ID: 1146462626

View in Genome Browser
Species Human (GRCh38)
Location 17:33058212-33058234
Sequence GCCTGCCTTACCTACCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146462626_1146462630 21 Left 1146462626 17:33058212-33058234 CCTGGGAGGTAGGTAAGGCAGGC 0: 1
1: 0
2: 2
3: 28
4: 283
Right 1146462630 17:33058256-33058278 TTCAATGACAGACCTGAAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 146
1146462626_1146462632 29 Left 1146462626 17:33058212-33058234 CCTGGGAGGTAGGTAAGGCAGGC 0: 1
1: 0
2: 2
3: 28
4: 283
Right 1146462632 17:33058264-33058286 CAGACCTGAAGTTGGAACTTGGG 0: 1
1: 0
2: 1
3: 21
4: 211
1146462626_1146462628 -10 Left 1146462626 17:33058212-33058234 CCTGGGAGGTAGGTAAGGCAGGC 0: 1
1: 0
2: 2
3: 28
4: 283
Right 1146462628 17:33058225-33058247 TAAGGCAGGCTGGTAAACCGAGG 0: 1
1: 0
2: 1
3: 9
4: 119
1146462626_1146462631 28 Left 1146462626 17:33058212-33058234 CCTGGGAGGTAGGTAAGGCAGGC 0: 1
1: 0
2: 2
3: 28
4: 283
Right 1146462631 17:33058263-33058285 ACAGACCTGAAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 26
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146462626 Original CRISPR GCCTGCCTTACCTACCTCCC AGG (reversed) Intronic
900399563 1:2467442-2467464 GCCTTCCTCACCTTCCTCACGGG + Intronic
900878289 1:5361823-5361845 GCCTGCCTTAGCTTCCTACTGGG - Intergenic
901856355 1:12046740-12046762 GCCTTCCTTCCCTTCCTCCCTGG + Intergenic
902293791 1:15452279-15452301 GCATGTCTCACCCACCTCCCGGG + Intergenic
904420515 1:30387986-30388008 CCCAGCCTTGCCTACTTCCCTGG - Intergenic
905684424 1:39898639-39898661 GCCTGCCCCACCTCCTTCCCTGG + Intronic
905883074 1:41477005-41477027 GGCTGCCTTACCCAGCTGCCTGG + Intergenic
906107798 1:43305158-43305180 GCCTGCCTAACTCACCTCCAGGG - Exonic
907579475 1:55558667-55558689 GCCTGCATCTCCTAGCTCCCCGG + Intergenic
910106569 1:83637667-83637689 GCCTGCCTTGCCTACCTTAGAGG + Intergenic
910424480 1:87106005-87106027 ACCTGCTGTACCTACCTCACAGG + Exonic
910763868 1:90761512-90761534 GCCTGACTTTCCTAGATCCCAGG - Intergenic
913294804 1:117309032-117309054 TCCTGACCTGCCTACCTCCCAGG + Intergenic
914804370 1:150981913-150981935 GCCTGTCTGACCTGCCCCCCAGG + Intergenic
916275396 1:162988405-162988427 ACCTGCCTGGCCTATCTCCCTGG + Intergenic
918301352 1:183207025-183207047 GACTGCATTATCTGCCTCCCTGG - Intronic
919835978 1:201573622-201573644 GCCTGCTGTACCTATCTCCCAGG + Intergenic
920178965 1:204120818-204120840 GCCTACCCTACCTCACTCCCAGG - Intronic
920719625 1:208375044-208375066 GCCTGCCTTAGCTCTCTCCATGG - Intergenic
921080578 1:211735837-211735859 GCCTGCCCTGTCTGCCTCCCGGG - Intergenic
922415002 1:225413246-225413268 GCCTGCTGTCCCTACCCCCCAGG - Intronic
922594758 1:226805060-226805082 GCCTGCCTTAAACACCTCACTGG - Intergenic
1063065051 10:2599812-2599834 CCCTGCCTTGCCCACCCCCCAGG - Intergenic
1063463545 10:6229271-6229293 GACTGCCCTGCCGACCTCCCAGG - Intronic
1064381343 10:14844222-14844244 TCCTGCCCTGCCTACCTCACAGG + Intronic
1065329064 10:24574716-24574738 GGCTGCCTCCCCTACCTGCCTGG - Intergenic
1065457802 10:25925978-25926000 CCCTGCCATACTTACCTCCTAGG + Intergenic
1068982445 10:63075839-63075861 CCCTGCCTTACCTGTGTCCCTGG - Intergenic
1069418446 10:68223850-68223872 CCCTGCCTTGCCTTCCTCACAGG - Intergenic
1069597777 10:69683666-69683688 GCCTGCCTTTTCTCCCTCCCTGG + Intergenic
1070492594 10:76991749-76991771 GGCTGCCTTCCCTCCCTCCAAGG - Intronic
1072568700 10:96640046-96640068 GCTTCCCTTAGCAACCTCCCTGG - Intronic
1074489280 10:113924506-113924528 GCCTGGCTTCCCAACCTCCAAGG + Intergenic
1074762453 10:116677148-116677170 GCTTGCCTTACCTCCTTCACGGG + Intronic
1075305628 10:121365259-121365281 GCCTTCCTTACATACCTCAAAGG + Intergenic
1076498542 10:130915832-130915854 GCATGCCTTTCCTCCCTCACTGG - Intergenic
1076848213 10:133080375-133080397 CCCTGCCTTACCCACAGCCCTGG - Intronic
1077322020 11:1946927-1946949 GCCTGTCTGCCCTGCCTCCCGGG - Intergenic
1078432279 11:11297492-11297514 ACCTCCCTTGCCCACCTCCCTGG + Intronic
1078694983 11:13622142-13622164 ACTTGCCTTGCCTACCTCACTGG - Intergenic
1079083661 11:17430596-17430618 GACTTGCTTACATACCTCCCAGG - Intronic
1079135076 11:17771821-17771843 GCCTTCCTTACCTACATCGAGGG + Exonic
1080061155 11:27958412-27958434 CCCTGCATTAACTACCTCACAGG - Intergenic
1080349007 11:31359966-31359988 ATCTGCCTTACCTACCTCACAGG + Intronic
1080588240 11:33700185-33700207 GCCTGCCCTAGCTCCCTCCTTGG - Intronic
1081733643 11:45388808-45388830 TCCTGCCTTGCCCACCTCCCAGG - Intergenic
1082004793 11:47413575-47413597 TCCTGCCTTCCCTCCTTCCCAGG + Exonic
1082264902 11:50107844-50107866 GCTTGCCTTACCTATTTCTCTGG - Intergenic
1082741498 11:56916541-56916563 GCCTGCCTTCCCTCCCTCGTTGG - Intergenic
1082780937 11:57287027-57287049 CCGGGCCTTACCTGCCTCCCTGG - Intergenic
1083647792 11:64182903-64182925 GCTTTCCTTCCCTGCCTCCCAGG + Intergenic
1084008906 11:66337028-66337050 GCCTGCCTTGCCAATCTGCCAGG + Intergenic
1084698225 11:70768913-70768935 ACCTGCCTTCCCCACCCCCCTGG - Intronic
1084868459 11:72079798-72079820 ACCTGCCTTACCTACTTCCTGGG - Intronic
1087024151 11:93633325-93633347 GCCTTCTTTACCATCCTCCCAGG - Intergenic
1087278268 11:96182162-96182184 GTCTGCCTTACCTGCCTCCCAGG + Intronic
1087842080 11:102930928-102930950 ACTTGCCTTGCCTACCTCACAGG - Intergenic
1088349015 11:108864058-108864080 GCCTGCATTGCCAACCTTCCAGG + Intronic
1088821099 11:113458003-113458025 GTCTGGCTTCCCTACCACCCAGG - Intronic
1089857658 11:121560790-121560812 ACCAGCCTTCCCTACCTCACAGG - Intronic
1202805036 11_KI270721v1_random:2240-2262 GCCTGTCTGCCCTGCCTCCCGGG - Intergenic
1091646713 12:2277720-2277742 TCCTGCCTTCTCTACCTCACAGG + Intronic
1091795745 12:3296627-3296649 GCCTGGCCTCCATACCTCCCAGG - Intergenic
1092022108 12:5211198-5211220 GCCTCGCTTGCCTGCCTCCCAGG - Intergenic
1094356355 12:29582355-29582377 GCCTGCCCTAGCTCCCTCCATGG + Intronic
1096072383 12:48782540-48782562 GCCCTCCATCCCTACCTCCCTGG + Intronic
1096470564 12:51872813-51872835 CCCTGCCTTATCTTCCTCACTGG + Intergenic
1096739033 12:53678042-53678064 GCCAGCTTTAGCTTCCTCCCAGG - Intergenic
1096788644 12:54031851-54031873 GCCTGCCCTGCCCACCCCCCAGG + Intronic
1096824183 12:54261834-54261856 ACCTGCCCTACGTACCTCCGAGG + Intronic
1098986145 12:77014619-77014641 GCCTTCCTTACTCACCGCCCAGG - Intergenic
1099251258 12:80257708-80257730 GCCTGCCTCTCCTCCTTCCCTGG + Intronic
1099984412 12:89646466-89646488 GCCTTCCTTGCCTCCCTCACTGG - Intronic
1099989581 12:89708621-89708643 GCCTGCCTTTCCTTCCCCCTCGG - Exonic
1101168173 12:102061017-102061039 GCCTGACTGACCTATCTCACAGG + Intronic
1101565530 12:105901509-105901531 GCCAGCCTTACCTCTGTCCCAGG - Intergenic
1101672487 12:106888903-106888925 ACCTGCCCTGCCTGCCTCCCAGG - Intronic
1102246896 12:111361835-111361857 GCTTGCCTGACCTCCCTTCCTGG - Exonic
1102885617 12:116519500-116519522 CCCTGCCACACCTACCTCCCAGG - Intergenic
1103123772 12:118403203-118403225 ATCTGCCTTGCCTACTTCCCAGG + Intronic
1103173968 12:118845510-118845532 TCCTGCCTTGCCTGCCTCCCTGG - Intergenic
1104002009 12:124865766-124865788 GCCTGCCTTACCCACGTGCTGGG - Intronic
1104864147 12:131942855-131942877 GCCTGCCCACCTTACCTCCCTGG - Intronic
1104904545 12:132206182-132206204 GCCTGCCTTGCCCACCCCCTGGG + Intronic
1107183717 13:37492946-37492968 GTCTGCATTACTTATCTCCCTGG + Intergenic
1109252525 13:60036515-60036537 GCCTGCATTACTTACCTCCGTGG + Intronic
1112551249 13:100423083-100423105 GCCTGCTTCACCTACCCTCCCGG - Intronic
1113861773 13:113491316-113491338 CCCTTCCTTCCCTCCCTCCCTGG + Intronic
1113861810 13:113491404-113491426 TCCTTCCTTCCCTCCCTCCCTGG + Intronic
1113861846 13:113491487-113491509 TCCTTCCTTCCCTCCCTCCCTGG + Intronic
1113956575 13:114102713-114102735 TCCTGCCTCACCTACCCCCAGGG + Intronic
1114620651 14:24094339-24094361 CCCCGCCTTCCATACCTCCCCGG + Exonic
1118239194 14:64038999-64039021 GCCAGCCACACCTACCTCTCAGG - Intronic
1119473473 14:74913219-74913241 GCCTACCTTCCCTACATCTCTGG + Intronic
1119899886 14:78250628-78250650 GCCTGCCCTACCTGCCTCACTGG - Intronic
1121856396 14:97274004-97274026 GCCTGACTGACCTGCCTCCAAGG - Intergenic
1122776315 14:104118398-104118420 GCCTGTCTGACCCATCTCCCAGG - Intergenic
1125732577 15:41901539-41901561 GCCTGCCCCTCCTTCCTCCCAGG - Intronic
1129358954 15:75012528-75012550 CCCAGCCGTCCCTACCTCCCCGG - Intronic
1129465803 15:75723641-75723663 GCCTCTCCCACCTACCTCCCAGG - Intergenic
1129574773 15:76731262-76731284 GGCTGCCTTAAACACCTCCCTGG - Intronic
1129672085 15:77613098-77613120 CCCTGCCCTGCCTACCTCACAGG - Exonic
1130243737 15:82223092-82223114 TCCTGCCTTACTTTTCTCCCTGG + Intronic
1130456738 15:84118184-84118206 TCCTGCCTTACTTTTCTCCCTGG - Intergenic
1130908298 15:88254870-88254892 CCCTTCCTAACCTACCACCCTGG - Intronic
1131067795 15:89445027-89445049 GCCTGCCTCGTCTGCCTCCCCGG + Intergenic
1132269962 15:100515524-100515546 TCCTGCCTCACTTACCTCCCTGG - Intronic
1132662013 16:1065827-1065849 GCCTGCCGTTCCTGCCTCCGCGG - Intergenic
1132799819 16:1746531-1746553 GCCTGCCCCACGTTCCTCCCCGG - Intronic
1137923150 16:52512035-52512057 TCCTGCCATATCTGCCTCCCAGG + Intronic
1138168856 16:54830031-54830053 GCCGGCTTTAGCTGCCTCCCCGG + Intergenic
1138342882 16:56302289-56302311 GCCAGCCCTACCTCCTTCCCAGG + Intronic
1138553450 16:57759327-57759349 GCCGGGCTTGCCTACCTCCTAGG - Intronic
1139869191 16:70090581-70090603 TCCTGCTTTACCTACCTCATGGG - Intergenic
1140386191 16:74541556-74541578 TCCTGCTTTACCTACCTCATGGG + Intronic
1141669570 16:85484821-85484843 CCCTGCCTTACCTGTCTCCTTGG + Intergenic
1142415008 16:89936494-89936516 GGCCCCCTTCCCTACCTCCCTGG - Intergenic
1144787539 17:17840301-17840323 GCCGCCCCTCCCTACCTCCCGGG - Intergenic
1146218961 17:31001917-31001939 CCCTTCCTTACCTTCCTCACAGG + Intergenic
1146462626 17:33058212-33058234 GCCTGCCTTACCTACCTCCCAGG - Intronic
1147547962 17:41417781-41417803 ACCTGCTTTACCTGCCTGCCAGG - Intergenic
1147888881 17:43703219-43703241 GCCTGCCTGCCCTTCCTCCCTGG + Intergenic
1148194525 17:45703711-45703733 GCCTCCCTTGCCTCCCTCACTGG + Intergenic
1148348313 17:46919485-46919507 ATCTGCCTTATCCACCTCCCAGG + Intergenic
1148847910 17:50540027-50540049 ATCTGCCCTACCTACCTCACAGG + Intronic
1148856962 17:50584160-50584182 GCCTGCCTGATCTCCCTCCTGGG - Intronic
1148901851 17:50884508-50884530 CCCTGCCTTCCCCACCTCCCAGG - Intergenic
1149994999 17:61401662-61401684 TCCTCCCTTCCCTCCCTCCCAGG + Exonic
1152813513 17:82393514-82393536 GGCTGCCTTGCCTGCATCCCAGG - Intronic
1153573392 18:6495915-6495937 GCCTGCTTTGCTTACCTCTCTGG - Intergenic
1156786179 18:40918100-40918122 AGCTGCCTTACCTACCTCATGGG - Intergenic
1158540362 18:58348119-58348141 GCCTGCCTTAGCTACCTGAAAGG - Intronic
1159107133 18:64015305-64015327 AACTGCCTTCCCTACCTCCGTGG - Intergenic
1160447156 18:78936718-78936740 CCCTGCCCTGCCCACCTCCCTGG - Intergenic
1160447172 18:78936764-78936786 TCCTGCCCTACCCACATCCCTGG - Intergenic
1160785854 19:900019-900041 GCCTCCCTTTTCTACCTGCCTGG - Intronic
1160786445 19:902090-902112 GCCTGCCCTAGCCAGCTCCCAGG - Exonic
1161249020 19:3270659-3270681 GCCCGCCTTACCCACCGGCCTGG - Intronic
1162496774 19:11027711-11027733 TCCTGCCTTACCTGCCTGCAGGG + Intronic
1164473506 19:28555012-28555034 GGCTGCCATTCCTTCCTCCCAGG - Intergenic
1164523903 19:28999710-28999732 GCCTGGCTGACCTCTCTCCCAGG + Intergenic
1164708486 19:30337628-30337650 GCCTTCCTTATCTCCCTCACAGG + Intronic
1164865521 19:31601290-31601312 GGCTCCCTCACCTTCCTCCCAGG - Intergenic
1164877408 19:31701178-31701200 TCCTGCCCTACCTGCCTCCAGGG - Intergenic
1165453042 19:35896269-35896291 GTCTGCCTTCTCTTCCTCCCAGG - Exonic
1165785160 19:38457412-38457434 TCCTGGCTTCCCTCCCTCCCAGG + Intronic
1165793528 19:38506045-38506067 TCTTGCCCCACCTACCTCCCTGG - Intronic
1165906832 19:39199387-39199409 TCCTGCCCTGCCCACCTCCCTGG + Intronic
1167752169 19:51387786-51387808 CCCTTCCTTACCCACCACCCAGG - Intronic
925287843 2:2727461-2727483 GACTCCCTTCCCTGCCTCCCCGG + Intergenic
925590340 2:5503043-5503065 TCCTGGCTTACCTTCCTACCTGG - Intergenic
926753281 2:16216631-16216653 GCCTGGCTCACCTCCCTGCCGGG + Intergenic
927418953 2:22909388-22909410 CCCTGACTTACCTACCTGCACGG + Intergenic
927890103 2:26742786-26742808 GACTGCCTTGCCCACCTCACAGG - Intergenic
928172768 2:29014042-29014064 TCCTGCCGTACGTACCTCCCAGG + Intronic
928207477 2:29296452-29296474 GCCTGTCCTACCTACCTTGCAGG + Intronic
928366471 2:30706840-30706862 GCCTCACTTTCCTACCTGCCAGG + Intergenic
929468636 2:42169372-42169394 GCCTGCCCGGCCTCCCTCCCAGG - Exonic
929532260 2:42760679-42760701 GCATGCATTACCTTCCTCCAGGG - Intergenic
931345293 2:61440288-61440310 GGCTGCCATCCCTGCCTCCCTGG + Intronic
932620117 2:73260216-73260238 GCCTGACTGACCTAGGTCCCAGG - Intronic
934141892 2:89054850-89054872 CCCTGCCTTACATACCTACTGGG + Intergenic
934227345 2:90145696-90145718 CCCTGCCTTACATACCTACTGGG - Intergenic
938265618 2:129926016-129926038 GCCCGCCTTCCCTTCCTCCCTGG - Intergenic
938726015 2:134109491-134109513 CCCGGCCTTAGCTGCCTCCCTGG - Intergenic
938972984 2:136449165-136449187 GCCTTCCTTTCTTACCCCCCAGG + Intergenic
939738271 2:145876959-145876981 GCCTGCCTTCCCTATCACTCTGG - Intergenic
944237393 2:197452997-197453019 GCCTGCCTTGCCTATCTCACGGG - Intergenic
944615393 2:201453764-201453786 GCCTGCCCTGCCAACCTTCCAGG - Intronic
946195440 2:218030092-218030114 CCCTGCCTGCCCTGCCTCCCAGG + Intergenic
946338492 2:219054322-219054344 GCCTGGCTCACCTTCCTCCAAGG - Intergenic
946415734 2:219538844-219538866 GCCTGCCTTTCCTTTCACCCGGG - Intergenic
947129740 2:226909077-226909099 GCCTGAGTTACCTCCTTCCCTGG - Intronic
947398044 2:229705905-229705927 CCCTGCCTCACATACTTCCCTGG + Intronic
947638515 2:231693089-231693111 GCCTGCCTTGCCTACCTGGATGG - Intergenic
947669223 2:231926061-231926083 GCCTGCCTTCCCTCTCTCCTGGG + Intronic
947999534 2:234556289-234556311 GCCTGCATGACCGACCTGCCAGG - Intergenic
1168893037 20:1306798-1306820 GCCGGGCTTAGCTACCTCACAGG - Exonic
1172180455 20:33000355-33000377 GCCTGCCTTTCCCACCTGACTGG + Intronic
1173193408 20:40894239-40894261 CCCTGCCATACCTGCCTCTCAGG - Intergenic
1173255283 20:41390231-41390253 GCCAGCCTGACCTCCCTGCCTGG + Intergenic
1173278141 20:41602541-41602563 GCCTGCCTTTCTTGCCTCCCTGG + Intronic
1173363894 20:42368135-42368157 GCCTGACTCAACAACCTCCCAGG + Intronic
1174200811 20:48805249-48805271 TCCTGCCCTACCTACCTCTTTGG - Intronic
1174449395 20:50610102-50610124 CCCTGCCTCACCTGCCACCCCGG + Intronic
1175127718 20:56764807-56764829 GCCTGCCTCATCTTCCTGCCTGG - Intergenic
1175632716 20:60555925-60555947 GCCTGCCCCACCTTCCTTCCTGG - Intergenic
1175759250 20:61550130-61550152 GCCTCCCTAGCCTACCTCCATGG + Intronic
1175759291 20:61550264-61550286 GCCTCCCTAGCCTACCTCCCTGG + Intronic
1176143868 20:63556948-63556970 GCCTTCCTTACCCACCTCCCTGG + Intergenic
1177795907 21:25778529-25778551 GCGGGCCTTAGCTGCCTCCCCGG + Intergenic
1179263406 21:39778806-39778828 CCCTGCCTTATCTACTTCTCAGG + Intronic
1179416022 21:41199343-41199365 GCCAGCCTTCCCCTCCTCCCTGG - Intronic
1181509923 22:23384623-23384645 TCCTGCCTTCTCTCCCTCCCTGG + Intergenic
1181767331 22:25101214-25101236 CCCTGCCTGACTTATCTCCCTGG - Intronic
1181895035 22:26099738-26099760 GCCTGTCCTTCCTACCTTCCAGG - Intergenic
1182308170 22:29385861-29385883 GCATGTCTTAACTACTTCCCAGG - Intronic
1182828683 22:33286922-33286944 GCCTGCCCTACCTGCACCCCTGG + Intronic
1183498957 22:38166897-38166919 GCCTTCCTTGCCCACCTCCACGG + Intronic
1183959729 22:41404158-41404180 GCCAGCCCTCCCTTCCTCCCAGG - Intergenic
1184044243 22:41962694-41962716 TCCTGCCCTACCTCCCTCACCGG + Intergenic
1184066831 22:42126046-42126068 GCCAGGGCTACCTACCTCCCAGG - Intergenic
1184108719 22:42383219-42383241 GCCTGCCTCCCCCACCTCCTGGG - Exonic
1185038069 22:48489930-48489952 GCCTCCCTTCCCTGACTCCCCGG + Intronic
950717792 3:14862070-14862092 GTCAGGCTTACCTTCCTCCCAGG - Intronic
950788787 3:15456118-15456140 GCATGCCTTGACTTCCTCCCAGG + Intronic
953358405 3:42273796-42273818 TCCTACCTTACCAACCTGCCTGG + Intergenic
953926674 3:46986073-46986095 GGCTGCCTGTCCTGCCTCCCTGG - Intronic
954225135 3:49176407-49176429 TCCTACCCTACCTACCTCACAGG + Exonic
955137927 3:56238422-56238444 ATCTGCCTTACTTGCCTCCCTGG + Intronic
955475109 3:59328502-59328524 CCCTGCCTTGTCTACCTCCCAGG - Intergenic
955671020 3:61403142-61403164 ACCTGCCTTACTTACCTCATAGG - Intergenic
956282992 3:67578562-67578584 GCATTCCTTTCCTTCCTCCCTGG - Intronic
960089614 3:113626081-113626103 TCCTGCCTCACCTTCCTCCAGGG + Exonic
960737641 3:120798242-120798264 ATATGCCTGACCTACCTCCCAGG + Intergenic
960971180 3:123141314-123141336 TCCTGCCTCTCCCACCTCCCTGG + Intronic
961706590 3:128791558-128791580 TTCTGCCTTATCTAGCTCCCAGG - Intronic
962046992 3:131770792-131770814 CCCTGACTTACCTATCTCACTGG + Intronic
962713436 3:138106966-138106988 GCCAGCCCTGCCTACCTCACAGG + Intronic
962919159 3:139935511-139935533 GCCTGCCCTGCCTCCCTCCTGGG - Intronic
963044055 3:141089503-141089525 GCCTGCCTTGCCTTCCTGCTAGG - Intronic
963844644 3:150142875-150142897 ACCTGGCTTAACTACCTCACAGG + Intergenic
964466628 3:156999789-156999811 GCCTGCCACACCTGCCTCACTGG + Intronic
964634701 3:158846209-158846231 GCCTGCCATGCCTATCTCACGGG - Intergenic
967259030 3:187623764-187623786 ACCTGCCTTACCCACCCTCCAGG + Intergenic
967934320 3:194714725-194714747 GCCTGCCCTAAGTACCTCCCTGG + Intergenic
969124030 4:4932817-4932839 CCCTGTCTTTCCAACCTCCCTGG + Intergenic
969184501 4:5465342-5465364 TCCTGGCTTCCCTAACTCCCAGG - Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
976426820 4:84913811-84913833 GCCTGCCTCTCCTGCCTCCCTGG + Intronic
979020706 4:115493794-115493816 CCTTGCCTTACCTCCTTCCCTGG + Intergenic
979565799 4:122152724-122152746 GCCATCCTTACCTACAGCCCTGG + Intronic
982980425 4:162127188-162127210 GGCTGCCTTTCCTACTTCCTCGG + Intronic
984767371 4:183409895-183409917 ACCTTCCCTGCCTACCTCCCTGG + Intergenic
986364311 5:7015775-7015797 CCCTGCTTTACCCACCTCCCTGG - Intergenic
987316097 5:16725667-16725689 GGCTGCCCTACCCACCTCACAGG - Intronic
989592018 5:43121112-43121134 GCCCGCCTTACCTAGCTCGTGGG - Intronic
992138384 5:73770795-73770817 CCCTGCCTTACCTCCTCCCCGGG + Intronic
992884814 5:81148005-81148027 GCCTTCCTTACCTTCCTCACTGG + Intronic
993629734 5:90271573-90271595 GCCTGCTTTACTTACCATCCAGG - Intergenic
993783372 5:92097662-92097684 CCCTCCCTTTCCTACCTCCTGGG + Intergenic
995840276 5:116437259-116437281 GGCTGCCCTGCCTACCTCACAGG - Intergenic
996566098 5:124881009-124881031 GCCTGTCTCACCTAGGTCCCTGG + Intergenic
997362841 5:133306070-133306092 GCCTGCCTTGCCAGCCTGCCAGG + Intronic
999104935 5:149062825-149062847 GGCTGCCTCTCCTTCCTCCCTGG - Intronic
999259994 5:150232426-150232448 GCTGACCTTGCCTACCTCCCAGG - Intronic
999483815 5:151972882-151972904 TCCTGGCTTTCCTACCTCACTGG - Intergenic
999524826 5:152393270-152393292 TCCAGCCTAACCCACCTCCCTGG + Intronic
1000952857 5:167505726-167505748 GCCTGCCTGTCCTAACTCCATGG - Intronic
1001045134 5:168365628-168365650 GCCTCCCTTACCCTCCTCTCAGG - Intronic
1005450071 6:25963503-25963525 TTCTGCCTTCCCTACCTCCTTGG + Intronic
1006367801 6:33625773-33625795 GCCAGCCTGACCTGCTTCCCTGG + Intronic
1006950991 6:37820376-37820398 GCCAGCCCTTCCTCCCTCCCGGG + Intronic
1007182892 6:39943210-39943232 GCCTGTCTTATCTACTTCACAGG + Intergenic
1007970011 6:46042460-46042482 GCCTGCCTGCCCCACCTCCTAGG - Intronic
1007970639 6:46048693-46048715 GCCAGCCTCAACTCCCTCCCAGG - Intronic
1009441070 6:63679013-63679035 ACCTGTCCTACCTACCTCACAGG - Intronic
1018429160 6:163709857-163709879 GGCTGCCTCCCCTCCCTCCCTGG - Intergenic
1018453417 6:163930210-163930232 GCCTGCCTTACGTAACACCTTGG + Intergenic
1019135031 6:169902593-169902615 GCCTGGCTTGCCTGCTTCCCAGG + Intergenic
1021346574 7:19536770-19536792 GTCTGCCTTCCCTACTACCCTGG + Intergenic
1021477660 7:21080728-21080750 GCCTGCTTTCCCTTCCTCCGTGG - Intergenic
1021980401 7:26048599-26048621 TCCTGTTTTACATACCTCCCAGG - Intergenic
1023681468 7:42691754-42691776 GCCTGCCCTTCCCATCTCCCAGG + Intergenic
1024234991 7:47391164-47391186 GTCTGCCTTCCCTACCTGCAAGG + Intronic
1028342870 7:89744808-89744830 GCCTTCCTTATCTACCCCACAGG + Intergenic
1029657442 7:101936489-101936511 TCCTGCCCTAACTTCCTCCCCGG - Intronic
1029812954 7:103067665-103067687 GGCTTCCTTACCTACATGCCTGG - Intronic
1030641572 7:112012030-112012052 CCCTGCCTGGCCTACCTCACAGG + Intronic
1033801743 7:144909596-144909618 GCCTGCTTGACTTACCTCGCTGG + Intergenic
1034356347 7:150453448-150453470 CACTGCCTTTACTACCTCCCTGG + Intronic
1035009676 7:155703030-155703052 CTCTGCCTTTCCCACCTCCCTGG + Intronic
1036445840 8:8821186-8821208 GCCTGCCTGAACTGCCTGCCGGG + Intronic
1036770074 8:11572595-11572617 TCCTGCCTGTCCTTCCTCCCAGG - Intergenic
1036830531 8:12016362-12016384 TCCTGCCTCCCCTGCCTCCCTGG - Intergenic
1037457753 8:19081089-19081111 GCCTGCCCTAACCATCTCCCAGG - Intronic
1037882295 8:22579166-22579188 CCCCGCCTTCCCTCCCTCCCGGG + Exonic
1037935107 8:22910175-22910197 ACCTGCCTGACCCACCTCCCAGG + Intronic
1038341650 8:26691268-26691290 CCCTGCCTGACCTGCCTCCTGGG - Intergenic
1038673101 8:29598011-29598033 GCCTGCCTTACACCCCTTCCAGG - Intergenic
1039750738 8:40476012-40476034 CCCTGCCTTGCCTGTCTCCCAGG + Intergenic
1041136441 8:54764145-54764167 GCCTGCCTCACCTGCCTGCAGGG - Intergenic
1047060217 8:121216914-121216936 ACCTGCCTTACCTAAGTCACAGG - Intergenic
1048344900 8:133569142-133569164 GCCTTTGTTGCCTACCTCCCTGG - Intronic
1048527983 8:135221897-135221919 GCCTTCCTTACCGTCCTCCAAGG + Intergenic
1048878406 8:138854476-138854498 CCCTGCCTCTGCTACCTCCCAGG - Intronic
1051261328 9:15268049-15268071 GCCTGCTATACCTTCCTGCCAGG - Intronic
1051431477 9:16984739-16984761 CCCTGCCCTTCCTTCCTCCCAGG - Intergenic
1052973887 9:34398165-34398187 GCCAGCCTCAGCTCCCTCCCTGG - Exonic
1055347007 9:75350165-75350187 ACCAGCCTTACCTAGCTCCCAGG + Intergenic
1057142662 9:92737005-92737027 GCCTGCCTTCTCTATCTCCTAGG - Intronic
1057696672 9:97327998-97328020 GTCTTACCTACCTACCTCCCAGG + Exonic
1057727516 9:97578700-97578722 GCCTGCCCTGCTCACCTCCCAGG + Intronic
1057830467 9:98402475-98402497 ACCTGCCTTACCTACGGCCAAGG + Intronic
1058157799 9:101534293-101534315 GTCTGCCCTGCCTACCTCCCAGG - Intronic
1059362086 9:113752681-113752703 GTCTGCATTAGCTCCCTCCCAGG - Intergenic
1059800086 9:117741461-117741483 GCCTGCCTCTGCTACCTCTCCGG + Intergenic
1061132900 9:128718260-128718282 GCCTCCCTGCCCTGCCTCCCTGG + Intronic
1185853119 X:3507674-3507696 GCCTGCACTCCCTACCTCCATGG - Intergenic
1186730359 X:12403237-12403259 GCCTGCCTTTCCTGCCTCCTTGG + Intronic
1190474881 X:50816112-50816134 CCCTGACTTTCCTACCTCCCAGG + Intergenic
1190765689 X:53473749-53473771 TCCTTCCTTCCCTCCCTCCCTGG + Intergenic
1191053902 X:56222740-56222762 CCCGGCCTTAGCTGCCTCCCCGG - Intergenic
1191930358 X:66365380-66365402 GGCTGCCTGCCCCACCTCCCAGG + Intergenic
1192072126 X:67952140-67952162 ACCTGCCTTTTCTACCTCGCAGG - Intergenic
1192451867 X:71249837-71249859 GCTGGCCTTCCTTACCTCCCAGG - Intronic
1195964679 X:110419199-110419221 GCCGGCTTTACCTCCCTCCTAGG + Intronic
1197752873 X:129977535-129977557 ACCTGCCCTACCTCCCTCACAGG - Intergenic
1198620546 X:138503952-138503974 CCTTGCCTCACCCACCTCCCTGG + Intergenic
1199217131 X:145273103-145273125 TCTTGCCTTACCTACCTCATTGG - Intergenic
1199303266 X:146237511-146237533 GCCTGCCTGGGCTGCCTCCCTGG - Intergenic
1200038909 X:153351848-153351870 GCCTGCCCTACCTGCAGCCCTGG + Exonic
1200240414 X:154490358-154490380 CCCTTCCTTTCCTCCCTCCCAGG - Exonic
1200397593 X:156000361-156000383 GCCTGCCTGCCCTGCTTCCCTGG - Intronic