ID: 1146467158

View in Genome Browser
Species Human (GRCh38)
Location 17:33095396-33095418
Sequence CTGAGAGATCTCTTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146467151_1146467158 -1 Left 1146467151 17:33095374-33095396 CCCAACTCCCTCTCTGTTAAGAC 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248
1146467152_1146467158 -2 Left 1146467152 17:33095375-33095397 CCAACTCCCTCTCTGTTAAGACT 0: 1
1: 0
2: 2
3: 12
4: 173
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248
1146467154_1146467158 -9 Left 1146467154 17:33095382-33095404 CCTCTCTGTTAAGACTGAGAGAT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248
1146467150_1146467158 16 Left 1146467150 17:33095357-33095379 CCATGTTCACACTTGATCCCAAC 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248
1146467153_1146467158 -8 Left 1146467153 17:33095381-33095403 CCCTCTCTGTTAAGACTGAGAGA 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG 0: 1
1: 0
2: 2
3: 14
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146467158 Original CRISPR CTGAGAGATCTCTTGGGGAC AGG Intronic
900869552 1:5292311-5292333 CTGAGTGACCACATGGGGACGGG + Intergenic
901167154 1:7229171-7229193 CTGAGAGAGCTCTAGGGGACAGG + Intronic
901547016 1:9965628-9965650 CAGAGAGATCGCTTGAGGTCAGG - Intronic
903215743 1:21842454-21842476 CCGAGAGAACTCTTGGGTACCGG - Intronic
904314023 1:29648494-29648516 CTGAGACCTCACTTGGGTACAGG + Intergenic
905003606 1:34693165-34693187 CTGAGAGATCCCTGGAGCACAGG + Intergenic
906253014 1:44325874-44325896 CAGACAGATCTCTTGAGGCCAGG - Intronic
906519217 1:46457413-46457435 CAGTGAGATCTCTGGGGGAATGG - Intergenic
906776443 1:48534138-48534160 CTGGGAGGTCTTATGGGGACAGG - Exonic
909257129 1:73438551-73438573 ATGAGAAATTTCTTGGGAACTGG + Intergenic
909757128 1:79240427-79240449 ATGAGAAATTTCTTGGGAACTGG - Intergenic
911224190 1:95286740-95286762 CTGAGACACCTCATGGTGACTGG - Intergenic
912701948 1:111884566-111884588 CTGAGAGATCTCCTTGGAGCAGG + Intronic
913198249 1:116475643-116475665 CTGAGAGAACTGTGGGGGCCAGG + Intergenic
914672062 1:149878212-149878234 CTTAGGGATCTGATGGGGACAGG + Intronic
914792704 1:150892764-150892786 CTGACAGATCTCCTGAGGTCAGG - Intergenic
915768880 1:158396967-158396989 CAGGCAGATCTCTTGAGGACAGG + Intergenic
916370952 1:164093522-164093544 ATGAGAAACCTCTTGGGAACTGG - Intergenic
917959738 1:180132713-180132735 CTGTCAGGCCTCTTGGGGACCGG - Intergenic
919298886 1:195735539-195735561 CTGAGAAATCTCTTGTGGGAGGG + Intergenic
920209538 1:204318170-204318192 CTGTGAAATCTCCTGGGCACTGG - Intronic
920799619 1:209174144-209174166 CTGAGAGCTCTCCTGGGCCCTGG - Intergenic
921094894 1:211877903-211877925 CTGATGGATCTCTTGAGGTCAGG + Intergenic
924659590 1:246004183-246004205 CTGGTAGATCTCTTTGGGGCTGG - Intronic
1064840677 10:19587745-19587767 CAGAGAGATGTCTTGGTTACTGG + Intronic
1066082216 10:31942622-31942644 ATGAGAGATCTCTTGAGGCCAGG + Intergenic
1067007522 10:42679052-42679074 CAGAGAGATCACTTGAGGCCAGG + Intergenic
1067027351 10:42855998-42856020 TTGACAGATCTGTTGGAGACTGG + Intergenic
1075234012 10:120710450-120710472 ATGAGAGCTCTCGTGGGGCCAGG - Intergenic
1076115904 10:127899847-127899869 CTGAGAGATTTCTGGGGGAGAGG - Intergenic
1077190563 11:1254451-1254473 CTGGGAGCTGTCTTGGGCACTGG - Intronic
1077304025 11:1859919-1859941 CTGAGAGAGCCCATGGGGACAGG - Intronic
1077906815 11:6540519-6540541 CTCAGAAATTTCTGGGGGACAGG - Intronic
1078010287 11:7568275-7568297 CTGAGTGACCTCATGGGTACTGG + Intronic
1078082447 11:8214003-8214025 CTGTGAGATTTCTTGAGGGCAGG + Intergenic
1078571043 11:12458274-12458296 CTGAGAAAACTCCTGGGGCCAGG - Intronic
1079613123 11:22457552-22457574 CTGTTAGCCCTCTTGGGGACAGG + Intergenic
1081656791 11:44862652-44862674 CTGGGAGATCTCCTGAGGGCAGG + Intronic
1083113083 11:60431221-60431243 CTGAGAGGTCTTTGGGGGAGAGG - Intronic
1083234233 11:61341645-61341667 CTGGGGGAGCTCCTGGGGACTGG + Intronic
1083238624 11:61369055-61369077 CTGGGAGATCCTTTGGGGGCTGG - Exonic
1085159198 11:74325578-74325600 CTGGGGGCTATCTTGGGGACTGG - Intergenic
1085340212 11:75726384-75726406 CCGAGACATCCATTGGGGACTGG + Intronic
1086130800 11:83400423-83400445 CTGAAGGATCACTTGGGGCCAGG + Intergenic
1086578652 11:88370456-88370478 CTGATAGATCACTTGAGGTCAGG + Intergenic
1086725298 11:90175033-90175055 CAGTGAGATATCTTGGGGATGGG - Intronic
1087405873 11:97729839-97729861 TTGAGAGATGTTTTGGGGAATGG - Intergenic
1089763441 11:120745727-120745749 CTGAAAGATCTTTTGGGAATTGG + Intronic
1090031847 11:123213131-123213153 CAGAGAGATCACTTGAGGTCAGG - Intergenic
1090266184 11:125354299-125354321 CTGAGAGCTCTGTTTTGGACAGG - Intronic
1090802816 11:130184091-130184113 ATGAGTGGTTTCTTGGGGACAGG + Intronic
1092130404 12:6108064-6108086 CGGAGAGATCACTTGAGGTCAGG + Intronic
1092487990 12:8919361-8919383 CAGAAAGATCTCTTGAGGCCAGG + Intronic
1092563479 12:9641013-9641035 ATGAAAGATCTTATGGGGACCGG - Intergenic
1094267784 12:28578323-28578345 CTGTGAGCTCTCTTGAGAACTGG + Intronic
1095985874 12:47999312-47999334 TTGGGAGTTCTCGTGGGGACGGG - Intronic
1096018856 12:48305341-48305363 CTGAGTGTTCTCTTGGGTAGTGG - Intergenic
1099740259 12:86625606-86625628 CTCAGAGACCTCTGGGGCACTGG + Intronic
1101285513 12:103307822-103307844 CTGAGATCTCTTTTGGGGAGAGG + Intronic
1102537018 12:113589228-113589250 CTGGGAGATCTCTTGGAGGATGG + Intergenic
1102588217 12:113938161-113938183 CAGAGAGAGCTTTTGGTGACTGG + Intronic
1102875517 12:116445675-116445697 CAGAAAGATCTCTTGAGGCCAGG - Intergenic
1104031934 12:125071092-125071114 GTGAGTGAGCTCTTGGGGACGGG - Intronic
1106043877 13:26119305-26119327 CTTAGAAACCTCTTGAGGACTGG - Intergenic
1106245279 13:27944436-27944458 ATGAGAGACTTCTTGGGGGCTGG - Intergenic
1106582904 13:31032904-31032926 CTGAGTCAGATCTTGGGGACTGG - Intergenic
1112431952 13:99358053-99358075 CTGAGAGCTGTCCTGGGGAAGGG + Intronic
1119179214 14:72593612-72593634 CGGACAGATCACTTGAGGACAGG - Intergenic
1120252153 14:82070881-82070903 CTGAGACATATCTTTGGGACTGG + Intergenic
1121345769 14:93134912-93134934 CAGAGGGATCTCTTGAGGTCAGG - Intergenic
1121464006 14:94102522-94102544 CTGGGACAGCTCTTGGGGCCTGG + Exonic
1122601272 14:102923097-102923119 CTCAGTGCTCCCTTGGGGACCGG - Intronic
1122782859 14:104150919-104150941 CTGAGACACCCCTTGGGGAGGGG + Intronic
1125788188 15:42341332-42341354 CTGTGAGATCACTTGGGGGAAGG + Intronic
1126472844 15:49033607-49033629 CTGAAAGATCACTTGAGGTCAGG + Intronic
1127736125 15:61840639-61840661 CTCAGAGATCTCTGGGGCTCTGG + Intergenic
1127992715 15:64132717-64132739 ATGGGAGATATGTTGGGGACGGG - Intronic
1128242382 15:66109802-66109824 CTGAGAGACCTCTTAGGGAGAGG - Intronic
1128555740 15:68630522-68630544 CAGAAAGACCTCATGGGGACAGG + Intronic
1130095884 15:80855748-80855770 CAGGCAGATCTCTTGAGGACAGG - Intronic
1130578809 15:85116780-85116802 CAGGGAGTTATCTTGGGGACAGG - Intronic
1132395438 15:101469994-101470016 CTGAGTGCTCACTTCGGGACTGG + Intronic
1133218220 16:4306436-4306458 CTGAGGGCTCTCATGGGTACGGG - Intergenic
1133513028 16:6479358-6479380 CAGGCAGATCTCTTGAGGACAGG + Intronic
1134694048 16:16209956-16209978 CTGACAGATCACTTGAGGCCGGG - Intronic
1135392764 16:22107512-22107534 CTGAAGGATCTCTTGAGGCCAGG + Intronic
1138570646 16:57869875-57869897 CAGACAGATCACTTGAGGACAGG + Intergenic
1138589094 16:57989871-57989893 CAGAAAGCTCTCTTGGGGCCGGG + Intergenic
1138903168 16:61298839-61298861 CAGAAAGATCTCTTGAGCACAGG - Intergenic
1141485468 16:84336514-84336536 CTGACAGATCACTTGAGGTCAGG + Intergenic
1141669251 16:85483171-85483193 CAGTGAGATGTCTTGGGGATGGG - Intergenic
1142048969 16:87945758-87945780 CTGAGACATGTCTGGGGGAGGGG - Intergenic
1142283513 16:89161303-89161325 CTGAGTGACCTGTTGGGGGCAGG - Intergenic
1143176997 17:4961227-4961249 CAGACAGATCTCCTGGGGTCAGG + Intronic
1146467158 17:33095396-33095418 CTGAGAGATCTCTTGGGGACAGG + Intronic
1148067857 17:44886007-44886029 CAGAGAGATCACTTGAGGTCAGG + Intronic
1148478466 17:47944534-47944556 CTGAGACATCCTTTGGGGAGAGG + Intronic
1149798543 17:59544603-59544625 CAGACAGATCTCTTGAGGCCAGG - Intergenic
1153682891 18:7517280-7517302 CTGTGTGATCAATTGGGGACAGG + Intergenic
1154221304 18:12457056-12457078 CTGGCAGATCACTTGAGGACAGG - Intronic
1155364855 18:25039672-25039694 CTGAAAGCTCTGTTGAGGACAGG - Intergenic
1155874050 18:31063101-31063123 CTGACAGATCACTTGAGGTCAGG + Exonic
1156703213 18:39849301-39849323 GTGAGAGATCACTTGTGGCCAGG - Intergenic
1156848873 18:41702244-41702266 CTGACAGATCGCTTGAGGTCAGG + Intergenic
1158186471 18:54777324-54777346 CTCTTAGATCTCTTGGGTACAGG + Intronic
1162485394 19:10957268-10957290 CTGGCAGATCACTTGAGGACAGG - Intergenic
1164401170 19:27903293-27903315 CTGAGAGGTCTCCAGGGGGCTGG + Intergenic
1164428642 19:28167499-28167521 CTGAAAGATCACTTGAGGCCAGG - Intergenic
1165162782 19:33827761-33827783 CTGACAGATCACTTGAGGTCAGG - Intergenic
1165803047 19:38564741-38564763 CTGGCAGATCACTTGGGGTCAGG - Intronic
1167854533 19:52226971-52226993 CTCTGAGACCTCCTGGGGACAGG - Exonic
1168221706 19:54965210-54965232 CTGAGAGGTCTTTTGGGGGCGGG - Intronic
1168221871 19:54966300-54966322 CTGAGAGGTCTTTTGGGGGCGGG - Intronic
1168290643 19:55355365-55355387 CAGAGAGAGCTTTGGGGGACAGG + Intronic
926283310 2:11467484-11467506 CTGGGAGATCACTTGAGGCCAGG - Intergenic
928107138 2:28477869-28477891 CTGAGAGATCTTATGTGGCCAGG - Intronic
928399783 2:30969450-30969472 CTTTGAGAGCTTTTGGGGACAGG + Intronic
928689788 2:33787520-33787542 CTGAGAAATCTCATGGGCATTGG + Intergenic
928749820 2:34458416-34458438 ATGAGAAATTTCTTGGGAACTGG + Intergenic
931496020 2:62807990-62808012 GTGGGAGATCACTTGGGGCCAGG + Intronic
934618455 2:95789817-95789839 CTGAGCGGCCTGTTGGGGACTGG + Intergenic
934642438 2:96034742-96034764 CTGAGCGGCCTGTTGGGGACTGG - Intronic
934716610 2:96548491-96548513 CAGAGAGATCACTTGAGGTCAGG - Intronic
935272503 2:101447158-101447180 CTGAGAGACCTCTTAGAGGCAGG - Intronic
936376455 2:111945536-111945558 CTGAGACTTCTTTTGGGCACTGG + Intronic
936401069 2:112164817-112164839 CTCAAAGCTCTCTTGGGGATGGG - Intronic
936985626 2:118309429-118309451 CTGAGGCATCTCCTGGGGTCAGG + Intergenic
937710145 2:124971426-124971448 CTGGGAGATACCTTGGGGCCAGG - Intergenic
938368081 2:130751183-130751205 GTGTGAGTTCTCTTGGTGACAGG + Intergenic
940388306 2:153100799-153100821 CAGGGAGATCTCTTGAGGCCAGG + Intergenic
941622709 2:167796517-167796539 GTGGGAGATCACTTGAGGACAGG + Intergenic
942543627 2:177040029-177040051 CTAAGAGATCCCTCGGGGGCCGG + Intergenic
943069118 2:183120216-183120238 CTGACAGATCACTTGAGGTCAGG + Intronic
944747993 2:202677360-202677382 CTTAGAAATCTCTTTGGGGCTGG - Intronic
945272320 2:207953559-207953581 TGGACAGATCTCTTGGGGTCAGG + Intronic
946428513 2:219612722-219612744 CTGAGAGGACTCTGGGGGGCCGG + Intronic
947534720 2:230933485-230933507 CTGAGAGCTCCCTTGGAGATGGG - Intronic
1168838122 20:891325-891347 CTGGGAGAACCCTTGGAGACTGG - Intronic
1170018545 20:11810271-11810293 CTGAGAGCTTTCTTGGGCAATGG - Intergenic
1171210951 20:23316563-23316585 CCCAGAGATATCTGGGGGACAGG - Intergenic
1171850638 20:30305659-30305681 CTGAGAGATCTCTGTGGGTGGGG + Intergenic
1172229955 20:33329945-33329967 CTGAGAGGTCCCTTTGGGCCTGG - Intergenic
1172327680 20:34049418-34049440 CTGACAGATCTCTGAGGGAGGGG - Intronic
1173000886 20:39104934-39104956 CTGTGAGATCTTATGGGGGCAGG + Intergenic
1173108830 20:40165551-40165573 CTCAGATATATTTTGGGGACGGG + Intergenic
1173860687 20:46281317-46281339 CTGTGAGATGCCTGGGGGACTGG + Intronic
1178179591 21:30144585-30144607 ATGAGATCTCTCTTGGGGTCTGG + Intergenic
1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG + Intergenic
1181643310 22:24216174-24216196 CAGGAAGATCTCTTGGGTACAGG + Intergenic
1181652382 22:24267172-24267194 CTGACAGATCACTTGAGGTCAGG + Intergenic
1183380167 22:37486596-37486618 CTGACAGCTCTCTGGGGGAGTGG - Intergenic
1183663651 22:39235333-39235355 CTGAGTGAGCTCTGGGGCACGGG + Intronic
1183882843 22:40850028-40850050 CTGAGAGATCAGTTGAGGTCAGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184265821 22:43345288-43345310 CTGAGCAATCGCTTGGGGGCAGG - Intergenic
1185266113 22:49905119-49905141 CTGAGTGAACTCTCTGGGACAGG + Intronic
949437319 3:4043463-4043485 CTGAGAGAGGAATTGGGGACAGG - Intronic
950770653 3:15308170-15308192 CTGAGAGCTCTCTGGGGCACTGG + Intronic
951388239 3:22069289-22069311 GTGAGAGATCTCTTGTGGTGAGG - Intronic
951958442 3:28285554-28285576 ATGAGAAATCTATTGGGTACAGG + Intronic
952208512 3:31204809-31204831 CGGACAGATCACTTGAGGACAGG + Intergenic
952584016 3:34869648-34869670 CTGAGACTTCTCTTAGGGAAGGG - Intergenic
953016455 3:39081537-39081559 GAGAGGGTTCTCTTGGGGACTGG + Intronic
953563532 3:44012857-44012879 CTGAGGGATCTCCTGGGAAGGGG - Intergenic
954290023 3:49644761-49644783 CTGGGAGGTCTCTTGGGGACAGG - Intronic
955302615 3:57796949-57796971 GTGAGAGATCACTTGAGGCCAGG + Intronic
955312717 3:57905506-57905528 CAGACAGATCTCTTGAGGTCAGG - Intronic
958121866 3:89300857-89300879 CTCAGAGATCTCTAGAGAACAGG - Intronic
958430524 3:94035006-94035028 CTGACAGATCACTTGAGGTCAGG + Intronic
958581176 3:96025081-96025103 CAGACAGATCTCTTGAGGCCAGG + Intergenic
959786950 3:110310830-110310852 CAGAGAGATCACTTGAGGTCAGG + Intergenic
960212301 3:114984788-114984810 GTGAGAGTGCTCTTGGGAACAGG - Intronic
964928810 3:161990271-161990293 ATGAGAGATTTCTCGGGGCCAGG - Intergenic
965406587 3:168276615-168276637 CAGAGAGATCAGTTGGGGATAGG - Intergenic
967696236 3:192534617-192534639 CAGGGAGATCTCTTGAGGTCAGG - Intronic
967937297 3:194739195-194739217 CAGAGAGATGTCTTGGGCATGGG + Intergenic
968213802 3:196870743-196870765 CGGAGAGATCACTTGAGGTCAGG - Intronic
969680795 4:8642327-8642349 CTGAGAGATGGTCTGGGGACAGG + Intergenic
970581720 4:17479231-17479253 CTGTGAGATCCCTTATGGACAGG - Intronic
971170979 4:24232299-24232321 ATGTGAGATCTCTTGGAGAAGGG - Intergenic
971770565 4:30890686-30890708 CTGATAGATATCTTGGGAAATGG + Intronic
972211064 4:36838124-36838146 CTGTGAGGGCTCTGGGGGACTGG - Intergenic
972594147 4:40515546-40515568 CTGAGCACTCTCTTGGGGATTGG - Intronic
972638591 4:40905839-40905861 CTGAGAGATCTCTTTGGTAAGGG + Intronic
974176441 4:58331766-58331788 CTGAGAGAACTTTTGAAGACGGG + Intergenic
975970980 4:80036571-80036593 CAGAGGGATCACTTGGGGTCAGG + Intronic
976748712 4:88432259-88432281 CAGTGAGATATCTTGGGGATAGG - Intronic
977808447 4:101331478-101331500 CTGAGAAATCTCTGAGGGGCAGG - Intronic
978127408 4:105151089-105151111 GTGAGAGATCACTTGAGGCCAGG + Intronic
979899457 4:126200027-126200049 CTGAGAGATGGCTAGGGGCCAGG - Intergenic
980230637 4:130041906-130041928 CAGAAAAATCTCTTGGGGAAAGG + Intergenic
980589167 4:134861482-134861504 CTGGCAGATCACTTGAGGACAGG - Intergenic
980698566 4:136393810-136393832 CTGACAGATTATTTGGGGACAGG - Intergenic
981608377 4:146564853-146564875 GGGTGAGATCTCTTGGGGTCTGG + Intergenic
981999198 4:151006712-151006734 CTGAGAAATCATTTGGGAACTGG - Intronic
983524219 4:168744084-168744106 CTGAGAGCTTTCATGAGGACAGG - Intronic
987210503 5:15677240-15677262 CGGGCAGATCTCTTGAGGACAGG + Intronic
987982887 5:25110936-25110958 CTGACAGATCTCCTGAGGTCAGG + Intergenic
988647780 5:33113471-33113493 CAGAGAGATCACTTGAGGTCAGG + Intergenic
989532146 5:42520397-42520419 GTCAGAGATCTCATGGGGACAGG + Intronic
994936798 5:106264305-106264327 TTGAAAGATTTCTTGGGGACTGG + Intergenic
995625215 5:114069040-114069062 CTGGCAGATCACTTGGGGTCAGG - Intergenic
996826166 5:127683612-127683634 CTGAGAAATCTCTTCCGTACCGG - Intergenic
999409901 5:151341706-151341728 CAGAGAGGTCTCTTAGGGAGAGG - Intronic
1000117387 5:158166369-158166391 CTGGGAGATCTCTGGGGGCAAGG + Intergenic
1001603955 5:172946853-172946875 CTGAGAGAACTCTAGTGGCCAGG - Intronic
1002577589 5:180183942-180183964 CTGGCAGATCTCTTGAGGTCAGG + Intronic
1003398127 6:5770539-5770561 GTGAGAGACATGTTGGGGACAGG + Intronic
1004717973 6:18237149-18237171 GAGAGAGATATCTTGGGGATGGG - Intronic
1006444093 6:34069248-34069270 CTGAGAGCTGTTTTGGGGAAGGG - Intronic
1007767892 6:44171836-44171858 CTGGCAGATCTCTTGAGGCCAGG + Intronic
1009351678 6:62688508-62688530 CTGGCAGATCTCTTGAGGTCAGG + Intergenic
1010104125 6:72148044-72148066 CTGAGCAATCTCTTGAGGAGGGG - Intronic
1011589736 6:88960714-88960736 GAGAGAGAGCTCTTGGAGACAGG - Intronic
1012116746 6:95309330-95309352 CTGAGAGATATTTTGGGGTGAGG + Intergenic
1012838032 6:104294743-104294765 CTGAGAAATCACATGGGGAGAGG - Intergenic
1012907784 6:105088204-105088226 CAGAGGGATCTCTTGAGGCCAGG + Intergenic
1012929244 6:105299369-105299391 CGGACAGATCACTTGAGGACAGG + Intronic
1013823016 6:114178250-114178272 CAGAGACATCTCTTGGTGAATGG + Intronic
1014070306 6:117174224-117174246 CAGAGAGATCACTTGAGGCCAGG + Intergenic
1017282540 6:152639456-152639478 CAGACAGATCACTTGAGGACAGG + Intergenic
1018682927 6:166279925-166279947 CTGAGAGCTATGTTGAGGACTGG - Intergenic
1020255316 7:6499956-6499978 CTGAGAGATTGCTTGAGGCCAGG - Intronic
1023093513 7:36638206-36638228 CTAAGAGATCTCATAGGGTCTGG + Intronic
1023789412 7:43740810-43740832 CTGGCAGATCACTTGGGGCCAGG - Intergenic
1023931090 7:44707156-44707178 CTGAGAGCTCTCCTGGGCCCAGG - Intronic
1024437678 7:49377911-49377933 ATGAAAGATCTTATGGGGACTGG + Intergenic
1026156181 7:67827716-67827738 CTGAATGATCTGTTGGGAACTGG + Intergenic
1026678952 7:72450939-72450961 TTGAGAGAACTCTAAGGGACTGG - Intergenic
1027236047 7:76298401-76298423 CAGAAAGATCTCTTGGGGCCAGG + Intergenic
1029956868 7:104649496-104649518 CTGAGAGGTCACTATGGGACAGG - Intronic
1033002384 7:137520945-137520967 CTTAGAGACCATTTGGGGACTGG + Intronic
1033641480 7:143266256-143266278 CAGACAGATCTCTTGAGCACAGG - Intronic
1035371793 7:158384300-158384322 CTGAGAGATGTGTTGGTGTCTGG - Intronic
1036027561 8:4927283-4927305 CTGGCAGATCGCTTGAGGACGGG - Intronic
1036069963 8:5430562-5430584 CTGAAAGCTCTCATGGAGACTGG + Intergenic
1036824236 8:11963908-11963930 CTGTGAGATCTCAAGGGAACAGG - Intergenic
1038771763 8:30489272-30489294 GTGAGAGATCACTTGAGGCCAGG - Intronic
1038910637 8:31959884-31959906 CGGAGGGATCACTTGGGGCCAGG - Intronic
1039046587 8:33456048-33456070 CTGAGAGAGCTATTGGCAACAGG - Intronic
1039211459 8:35220021-35220043 CTGAAAGATCACTTGAGGCCTGG - Intergenic
1039954740 8:42198260-42198282 CTGGCAGATCTCTTGAGGTCAGG + Intronic
1040928125 8:52706887-52706909 CAGACAGATCACTTGGGGTCAGG - Intronic
1041095178 8:54342620-54342642 CTGAGAGAACTGGTGGGGCCTGG + Intergenic
1041511370 8:58658765-58658787 ATGAGACTTCCCTTGGGGACAGG + Intronic
1043345174 8:79289513-79289535 ATGAGAGAACTCTTGGCAACAGG - Intergenic
1044147573 8:88736292-88736314 GTGAAAGATCTTTTAGGGACTGG + Intergenic
1047220896 8:122917318-122917340 CTGTGTGGTCTCATGGGGACAGG - Intronic
1047613588 8:126544607-126544629 CAGAGGGATCTCTTGAGGCCAGG + Intergenic
1048425372 8:134318702-134318724 CTGTGAGATCTCTGGGGGCAGGG - Intergenic
1052568522 9:30189892-30189914 ATGAAAGATCTCTTGAGGGCTGG + Intergenic
1052750065 9:32481229-32481251 CTAAGTGAGCTCTTGAGGACAGG + Intronic
1054889035 9:70232309-70232331 CTGAGTCATCTCATTGGGACTGG + Intergenic
1055376934 9:75658880-75658902 CTGGCAGATCTCTTGAGGTCAGG - Intergenic
1056197834 9:84245715-84245737 GTGAGGGATCTCTTGAGGTCAGG + Intergenic
1056403978 9:86256929-86256951 GTGAGAGATCACTTGAGTACAGG + Intronic
1057179141 9:93020446-93020468 CAGAGAGACCTCCAGGGGACGGG + Intronic
1060772883 9:126345590-126345612 CAGAGAGACCTCCTGGGGAGTGG - Intronic
1061124234 9:128663744-128663766 CTGGGAGATCACTTGAGCACTGG - Intergenic
1062440378 9:136566951-136566973 CAGGGAGATCTCCTGGGGAGAGG + Intergenic
1185504665 X:623643-623665 CCCATAGATTTCTTGGGGACGGG + Intergenic
1187094923 X:16137676-16137698 CTAGGAGATCTCTTGGGAAAAGG + Intronic
1190108741 X:47576187-47576209 CTCAGAGATTTTTGGGGGACTGG - Exonic
1199324021 X:146476339-146476361 CTGAAGGAGCTGTTGGGGACAGG + Intergenic
1201548256 Y:15190131-15190153 CAGAGAGATCACTTGAGGTCAGG + Intergenic