ID: 1146463374

View in Genome Browser
Species Human (GRCh38)
Location 17:33065917-33065939
Sequence CACTGTAGGATCTCATACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146463374_1146463381 14 Left 1146463374 17:33065917-33065939 CCTTTGTATGAGATCCTACAGTG 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1146463381 17:33065954-33065976 GGGCTTCTGTCTCAGACCAGTGG 0: 1
1: 0
2: 1
3: 13
4: 167
1146463374_1146463380 -6 Left 1146463374 17:33065917-33065939 CCTTTGTATGAGATCCTACAGTG 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1146463380 17:33065934-33065956 ACAGTGATAAAGGTAGGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 252
1146463374_1146463379 -7 Left 1146463374 17:33065917-33065939 CCTTTGTATGAGATCCTACAGTG 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1146463379 17:33065933-33065955 TACAGTGATAAAGGTAGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 150
1146463374_1146463383 24 Left 1146463374 17:33065917-33065939 CCTTTGTATGAGATCCTACAGTG 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1146463383 17:33065964-33065986 CTCAGACCAGTGGGATGTTAAGG 0: 1
1: 0
2: 0
3: 13
4: 133
1146463374_1146463382 15 Left 1146463374 17:33065917-33065939 CCTTTGTATGAGATCCTACAGTG 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1146463382 17:33065955-33065977 GGCTTCTGTCTCAGACCAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146463374 Original CRISPR CACTGTAGGATCTCATACAA AGG (reversed) Intronic