ID: 1146461171

View in Genome Browser
Species Human (GRCh38)
Location 17:33047031-33047053
Sequence AGCGCCTGAGATGGCCTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146461165_1146461171 22 Left 1146461165 17:33046986-33047008 CCTGCACTCGTGATGCCGCATGA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1146461171 17:33047031-33047053 AGCGCCTGAGATGGCCTCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 69
1146461167_1146461171 7 Left 1146461167 17:33047001-33047023 CCGCATGATTAAGGCTCTGCTGC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1146461171 17:33047031-33047053 AGCGCCTGAGATGGCCTCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 69
1146461164_1146461171 23 Left 1146461164 17:33046985-33047007 CCCTGCACTCGTGATGCCGCATG 0: 1
1: 0
2: 0
3: 6
4: 25
Right 1146461171 17:33047031-33047053 AGCGCCTGAGATGGCCTCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146461171 Original CRISPR AGCGCCTGAGATGGCCTCGC AGG Intronic