ID: 1146467323

View in Genome Browser
Species Human (GRCh38)
Location 17:33096554-33096576
Sequence TGCTGTTGGCTTCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 300}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146467323_1146467333 23 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467333 17:33096600-33096622 AGCTCATGTTCTGATGGGGGAGG 0: 1
1: 0
2: 4
3: 50
4: 332
1146467323_1146467331 19 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467331 17:33096596-33096618 CTGGAGCTCATGTTCTGATGGGG 0: 1
1: 0
2: 9
3: 41
4: 266
1146467323_1146467328 17 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467328 17:33096594-33096616 TCCTGGAGCTCATGTTCTGATGG 0: 1
1: 1
2: 12
3: 53
4: 371
1146467323_1146467330 18 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467330 17:33096595-33096617 CCTGGAGCTCATGTTCTGATGGG 0: 1
1: 2
2: 8
3: 75
4: 354
1146467323_1146467326 0 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467326 17:33096577-33096599 TGGTGAAGTCTCTGTCCTCCTGG 0: 1
1: 0
2: 0
3: 30
4: 376
1146467323_1146467334 26 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467334 17:33096603-33096625 TCATGTTCTGATGGGGGAGGTGG 0: 1
1: 0
2: 4
3: 28
4: 304
1146467323_1146467332 20 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467332 17:33096597-33096619 TGGAGCTCATGTTCTGATGGGGG 0: 1
1: 2
2: 8
3: 76
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146467323 Original CRISPR TGCTGTTGGCTTCACTGTGC TGG (reversed) Intronic
901712682 1:11128057-11128079 TCTTGTTGGCTGCATTGTGCCGG + Exonic
902569231 1:17336189-17336211 TCTGGTTGGCTTCACTTTGCCGG - Exonic
906216958 1:44047562-44047584 TGATGTTGATGTCACTGTGCCGG - Intergenic
906895843 1:49770404-49770426 TGCTGTTGAATTCAGTTTGCCGG + Intronic
907321540 1:53605836-53605858 TGCTGTGGGCCTGACTGTGCTGG - Intronic
908667920 1:66512652-66512674 TGCTGTTGGATTCAGTTAGCTGG - Intergenic
908917933 1:69153967-69153989 TGCTGTTGGATTCAGTTTGCTGG + Intergenic
910208721 1:84773265-84773287 TGCTTTTGGCTTCTATGTCCTGG + Intergenic
910399301 1:86822630-86822652 TGCTGTTGCCTTCCCTCTGCCGG - Intergenic
911785028 1:101935735-101935757 TGCTGTTTGATTCAGTTTGCTGG - Intronic
911940704 1:104043988-104044010 TGCTGCTGGATTCAGTTTGCTGG + Intergenic
912004759 1:104884372-104884394 TGTTCTTGGCTTCATTGTTCTGG + Intergenic
912709026 1:111936645-111936667 AGATCTTGGCTTCACTGTGTGGG + Intronic
913158859 1:116127670-116127692 AGCTGTTGGCATCACTGCTCTGG - Intronic
913315248 1:117544905-117544927 TGATGTTGGGTTCACAATGCAGG - Intergenic
915804933 1:158837172-158837194 TGTTGTTGGCTTTACTGTTTTGG + Intronic
917436404 1:175025387-175025409 GGCTGTTGTCTTTACTGTCCTGG + Intergenic
918952594 1:191158930-191158952 TGTTGTTTGATTCACTTTGCTGG - Intergenic
921041005 1:211432398-211432420 TTTTGTAGGCTTCACAGTGCTGG - Intergenic
921666766 1:217881894-217881916 TGCTGTCTGCTACACTTTGCAGG + Intergenic
923745459 1:236695693-236695715 TGCAGTGTGCTTCACAGTGCTGG + Intronic
923886681 1:238165005-238165027 TGTTGTTGGCTGCACTGTTTGGG + Intergenic
924140158 1:241013651-241013673 GACTGTTGCCTTCACTCTGCTGG + Intronic
1064098142 10:12439606-12439628 TGCAGTTGAATTCACTGTCCCGG + Intronic
1067349230 10:45460828-45460850 TACTGTATGCTACACTGTGCTGG + Intronic
1067796982 10:49327804-49327826 GGATTTTGGCTTTACTGTGCTGG - Intergenic
1067906348 10:50294957-50294979 TGCTGGTGGCTGCAATGGGCTGG - Intergenic
1068210318 10:53912055-53912077 TGCTGCTGGATTCAGTTTGCGGG - Intronic
1069277212 10:66607566-66607588 TGCTGCTGGATTCAGTTTGCAGG - Intronic
1070705482 10:78634691-78634713 GGCTCTTGTCTTCACTGTTCAGG + Intergenic
1071495420 10:86164526-86164548 TTCTGTTTCCTCCACTGTGCTGG - Intronic
1072547618 10:96452066-96452088 TGCTTTGGGCAGCACTGTGCTGG + Intronic
1072740405 10:97905773-97905795 TGCTGTGGGCTTCTCTGTCGTGG - Intronic
1074648146 10:115488104-115488126 TGCTGCTGGATTCAATTTGCCGG + Intronic
1074687296 10:115972544-115972566 TGATGTTGGCCTCACTCAGCAGG - Intergenic
1075108356 10:119558618-119558640 TGGTGTTGGCTACACTTCGCAGG + Intergenic
1075851467 10:125591463-125591485 AGCTGTTGGCTTCCCACTGCGGG - Intronic
1076023817 10:127095731-127095753 TGATACTGTCTTCACTGTGCAGG - Intronic
1076110024 10:127852976-127852998 GGCAGTTGGCTTCCCTGGGCAGG - Intergenic
1076112543 10:127872157-127872179 TGCTGTTGGCTGAACCCTGCGGG - Intergenic
1076798977 10:132811969-132811991 TGCTGATGGCCCCACTGTGTGGG - Intronic
1077859589 11:6164339-6164361 TGCTGTTGAATTCAGTGTGCTGG - Intergenic
1078155849 11:8799237-8799259 TGCTCTTGGCTTGGCTGTGCTGG - Intronic
1079869523 11:25780590-25780612 TGGGGGTGGCTACACTGTGCTGG - Intergenic
1080287173 11:30628787-30628809 TGCTGTTTTCTTCACTAGGCTGG - Intergenic
1081817615 11:45959019-45959041 TGCTCTTGGATTCAGTTTGCTGG - Intronic
1082702967 11:56456364-56456386 TGCTCGTGGATTCACTTTGCTGG + Intergenic
1083871067 11:65488909-65488931 TGCTGGTGACGTCACTGGGCAGG + Intergenic
1084470142 11:69354591-69354613 TGCTGTGAGCTTGGCTGTGCAGG - Intronic
1085776112 11:79368173-79368195 TGCTCTTGGCTTCTCTGTGGTGG - Intronic
1086576250 11:88341769-88341791 TGCTGGTGGCTCTACTGTTCTGG + Intergenic
1087393328 11:97567219-97567241 TGCTGATGACTTCACAGTCCAGG + Intergenic
1087997954 11:104835219-104835241 TGCTGTTGGATTCAGTTTGCTGG + Intergenic
1089001743 11:115057792-115057814 TGCTGGTGTCTCCACTGTTCTGG - Intergenic
1090246058 11:125216691-125216713 TGCAGTGGGCTTCCCTGGGCAGG - Intronic
1090455793 11:126848678-126848700 TGCTGTTGGACTCTCTGTGTAGG + Intronic
1091660153 12:2377204-2377226 AGCTGTGGGTTTCACTGAGCAGG + Intronic
1091844761 12:3647229-3647251 TCCTGGTGGTTTCACTGTGAAGG + Intronic
1093388447 12:18587406-18587428 GGCTGTTGGCTTGACTTTGTTGG - Intronic
1094756569 12:33476892-33476914 TGCTGGTGGCTCCACAGTTCTGG - Intergenic
1095209075 12:39472036-39472058 TGCTGCTGGATTCAGTTTGCTGG + Intergenic
1095217133 12:39562922-39562944 TGCTGTTGAATTCAGTTTGCTGG - Intronic
1099312591 12:81046333-81046355 TGCTGTTGGCTTTCCTCTGGTGG + Intronic
1099676416 12:85766603-85766625 TGCTGTTGGGTTCCCATTGCAGG - Intergenic
1101187787 12:102298097-102298119 TGCTGTTGGATTCAGTTTGCTGG + Intergenic
1101472316 12:105009846-105009868 TGCTGCTGGATTCAGTTTGCTGG + Intronic
1101487603 12:105181342-105181364 TGCTGCTGGATTCAGTTTGCTGG + Intronic
1102009888 12:109611824-109611846 TGGTGCTGGCTCCACTGGGCTGG + Intergenic
1102109407 12:110353263-110353285 TGCACTTGGCTTCACTGTTCAGG - Intergenic
1105819718 13:24069411-24069433 GGCTCTTGGCTTCACTGTTTTGG + Intronic
1105890526 13:24679852-24679874 GGCTGTTGGCTGGACTGGGCTGG - Intergenic
1106319569 13:28624990-28625012 TGCTGTTGTCTTCAAAGAGCTGG - Intergenic
1106919563 13:34548918-34548940 TATTGTTGGCTTGACTGTGTGGG + Intergenic
1107650185 13:42536904-42536926 TGCAGTTGTCTTCAGTGTCCTGG - Intergenic
1108626966 13:52239312-52239334 TGCTGTTGGATTCAGTTTGCTGG - Intergenic
1108659099 13:52567149-52567171 TGCTGTTGGATTCAGTTTGCTGG + Intergenic
1109087997 13:58000813-58000835 TGCTGCTGGTTTCAGTTTGCCGG + Intergenic
1109650423 13:65316744-65316766 TGCTGTTGGATTCAGTTTCCTGG - Intergenic
1110350882 13:74505917-74505939 TGCTTTTGACTTCACAGTGAAGG + Intergenic
1110460651 13:75741490-75741512 TGCTGCTGGATTCAGTTTGCCGG - Intronic
1110973161 13:81793366-81793388 TGCTGTTGGATTGAGTCTGCTGG + Intergenic
1111802293 13:92995887-92995909 TGCTGATGGGTTGACTGTGATGG - Intergenic
1112652224 13:101412390-101412412 TTCTCTTGGCTTCAGTGTTCTGG + Intronic
1112658211 13:101474981-101475003 TATTGTTGTCTTCACTGTCCAGG - Intronic
1113549915 13:111184811-111184833 CCCCGTGGGCTTCACTGTGCGGG + Intronic
1113654629 13:112060225-112060247 TGCTGTAGTGTTCACTCTGCAGG - Intergenic
1114691865 14:24590590-24590612 TGTTGTTGGATTCAGTGAGCTGG + Intergenic
1114985197 14:28217840-28217862 TGCTGTGAGCTTCACTGTCTGGG + Intergenic
1118308544 14:64675807-64675829 TGCTGTTGTCTCTACTTTGCTGG + Intergenic
1119933685 14:78571049-78571071 TGATGTTGGCCTCACTGTCTTGG + Intronic
1120154173 14:81073838-81073860 TGTTGTTGTCTTTACTGTACTGG - Intronic
1121049225 14:90809394-90809416 TGCTGTGTGCTTCACTGTAGGGG - Intronic
1121365343 14:93303913-93303935 TGCTGTAGGCATCACTGCTCAGG - Intronic
1122157744 14:99760478-99760500 TGATGTTGGGATTACTGTGCAGG + Intronic
1122721800 14:103726463-103726485 TGCTGTTGGGTCCAGTGTGGAGG + Intronic
1125187011 15:36942494-36942516 TGCTGTTGTTTTCATTGTGTTGG - Intronic
1126515269 15:49527146-49527168 TGCTGTTGGAATCAGTTTGCTGG - Intronic
1127616678 15:60693059-60693081 TGCTGCTGGATTCAGTTTGCTGG - Intronic
1127875329 15:63106820-63106842 TGTGGTTGGGGTCACTGTGCAGG + Intergenic
1130257286 15:82331649-82331671 TGCTGGAGGCTTGGCTGTGCTGG + Intergenic
1132570256 16:641262-641284 TGCTGGGGGCATCCCTGTGCTGG - Intronic
1132570291 16:641365-641387 TGCTGGGGGCATCCCTGTGCTGG - Intronic
1132570343 16:641517-641539 TGCTGGGGGCATCCCTGTGCTGG - Intronic
1132842688 16:1985926-1985948 TGCGGTTCACTTCATTGTGCAGG - Exonic
1133297852 16:4763885-4763907 TGCTGCTGGCTGCACACTGCTGG - Intronic
1134863278 16:17580329-17580351 TGCTGTTGGATTCAATTTCCTGG - Intergenic
1135203152 16:20457423-20457445 TGCTGTTGGATTCAGTTAGCTGG - Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1138720713 16:59075998-59076020 TGCTGCTGGATTCAGTTTGCTGG - Intergenic
1140404732 16:74701118-74701140 TGGTGTTTGCTTCTCTGTGCTGG + Intergenic
1140630152 16:76842425-76842447 TGATGCTGGATTCAGTGTGCTGG + Intergenic
1141346788 16:83253992-83254014 TTCTCTTGGCCTCACGGTGCTGG - Intronic
1141783526 16:86181790-86181812 TGCTCTTGGCCTCACTGACCTGG - Intergenic
1142016813 16:87753252-87753274 TGCTTTTGTCTTCACAGTGGTGG - Intronic
1143012895 17:3875993-3876015 TACTGTTGGTTGCTCTGTGCTGG - Intronic
1143397018 17:6608534-6608556 TGCTGTTGTCATCTCTGAGCTGG - Intronic
1143699490 17:8647612-8647634 GGCTGTTGGGTGCACTGTGCTGG + Intergenic
1145782268 17:27571058-27571080 GGCTCTTTGCTTCACTGTGTTGG + Intronic
1146353059 17:32112056-32112078 CACTGGTGGCTTCTCTGTGCTGG + Intergenic
1146467323 17:33096554-33096576 TGCTGTTGGCTTCACTGTGCTGG - Intronic
1147245164 17:39115513-39115535 GGCTCCTGGCTTCACTGTCCTGG - Intronic
1149136916 17:53377983-53378005 TGCTGTTGGATTTAGTTTGCTGG + Intergenic
1149901621 17:60485088-60485110 TGCTGCTGGATTCAGTTTGCCGG + Intronic
1151757166 17:76081606-76081628 TGCTGTTGGCTGACGTGTGCGGG + Exonic
1151961336 17:77407540-77407562 GGGTGTTGGCTTCAGTGTGGGGG + Intronic
1152813146 17:82391695-82391717 GGCTCTTGGCGTCGCTGTGCCGG - Intronic
1152910251 17:83000853-83000875 TGCTGTGTGCTTCACTGGTCTGG - Intronic
1153293875 18:3527215-3527237 TGCTTTTGGCCTCACAGGGCTGG - Intronic
1155153493 18:23140069-23140091 GCCTGTTGGCTTCCCAGTGCTGG - Intronic
1156096617 18:33540554-33540576 TCCTGTGGGCTCCACTCTGCAGG - Intergenic
1156403516 18:36761444-36761466 TACTGTGGGCTTCACCCTGCAGG - Intronic
1156695192 18:39757421-39757443 TGCTGCTGGATTCAGTTTGCTGG - Intergenic
1156758333 18:40556201-40556223 TGTGCCTGGCTTCACTGTGCTGG + Intergenic
1157481210 18:48055040-48055062 GGCTTCTGGCTTCACTGGGCAGG + Intronic
1158451392 18:57569020-57569042 TGGTGTTGGCTTCCCTGCTCTGG - Intronic
1158656654 18:59342427-59342449 TGCTGTAGGATTCATTTTGCTGG - Intronic
1159977134 18:74727950-74727972 AGCTTTTTGCTTCAGTGTGCTGG + Intronic
1160339802 18:78080060-78080082 TGCTCTTGGCTTCACTGAGCAGG - Intergenic
1160495958 18:79375600-79375622 TGCTGTTGGCTTGCCTGTTCAGG + Intronic
1166624734 19:44340497-44340519 TGCTGTGGTCTTCACTGAGGAGG - Exonic
1166908075 19:46128726-46128748 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
1168630899 19:57955252-57955274 TCCTACTGGCTGCACTGTGCAGG + Intergenic
925860334 2:8169195-8169217 AGCAGTTGGCTCCCCTGTGCTGG + Intergenic
926538455 2:14144046-14144068 TGCTGTTGGATTCACTTTTCTGG + Intergenic
926970292 2:18460590-18460612 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
927154736 2:20215059-20215081 CCCTGTGGGCTTCACTGTGATGG - Intronic
927226218 2:20767904-20767926 TGTAGGTGGCTTCTCTGTGCAGG - Intronic
929232850 2:39577398-39577420 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
930775277 2:55164630-55164652 TCCTGCTGGCTTCATTCTGCTGG - Intergenic
932051227 2:68400115-68400137 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
934586664 2:95505012-95505034 TGTTGCTGCCTTCACAGTGCAGG + Intergenic
936642912 2:114335491-114335513 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
937734298 2:125271090-125271112 GGCTATTGGCTGCACTCTGCAGG + Intergenic
938844123 2:135190963-135190985 TGCTGCTGAATTCAGTGTGCTGG - Intronic
940131133 2:150383536-150383558 AGCTGTTGGATTCAATCTGCTGG + Intergenic
943096527 2:183435927-183435949 TGCTGCTGGCTTGCTTGTGCTGG + Intergenic
944919093 2:204392033-204392055 TATTGTTTCCTTCACTGTGCAGG + Intergenic
946813385 2:223550633-223550655 TGCTATTGGCTCCAGTGTTCAGG - Intergenic
948549920 2:238764443-238764465 TGGTTTTACCTTCACTGTGCAGG + Intergenic
948729138 2:239952383-239952405 TGCTGCGGGCTGCACAGTGCTGG - Intronic
948747229 2:240105701-240105723 TGCACTTGGGGTCACTGTGCTGG - Intergenic
948899389 2:240948517-240948539 TGCTGTTCGCTGCCCTGTGCTGG - Intronic
1170070796 20:12364260-12364282 TGCTGTTGGGTTCACTTTGCTGG - Intergenic
1170438519 20:16354323-16354345 TGCTGTTGAGTTCTATGTGCTGG + Intronic
1170804260 20:19616277-19616299 AGCTGTTGGCTCCACTGGGCTGG - Intronic
1171065283 20:22009077-22009099 TGCAGATGTCTTCACTGTGCAGG - Intergenic
1171537251 20:25905440-25905462 TGCTGTTGAATTCAATTTGCTGG + Intergenic
1171803864 20:29655853-29655875 TGCTGTTGAATTCAATTTGCTGG - Intergenic
1171840203 20:30200775-30200797 TGCTGTTGAATTCAATTTGCTGG + Intergenic
1172010777 20:31844621-31844643 TGCAGGTGGCTTCCCTGTCCAGG - Exonic
1175327925 20:58142463-58142485 TGCTGGTGAGTTCATTGTGCTGG - Intergenic
1178017228 21:28362171-28362193 TGCTGTTGAATTCAGTTTGCTGG + Intergenic
1178328355 21:31663703-31663725 TGCTTTTTACTTCACTGTGAGGG + Intronic
1179236310 21:39549996-39550018 TGCTGTCTGCCTCACTGTACTGG + Intergenic
1179618059 21:42594491-42594513 TGATGTTGGCTTCACAATGTTGG + Intergenic
1180280645 22:10690587-10690609 TTCTGTTGGCTTCTCTCTCCCGG + Intergenic
1181402422 22:22658973-22658995 TGCTGTTGGATTCATGTTGCTGG - Intergenic
1181737791 22:24895261-24895283 TGCTGCTGGAGTCGCTGTGCAGG - Exonic
1182413729 22:30207700-30207722 TTCTGGTGTCTTCTCTGTGCGGG + Intergenic
1184749519 22:46477269-46477291 GGCTGGTGCCTTCACTGTGGCGG - Intronic
1185167571 22:49271124-49271146 TGCTGTTGGCTGGTCTGTGAAGG - Intergenic
951782224 3:26376670-26376692 TGCTTTTTGATTCACTATGCTGG + Intergenic
952978971 3:38719924-38719946 TCCTGATGGCTTCGCTGGGCTGG + Intronic
954318198 3:49812698-49812720 TGGTGAGGACTTCACTGTGCAGG - Exonic
955177299 3:56629680-56629702 TGCAGTTTGCTTCAGTGTTCAGG - Intronic
956355198 3:68383563-68383585 TGCTGCTGGATTCAGTTTGCTGG + Intronic
959323994 3:104912663-104912685 TGCTGTTGAATTCAGTTTGCTGG + Intergenic
959966693 3:112363672-112363694 TGATGTTGGCATCACTCTGATGG - Intergenic
960970125 3:123133536-123133558 TGCTGTTTTCCTCACTGTGATGG + Intronic
961355859 3:126339625-126339647 TCCTCATGCCTTCACTGTGCAGG + Intergenic
962279489 3:134039328-134039350 TGCTCATTGCTTCCCTGTGCAGG + Intronic
963340338 3:144025094-144025116 TGCTGCTGGATTCAGTTTGCCGG - Intronic
964379859 3:156087453-156087475 TCCTGTTGGCTTCATTATGATGG + Intronic
964600938 3:158500247-158500269 TGTTGTTGGATTCAGTGAGCTGG + Intronic
965494053 3:169375938-169375960 TGCTGCTGGATTCAATTTGCCGG - Intronic
965631327 3:170735689-170735711 TGCTGTTGGATTCAGTTTGCTGG - Intronic
967480440 3:189966724-189966746 GGATGTTGGTTTCTCTGTGCAGG - Intronic
970071070 4:12161167-12161189 TACTGTTGTCTTCACTGTTTGGG + Intergenic
970716577 4:18933524-18933546 TGCTTTTGGATTCACAGGGCGGG + Intergenic
971821458 4:31560967-31560989 TTCTGTAGCCTTCACTGTGGGGG + Intergenic
973020840 4:45204704-45204726 TGCCGTTGAATTCAGTGTGCTGG + Intergenic
973667870 4:53181264-53181286 TGCTGCTGGATTCAGTTTGCAGG - Intronic
974168317 4:58232464-58232486 TGTTGTTATCTTCACTGTTCTGG + Intergenic
975729524 4:77324009-77324031 TGCTGCTGGATTCAGTTTGCCGG + Intronic
977653504 4:99495867-99495889 TGCTGCTGGATTCAGTTTGCCGG - Intergenic
977757256 4:100687582-100687604 TGCTGTAGGATTCAGTTTGCTGG + Intronic
978114094 4:104998567-104998589 TGCTGTTGGATTCAATTTGCTGG + Intergenic
978442461 4:108748114-108748136 TGCTGTTGGTTTGGCTGTCCTGG - Exonic
978961767 4:114688173-114688195 TGCTGTTGCCTTCACGCAGCTGG + Intergenic
979195094 4:117911730-117911752 TGCTGTTGGATTCAATTTGTTGG + Intergenic
979691879 4:123568142-123568164 TGCTGTTGGATTCAGTTAGCAGG + Intergenic
980724554 4:136741887-136741909 TGGTATTGGCTTCTGTGTGCAGG - Intergenic
980891615 4:138821391-138821413 TGTTGTGGGCTTCACTGTTAGGG + Intergenic
981235795 4:142414471-142414493 TGCTCTTGGATTGTCTGTGCTGG + Intronic
985290856 4:188385724-188385746 TGCTGTTAGATTCAGTTTGCTGG + Intergenic
985671699 5:1210127-1210149 TGCTGGAGGCTGCACTGGGCAGG + Intronic
985919042 5:2953317-2953339 TGTTGTTGGATTCACTTTCCTGG + Intergenic
985960467 5:3299193-3299215 TGATGCTGCCTGCACTGTGCTGG - Intergenic
987036444 5:14023687-14023709 TCCTGCTGGCTTCACTGGTCAGG - Intergenic
987106323 5:14643315-14643337 TGCTGTTGGATTCAATTTGCTGG + Intergenic
988634192 5:32964191-32964213 TCATGTTGGCTTCAATGTGTTGG + Intergenic
988935317 5:36076388-36076410 TGCTGCTGGATTCGCTTTGCAGG + Intergenic
989006850 5:36824393-36824415 TGCTGTTGGATTCAGTTAGCTGG + Intergenic
990055707 5:51575328-51575350 TGCTGTTGGATTCAGTTTGCTGG - Intergenic
990300060 5:54441246-54441268 TCATGTTGGCCTCACTGTCCTGG - Intergenic
990840198 5:60070575-60070597 TGCTCTTGGATTCAGTTTGCTGG + Intronic
992795787 5:80254302-80254324 TGCTGGAGGCATCACTGTGGTGG - Intronic
993785847 5:92134529-92134551 TGCTGCTGGATTCAGTTTGCAGG + Intergenic
994327721 5:98468309-98468331 TGCTGTTGGATTCACTTTGATGG - Intergenic
995317609 5:110793956-110793978 TGTTGTTGGATTCAGTTTGCTGG + Intergenic
996141041 5:119909665-119909687 TGCTGTTGGATTCAGTTAGCTGG + Intergenic
997944902 5:138191420-138191442 TTCTGTTGGCTTCTCTGGGATGG - Intronic
999111798 5:149127808-149127830 TGCTGTTGGCTTCCTTGCACAGG - Intergenic
999620907 5:153472318-153472340 TGCTGCTGGATTCGGTGTGCCGG + Intergenic
999636690 5:153630420-153630442 TGCTGTGGGCTTCTATGAGCTGG + Intronic
1000327290 5:160182023-160182045 TCCTGTTGGCTCCAATCTGCTGG - Intergenic
1001872573 5:175169667-175169689 TGCTGTTTGCTTCACTACTCTGG + Intergenic
1002846534 6:950712-950734 TGATGGTGCCTTCACTTTGCTGG + Intergenic
1003537268 6:6986175-6986197 TACTGTTAGCTTCACTTTACAGG - Intergenic
1004317153 6:14599639-14599661 TGGTGTTGCCATCACTGTTCTGG - Intergenic
1006600155 6:35219883-35219905 TGCCCTTGGATTCACTATGCTGG - Intronic
1007990687 6:46252184-46252206 ATCTGGTGGCTTCATTGTGCTGG - Intronic
1009512648 6:64572040-64572062 TGCTGCTGGATTCAGTTTGCCGG - Intronic
1009706970 6:67264953-67264975 TGCTGTGGGCTTCCCTTTGCAGG + Intergenic
1010526130 6:76902592-76902614 TGCTGTTGGATTCGGTTTGCTGG + Intergenic
1011845476 6:91558942-91558964 TGCTGTTATCTTCAATGTACAGG + Intergenic
1012278560 6:97301894-97301916 ATCTGTAGGCTACACTGTGCTGG + Intergenic
1013305617 6:108844458-108844480 TGGTGGTGGCTGCACTGAGCTGG - Intergenic
1015878371 6:137846600-137846622 TTCTGTTCCCTTCACTGTCCCGG - Intergenic
1016983342 6:149873987-149874009 TGCTGTTGAATTCAGTTTGCTGG + Intergenic
1017542347 6:155415625-155415647 TGCTGCTGGCTTCACCATGCAGG + Intronic
1017630912 6:156395705-156395727 TTCTGTTGGCTTGACTGACCTGG - Intergenic
1019073243 6:169366861-169366883 AGCTGTGGGCTTCACAGTGCAGG + Intergenic
1019341669 7:511438-511460 TGCTGTAGGATTCACTGTTAAGG - Intronic
1020563004 7:9755021-9755043 TGCTGTTGGATTCAGTTTGCTGG + Intergenic
1021082447 7:16380372-16380394 TGCTGCTGGATTCAGTTTGCCGG + Intronic
1021143339 7:17054197-17054219 TGCAGTTTTCTTAACTGTGCTGG + Intergenic
1021625006 7:22584361-22584383 GGTTTTTGCCTTCACTGTGCTGG - Intronic
1021908992 7:25365308-25365330 TTCTGTGAGCTTCAGTGTGCAGG + Intergenic
1023025654 7:36047675-36047697 TGCTCTAGGCTTCTCTGTGTGGG - Intergenic
1023290925 7:38668250-38668272 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
1023763744 7:43491366-43491388 TGTTATTGCATTCACTGTGCTGG - Intronic
1023906308 7:44524236-44524258 TGCTGTTGGTGTTTCTGTGCTGG - Intronic
1026564912 7:71481733-71481755 GGCTGTTGGCTCCACCGTGAAGG + Intronic
1029862297 7:103585816-103585838 TGCTGTTGTTTTCAGTTTGCTGG - Intronic
1029951347 7:104589494-104589516 TGCTGCTGGATTCAGTTTGCCGG + Intronic
1030124321 7:106140132-106140154 TGCTGTTTGGTTCACTGTGGGGG - Intergenic
1031245532 7:119306753-119306775 TGCTGCTGGATTCAGTTTGCAGG - Intergenic
1031366314 7:120904461-120904483 TGCTGCTGGATTCAGTTTGCTGG - Intergenic
1031891559 7:127299749-127299771 TGCTGCTGGATTCAGTTTGCTGG - Intergenic
1033137286 7:138796075-138796097 TGCAGTGGGCTTCACAGGGCAGG - Intronic
1033288059 7:140059538-140059560 TGCTGTTGGCCTGACTCTTCTGG - Intronic
1034316562 7:150138612-150138634 TGGTGGTGGCATCACTTTGCTGG - Intergenic
1035068828 7:156126314-156126336 TGCTGCTGACGTCACTGTGATGG + Intergenic
1035172605 7:157027098-157027120 TGCTGTTGAATTCAGTTTGCTGG + Intergenic
1035980746 8:4368369-4368391 TGCTGCTGGATTCAGTTTGCTGG + Intronic
1036596310 8:10215498-10215520 TGATGTTGGCGTCACTCTCCCGG - Intronic
1036806575 8:11838527-11838549 TGCTTTTGGCTGCCCTGAGCTGG + Exonic
1038366141 8:26937319-26937341 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
1039377335 8:37048950-37048972 TTCTGTTGGCTTTACTCTTCCGG + Intergenic
1039616138 8:38956380-38956402 TGCTCCTTGCCTCACTGTGCGGG - Intronic
1042401196 8:68349356-68349378 TGCTGCTGGATTCAATTTGCAGG + Intronic
1042784360 8:72531289-72531311 AGCTTTTTGCTCCACTGTGCTGG + Intergenic
1046285271 8:112085572-112085594 TGCTGCTGGATTCAGTTTGCTGG - Intergenic
1046380146 8:113438984-113439006 TGCTGTTGCCTTTGCTGGGCTGG + Intergenic
1049871946 8:144986633-144986655 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
1051818890 9:21141584-21141606 TGCTCCTGGCTTTACTGAGCTGG + Exonic
1052267639 9:26592318-26592340 TGCTGTTGAATTCAATTTGCTGG + Intergenic
1053364081 9:37510690-37510712 TTCTGTTGTCTTCACAGAGCAGG + Intergenic
1054821423 9:69524843-69524865 TGCTGTTGGATTCAGTTTGCTGG - Intronic
1055459712 9:76507749-76507771 TGCTGTTGGTTTGAATGTGATGG + Intergenic
1056276445 9:84998461-84998483 TGCTGTTGATTTCATAGTGCTGG - Intronic
1056608213 9:88105209-88105231 TGCTGTTGAATTCAGTTTGCTGG - Intergenic
1057292389 9:93814950-93814972 TCCTGTTGTCTTCACTTTCCTGG + Intergenic
1057496717 9:95566926-95566948 TGCTGCTTGCTTCTCTCTGCAGG + Intergenic
1057512535 9:95692710-95692732 TACTGTTTGCTTCCCTGTGGAGG + Intergenic
1058030278 9:100188553-100188575 TGCTGTTGGATTCAGTTTGCTGG + Intronic
1058943919 9:109839144-109839166 TGCTGCTGGATTCAGTTTGCCGG - Intronic
1060985112 9:127815302-127815324 TGCTGTTGGCCTGGCTGGGCTGG + Exonic
1061336998 9:129945669-129945691 TCCTGTTGGCTTCACAGAGTTGG + Intronic
1062368819 9:136226038-136226060 GGCTGTTGTTTTCACTGTGCTGG - Intronic
1062603439 9:137331014-137331036 TGCTGTTGGATTCCGTTTGCAGG - Intronic
1186780187 X:12904330-12904352 AGCTTTTGGCCTCACAGTGCAGG + Intergenic
1186957054 X:14695269-14695291 TGCAATTGCCTTTACTGTGCAGG + Intronic
1189626418 X:42902032-42902054 TGCTATAGGCTTGTCTGTGCAGG - Intergenic
1190518122 X:51246184-51246206 TGCTGTTGAATTCACTTTGCTGG - Intergenic
1190598421 X:52067750-52067772 TTGTGTTAGCTTCCCTGTGCTGG + Intronic
1190610403 X:52186323-52186345 TTGTGTTAGCTTCCCTGTGCTGG - Intronic
1191155662 X:57270476-57270498 TGCTGTTGAATTCAGTTTGCTGG - Intergenic
1191222686 X:58006472-58006494 TGCTGCTGGATTCAGTTTGCCGG - Intergenic
1191647310 X:63495849-63495871 TGCTGCTGGATTCAGTTTGCCGG - Intergenic
1191685760 X:63888625-63888647 TGCTGCTGGATTCAATTTGCTGG - Intergenic
1191804861 X:65124371-65124393 TGCTGTTGGACTCAGTTTGCTGG + Intergenic
1191928041 X:66336576-66336598 TGCTGTTGGATTCAGTTTGCTGG + Intergenic
1192301052 X:69903474-69903496 TGCTATTGGTTTTACTGTGTAGG - Intronic
1193160913 X:78228360-78228382 TGCTGCTGGATTCAGTTTGCCGG + Intergenic
1193167964 X:78303048-78303070 TGCTGTGGGCTACAGTGTTCTGG - Intronic
1193175306 X:78385177-78385199 TATTGTAGTCTTCACTGTGCGGG - Intergenic
1193294210 X:79815371-79815393 TGCTGCTGGATTCAGTTTGCTGG + Intergenic
1194047653 X:89028798-89028820 TGATGTTGGATTCAGTTTGCTGG + Intergenic
1194175118 X:90636497-90636519 TGCTGTTGCATTCAATTTGCTGG - Intergenic
1194194822 X:90880234-90880256 TGCTGCTGGATTCAATTTGCAGG + Intergenic
1194401409 X:93441352-93441374 TGCTGTTGGATTCAGTTTGCTGG - Intergenic
1194874313 X:99167443-99167465 TGCTGTTGGATTCGGTTTGCTGG - Intergenic
1195206817 X:102609156-102609178 TGCTGTTGGATTTGTTGTGCTGG + Intergenic
1195664440 X:107416163-107416185 TCCTGTTGGCTTCTCTGTTAAGG - Intergenic
1196687871 X:118528009-118528031 TGTTGTTGGCATCATTGTGGAGG + Intronic
1198122690 X:133609726-133609748 TTCTGTTGGGTTGACTGTACAGG + Intronic
1198168712 X:134083214-134083236 TGCTGCTGGATTCAGTTTGCCGG - Intergenic
1198663825 X:138999944-138999966 TGCTGCTGGATTCAGTTTGCCGG - Intronic
1199400504 X:147393506-147393528 TGCTGCTGGATTCAGTTTGCTGG - Intergenic
1199748081 X:150788153-150788175 TGCTGCTGGATTCAATTTGCTGG - Intronic
1200521763 Y:4217470-4217492 TGCTGTTGCATTCAATTTGCTGG - Intergenic
1200541439 Y:4462639-4462661 TGCTGCTGGATTCAATTTGCAGG + Intergenic
1200888009 Y:8291099-8291121 TGCTGCTGGTTTCAGTTTGCCGG + Intergenic
1201270206 Y:12246848-12246870 AGGTGTTGGCTTCCCTCTGCGGG - Intergenic
1201615161 Y:15889058-15889080 TGCTGCTGGATTCATTTTGCCGG - Intergenic