ID: 1146467158

View in Genome Browser
Species Human (GRCh38)
Location 17:33095396-33095418
Sequence CTGAGAGATCTCTTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146467154_1146467158 -9 Left 1146467154 17:33095382-33095404 CCTCTCTGTTAAGACTGAGAGAT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248
1146467152_1146467158 -2 Left 1146467152 17:33095375-33095397 CCAACTCCCTCTCTGTTAAGACT 0: 1
1: 0
2: 2
3: 12
4: 173
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248
1146467151_1146467158 -1 Left 1146467151 17:33095374-33095396 CCCAACTCCCTCTCTGTTAAGAC 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248
1146467150_1146467158 16 Left 1146467150 17:33095357-33095379 CCATGTTCACACTTGATCCCAAC 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248
1146467153_1146467158 -8 Left 1146467153 17:33095381-33095403 CCCTCTCTGTTAAGACTGAGAGA 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146467158 Original CRISPR CTGAGAGATCTCTTGGGGAC AGG Intronic