGGGAAGGAAGAGGATGG - Intronic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034497869 7:151432989-151433011 CCGTGAGGGCAGGAGGGGGCAGG - Intronic
1034970985 7:155418959-155418981 CTCTGTGAGGAGGTGGAGGAAGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035264696 7:157684605-157684627 CTGTGTGGGCCGGAGGGAGGGGG - Intronic
1035339453 7:158151144-158151166 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339480 7:158151254-158151276 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339490 7:158151291-158151313 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339500 7:158151327-158151349 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339510 7:158151364-158151386 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339520 7:158151401-158151423 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339540 7:158151475-158151497 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035498491 8:73039-73061 AGGAGTGGGGAGGAGGAGGAGGG - Intronic
1036066356 8:5385337-5385359 GTGTGAGTGCTGGAGGAGGAGGG - Intergenic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1037583679 8:20261894-20261916 CTGAGTGGGAGGGAGGAGGCAGG - Intronic
1037769241 8:21789283-21789305 CTGCGGGGGGAGGAGGAGGAGGG - Intronic
1037896353 8:22658899-22658921 CTGTCTCGGCAAGAGCAGGAAGG + Intronic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038040122 8:23717217-23717239 CTGTCTGGGGAGGAGGTAGAAGG - Intergenic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038401421 8:27287477-27287499 CAGTGTGGGCATTAGGAAGAGGG + Exonic
1038542768 8:28402751-28402773 CTGTGTGTGCAGGAGGCAGGAGG - Intronic
1038876066 8:31550953-31550975 CTGAGTGGGATGGAGCAGGATGG + Intergenic
1039256901 8:35729036-35729058 ATGTTTGGGCAGGAGGAGTGGGG + Intronic
1039375968 8:37034531-37034553 ATGTGTGGATAGGAGGAGAAGGG - Intergenic
1041091910 8:54309933-54309955 CTGTGAGGGGAAGAGAAGGAAGG - Intergenic
1041318911 8:56593712-56593734 GAGTGTGGGCTGGAGGAGGCAGG + Intergenic
1041643718 8:60229790-60229812 ATGTCTAGGCAGGAGGGGGAAGG - Intronic
1041697149 8:60748105-60748127 CTGTGTGAGCAGGAAGATGCAGG + Intronic
1041714426 8:60921441-60921463 CCGGGAGGGCAGGGGGAGGAGGG - Intergenic
1041811905 8:61921183-61921205 ATGTGTGTGCAGGAGGTGTACGG - Intergenic
1042109679 8:65367485-65367507 CTGCTTGGGCAAGAGGTGGAGGG - Intergenic
1042132934 8:65606922-65606944 GTGTGTGGGCCAGAGGTGGAGGG - Intronic
1042226751 8:66520415-66520437 CCGAGTGGGAAGGAGGAGGTGGG - Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1043878156 8:85509912-85509934 CTATGTGGGACTGAGGAGGAGGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1044832934 8:96267878-96267900 ATGTGTGGGCAGGAGGTGGCGGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1045788541 8:105955011-105955033 CAGTGGGGGCAGGAGCAGGATGG + Intergenic
1046015732 8:108602960-108602982 TTGTGTGGGGAGTAGGAGGGAGG + Intergenic
1046046715 8:108973601-108973623 GTTTGGGGGAAGGAGGAGGATGG - Intergenic
1047315303 8:123727632-123727654 GTGTGTGGGCGGGGGGAGGGGGG - Intronic
1047326093 8:123837256-123837278 TTTTGAGGGCAGGAGGTGGAGGG + Intergenic
1047625575 8:126652754-126652776 CTGTGGGGGCAAGAGAAAGAAGG - Intergenic
1048173715 8:132132642-132132664 GTGTGTGTGCAGGTGGAGAAGGG + Intronic
1048292711 8:133192697-133192719 CTGGGAGGGCAGGGAGAGGATGG + Intronic
1048329415 8:133461847-133461869 CCCTGTGGGCAGGGGGAGGGTGG + Intronic
1048329952 8:133464646-133464668 TTGTGTGTGCCGGAGGAGGCTGG + Intronic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1049073123 8:140372472-140372494 GTGTGTGGACAGGTGAAGGAAGG - Intronic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049322041 8:142001781-142001803 CTGAGGGGGTAGGAGGAGCAAGG - Intergenic
1049372193 8:142273217-142273239 CTGGGACGGCAGGAGGACGATGG - Intronic
1049412878 8:142481268-142481290 CGGTGTGAGCTGGACGAGGAAGG + Exonic
1049574596 8:143384436-143384458 ATGTGTGGGCAGGGGTGGGACGG - Intergenic
1049603264 8:143517851-143517873 CTGTGTGTGCAGGTGGGGCAGGG - Intronic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1049816551 8:144605777-144605799 CTGGCTGGGCAGGATGACGATGG + Intronic
1050130418 9:2406551-2406573 CTGGGGGGCCAGGAGCAGGAAGG + Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1052311109 9:27070215-27070237 CTGGGTGGGAAGGAGTAGGATGG + Intergenic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053144718 9:35704590-35704612 CTGAGAGGGCTGGAGGAGGATGG + Intronic
1053173719 9:35908016-35908038 CTGTGAGGGCTGCAGGAGGAGGG + Intergenic
1053303668 9:36969242-36969264 CTGGGTGGGCCGGAGGAGCTGGG - Intronic
1053441558 9:38120540-38120562 CTCTGTGGTCAGGAGGACGGCGG + Intergenic
1054455262 9:65427115-65427137 CTGTGTGGGGACGAGGACCAGGG - Intergenic
1055130246 9:72766593-72766615 CTGTGTAGGCAGGAGGCAGGGGG + Intronic
1055944345 9:81679522-81679544 AGGTGTGGGCAGGAGGAGAGAGG - Intronic
1056438757 9:86598832-86598854 CTGTGTGGGGTGGGGTAGGAGGG - Intergenic
1056478820 9:86980256-86980278 CTCTGTGGTTAGGAGGAGGGAGG + Intergenic
1056639429 9:88357886-88357908 CTGTGGGGTCTGGAGGATGATGG - Intergenic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1056931370 9:90880724-90880746 CTGTGTGGGCAGGGCCAGGTAGG + Intronic
1056950372 9:91036578-91036600 GTGATGGGGCAGGAGGAGGAGGG - Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1057147121 9:92765478-92765500 GTCTGGGGGCGGGAGGAGGACGG + Intergenic
1057193532 9:93100718-93100740 AGGTGTGGGCAGAAGGAGAAAGG - Intronic
1057231407 9:93323785-93323807 CTGTGTGGGCCGGGGCAGGAGGG + Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057485882 9:95483750-95483772 ATGTGTGGCTAGGTGGAGGATGG - Intronic
1057740671 9:97708772-97708794 CTATGTGGCCAGGACGGGGAGGG + Intergenic
1058070609 9:100597626-100597648 CTGTGAGGGCTGAAGGATGAAGG - Intergenic
1058114788 9:101072483-101072505 CTGTGTGCCCAGGAAGAGAAGGG + Intronic
1058994378 9:110285372-110285394 GTGTGTGGGCAATGGGAGGAGGG + Intergenic
1059352709 9:113676940-113676962 CTGGGGGGGCAGGTGGAGGTGGG + Intergenic
1060005019 9:119992192-119992214 CTGACTGGGAGGGAGGAGGAGGG - Intergenic
1060481988 9:124021901-124021923 CTGGGTGGGCAGGTGGGGGCGGG + Intronic
1060620122 9:125057666-125057688 CCGAGTGTGGAGGAGGAGGAGGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061004351 9:127920157-127920179 CTGAGGGGGAAGGGGGAGGAAGG - Intergenic
1061192389 9:129089296-129089318 GGGTGTGGGGTGGAGGAGGAGGG + Exonic
1061682526 9:132250097-132250119 CTCTGTGGGCAGGAGGGGAAAGG - Intergenic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061942778 9:133892070-133892092 GGGTGTGGGGAGGAGGGGGAAGG + Intronic
1062035972 9:134382684-134382706 CTGAGTGGGCAGTATGAGGGTGG + Intronic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062239173 9:135526607-135526629 CTGGGTGGGAAGCAGGAGGAAGG + Intergenic
1062326851 9:136016636-136016658 CTGTGAGGGCAGGACTAGGTGGG - Intronic
1062387164 9:136317273-136317295 CTGCGTGGGCAGTCGGAGTAAGG + Intergenic
1062544187 9:137054292-137054314 CTGAGTGGGCGGGAAGGGGAAGG - Intergenic
1062744244 9:138201381-138201403 CTGTGTGGTCAGGAGCTGGGAGG + Intergenic
1062746415 9:138215679-138215701 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1203610505 Un_KI270748v1:91555-91577 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185975057 X:4710897-4710919 CCGTGTGTGCATTAGGAGGATGG + Intergenic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186471825 X:9827747-9827769 CTGTGTGGGGAGGTGGAGCAAGG + Intronic
1186557057 X:10570942-10570964 CTGTGTGGGCAACAGCAGCAAGG + Intronic
1188736858 X:33727396-33727418 GTGTGTGGGGAGGTGGGGGAGGG - Intergenic
1189279619 X:39812025-39812047 GTGTGTGGGTAGGGGGAGGTGGG - Intergenic
1189823975 X:44898516-44898538 CTGTGTGTGCAGGAGGGAGGTGG + Intronic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1190076720 X:47322416-47322438 CAGTGTGGGAGGGAGGAGGAGGG - Intergenic
1192180272 X:68911971-68911993 AGGTCTGGGGAGGAGGAGGATGG - Intergenic
1192555218 X:72083915-72083937 GTGTGTGGGCAGGGGGAGTAAGG - Intergenic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1194346276 X:92771073-92771095 GTGTGTGGACAAGAGGAGGTTGG + Intergenic
1195112123 X:101659118-101659140 CTGTGTGGGCCGGAGGTGTCTGG + Exonic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195728565 X:107941932-107941954 CTTTGGGAGCTGGAGGAGGAAGG - Intergenic
1195857968 X:109350924-109350946 CTTGGTGGGCAGGATGAGGTGGG + Intergenic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1197592738 X:128428545-128428567 TTGTTTGGGCAGGCAGAGGAAGG - Intergenic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197860622 X:130966224-130966246 CTGAGTTGGCAGTAGGAGGCTGG - Intergenic
1198119969 X:133582778-133582800 CTGTGTGGGCAGAATCAGAAGGG + Intronic
1198166785 X:134065419-134065441 CAGTGTGGGGAGGGGTAGGATGG - Intergenic
1198276450 X:135098847-135098869 CTGTGCGGGCTCGTGGAGGAGGG - Intergenic
1198542317 X:137652916-137652938 GTGTGTGTGTAGGAAGAGGAGGG + Intergenic
1198963632 X:142206038-142206060 CTGTCTGGACAGGAGAAGGAAGG - Intergenic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1201642506 Y:16194584-16194606 CTGTGGGTGCACTAGGAGGATGG - Intergenic
1201660308 Y:16390736-16390758 CTGTGGGTGCACTAGGAGGATGG + Intergenic
1201771410 Y:17620412-17620434 CTGTGTGGCAAGGATCAGGAAGG + Intergenic
1201830145 Y:18285574-18285596 CTGTGTGGCAAGGATCAGGAAGG - Intergenic