ID: 1146467323

View in Genome Browser
Species Human (GRCh38)
Location 17:33096554-33096576
Sequence TGCTGTTGGCTTCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 300}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146467323_1146467328 17 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467328 17:33096594-33096616 TCCTGGAGCTCATGTTCTGATGG 0: 1
1: 1
2: 12
3: 53
4: 371
1146467323_1146467326 0 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467326 17:33096577-33096599 TGGTGAAGTCTCTGTCCTCCTGG 0: 1
1: 0
2: 0
3: 30
4: 376
1146467323_1146467331 19 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467331 17:33096596-33096618 CTGGAGCTCATGTTCTGATGGGG 0: 1
1: 0
2: 9
3: 41
4: 266
1146467323_1146467332 20 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467332 17:33096597-33096619 TGGAGCTCATGTTCTGATGGGGG 0: 1
1: 2
2: 8
3: 76
4: 369
1146467323_1146467334 26 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467334 17:33096603-33096625 TCATGTTCTGATGGGGGAGGTGG 0: 1
1: 0
2: 4
3: 28
4: 304
1146467323_1146467333 23 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467333 17:33096600-33096622 AGCTCATGTTCTGATGGGGGAGG 0: 1
1: 0
2: 4
3: 50
4: 332
1146467323_1146467330 18 Left 1146467323 17:33096554-33096576 CCAGCACAGTGAAGCCAACAGCA 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1146467330 17:33096595-33096617 CCTGGAGCTCATGTTCTGATGGG 0: 1
1: 2
2: 8
3: 75
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146467323 Original CRISPR TGCTGTTGGCTTCACTGTGC TGG (reversed) Intronic