ID: 1146467348

View in Genome Browser
Species Human (GRCh38)
Location 17:33096713-33096735
Sequence GGCTCGCTTGGTTGGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146467348 Original CRISPR GGCTCGCTTGGTTGGGAGTC AGG Intronic
900275792 1:1826641-1826663 GGCTCACTTGGGTGGGAGAGTGG - Intronic
904328855 1:29745128-29745150 GGCACCCTGGGCTGGGAGTCAGG - Intergenic
905349765 1:37337448-37337470 GGCTCGGTTGGGTGGGGCTCAGG - Intergenic
905775272 1:40664251-40664273 GGCATTCTTGGTTGGGAGGCGGG - Intronic
905800895 1:40841885-40841907 GTCTCGCTTGGTTGCCAGGCTGG + Intergenic
908865746 1:68547428-68547450 AGTTCCCTTGGCTGGGAGTCGGG - Intergenic
914046936 1:144101459-144101481 GGCTAGCTTGGTTGGCCGGCTGG + Intergenic
914046950 1:144101520-144101542 GGCTGGCTTGGCTGGCAGGCTGG + Intergenic
914047054 1:144102009-144102031 GGCTGGCTTGGCTGGCTGTCTGG + Intergenic
914047497 1:144103950-144103972 GGCTGGCTTGGCTGGCAGGCTGG + Intergenic
914047568 1:144104247-144104269 GGCTGGCTTGGCTGGCAGGCTGG + Intergenic
914047959 1:144105990-144106012 GGCTGGCTTGGCTGGGTGGCCGG + Intergenic
914047989 1:144106116-144106138 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
914048008 1:144106204-144106226 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
914048014 1:144106225-144106247 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
914131167 1:144859214-144859236 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
914131173 1:144859235-144859257 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
915527870 1:156487312-156487334 GGCTACCTTGGTAGGGAGTGGGG - Intronic
917681844 1:177375531-177375553 GGCTGGAGTGGTTGGGATTCAGG + Intergenic
923689103 1:236175836-236175858 GGCTTGCTTGGTTAGGTGACTGG + Intronic
1064086195 10:12348662-12348684 GGCTGGCTTAGTAGGGTGTCCGG - Intergenic
1065754527 10:28919111-28919133 GGCTGGCCTGGTGAGGAGTCAGG - Intergenic
1069715088 10:70515457-70515479 GGCTGCCTTGGTTGAGAGCCAGG + Intronic
1069816154 10:71195856-71195878 TGCTGGCTGGGTTAGGAGTCAGG - Intergenic
1072361653 10:94664758-94664780 GCCTCCCTTGGCTGGGAGTGGGG + Intergenic
1074187384 10:111108616-111108638 GGCTTGCTTGGTTTGGTGTGTGG + Intergenic
1074541159 10:114366280-114366302 GGCATGCTTGGTAGGGATTCTGG + Intronic
1075668591 10:124247903-124247925 TGCTGGCTTGGGTGGGAGGCTGG - Intergenic
1079125374 11:17714735-17714757 GGCTCATTTGGTGGGGAGTGGGG - Intergenic
1079486703 11:20942454-20942476 GGCTCCCAGGGTTGGGAGTAGGG + Intronic
1083182769 11:60998516-60998538 GGGTCACTGGGTTGGGCGTCAGG - Intronic
1083743596 11:64723402-64723424 GGCCCGCCTGGTTGGGGGCCCGG - Intergenic
1085005366 11:73083517-73083539 GTCTCGCTTTGTTGCGAGGCTGG - Intronic
1089363163 11:117904234-117904256 GCCTCCCTTGGGTGGGAGCCAGG - Intronic
1091058871 11:132443391-132443413 GGCTCACATGGTTGGGTTTCTGG + Intronic
1103000772 12:117383853-117383875 GGATCACTTGCTTGGGAGTTCGG - Intronic
1105335148 13:19460282-19460304 GCTTCCCTTGGCTGGGAGTCGGG + Intronic
1105514608 13:21078013-21078035 GGCTCCCTTTGTTCAGAGTCCGG - Intergenic
1105624737 13:22101764-22101786 GGCACGCTGGGGTGGGAGTTGGG - Intergenic
1111137556 13:84068196-84068218 GTCTCGCTTTGTTGAGAGGCTGG - Intergenic
1113379022 13:109786359-109786381 CGCTCGCTGGGCCGGGAGTCGGG + Exonic
1115924165 14:38412587-38412609 GCCTCCCTTGGTTGGGGGTAGGG - Intergenic
1123416673 15:20100511-20100533 GGCTGGCTTGGTTGGCTGGCTGG + Intergenic
1123417267 15:20102969-20102991 GGCTGGCTTGGCTGGGAGGCTGG + Intergenic
1123417276 15:20103007-20103029 GGCTGGCTTGGCTGGTGGTCTGG + Intergenic
1123417471 15:20103848-20103870 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
1123417480 15:20103886-20103908 GGCTGGCTTGGCTGGTGGTCTGG + Intergenic
1123417877 15:20105488-20105510 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
1123447724 15:20342439-20342461 GGCTGGCTTGGTTGGCTGGCTGG - Intergenic
1123447911 15:20343317-20343339 GGCTCGCTTGGCTGGTTGGCTGG - Intergenic
1123447918 15:20343352-20343374 GGCTGGCTTGGTTGGCTGGCTGG - Intergenic
1123526012 15:21107617-21107639 GGCTGGCTTGGTTGGCTGGCTGG + Intergenic
1123526543 15:21109823-21109845 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
1123526552 15:21109861-21109883 GGCTGGCTTGGCTGGTGGTCTGG + Intergenic
1123526846 15:21111126-21111148 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
1123526855 15:21111164-21111186 GGCTGGCTTGGCTGGTGGTCTGG + Intergenic
1127047685 15:55043941-55043963 AGCTGGATTGGCTGGGAGTCTGG - Intergenic
1131035332 15:89218361-89218383 GGCTGGCCTGGCTGGGTGTCTGG + Intronic
1133261531 16:4554011-4554033 TGCTGGCTGGGTTGGGAGTCAGG + Intergenic
1135424984 16:22328004-22328026 GCCTGGATTGCTTGGGAGTCAGG + Intronic
1136716054 16:32285377-32285399 GGCTGGCTTGGTTGGCTGGCAGG + Intergenic
1136716063 16:32285420-32285442 GGCTGGCTTGGTTGGCTGTGTGG + Intergenic
1136716081 16:32285495-32285517 GGCTGGCTTGGTTGGCTGGCAGG + Intergenic
1136716090 16:32285538-32285560 GGCTGGCTTGGTTGGCTGTGTGG + Intergenic
1136822730 16:33335990-33336012 GGCTGGCTTGGTTGGCTGGCAGG + Intergenic
1136822739 16:33336033-33336055 GGCTGGCTTGGTTGGCTGTGTGG + Intergenic
1136822755 16:33336099-33336121 GGCTGGCTTGGTTGGCTGGCAGG + Intergenic
1136822764 16:33336142-33336164 GGCTGGCTTGGTTGGCTGTGTGG + Intergenic
1136822777 16:33336202-33336224 GGCTGGCTTGGTTGGCTGTGTGG + Intergenic
1136823030 16:33337273-33337295 GGCTGGCTTGGCTGGCTGTCTGG + Intergenic
1136823123 16:33337697-33337719 GGCTGGCTTGGCTGGCTGTCTGG + Intergenic
1136823476 16:33339210-33339232 GGCTGGCTTGGCTGGCTGTCTGG + Intergenic
1136823495 16:33339296-33339318 GGCTGGCTTGGCTGGCTGTCTGG + Intergenic
1136823661 16:33340007-33340029 GGCTGGCTTGGTTGGCTGGCAGG + Intergenic
1141359701 16:83384265-83384287 GGCTGGCATGGTTGAGAGGCTGG - Intronic
1203010510 16_KI270728v1_random:233013-233035 GGCTGGCTTGGTTGGCTGTGTGG - Intergenic
1203010523 16_KI270728v1_random:233073-233095 GGCTGGCTTGGTTGGCTGTGTGG - Intergenic
1203010532 16_KI270728v1_random:233116-233138 GGCTGGCTTGGTTGGCTGGCAGG - Intergenic
1203010548 16_KI270728v1_random:233182-233204 GGCTGGCTTGGTTGGCTGTGTGG - Intergenic
1203010557 16_KI270728v1_random:233225-233247 GGCTGGCTTGGTTGGCTGGCAGG - Intergenic
1203138940 16_KI270728v1_random:1747539-1747561 GGCTCGCTTGGCTGGCTGCCTGG - Intergenic
1203139183 16_KI270728v1_random:1748589-1748611 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
1203144684 16_KI270728v1_random:1792286-1792308 GGCTGGCTTGGTTGGCTGGCAGG + Intergenic
1203144693 16_KI270728v1_random:1792329-1792351 GGCTGGCTTGGTTGGCTGTGTGG + Intergenic
1203144698 16_KI270728v1_random:1792355-1792377 GGCTGGCTTGGTTGGCTGTGTGG + Intergenic
1203144709 16_KI270728v1_random:1792407-1792429 GGCTGGCTTGGTTGGCTGTGTGG + Intergenic
1146467348 17:33096713-33096735 GGCTCGCTTGGTTGGGAGTCAGG + Intronic
1147192597 17:38746809-38746831 GGCTCCCCTGGTTGGGGGTTGGG - Intronic
1152363568 17:79843263-79843285 GGCCCGCTAGGGTGGGACTCGGG - Intergenic
1156400333 18:36733873-36733895 GGCTCACTGGCTTGGGAGCCTGG - Intronic
1157522716 18:48356440-48356462 GAATTGCTTGGTTGGGAGACAGG - Intronic
1161697189 19:5776035-5776057 GGCACGCATGGGTGGGACTCTGG - Intronic
1162861359 19:13507578-13507600 GCGTCGCATGGTTGGGAGGCAGG + Intronic
1166097926 19:40553089-40553111 GGCTCCATAGGTTGGGAGTGAGG + Intronic
1166851325 19:45762931-45762953 GGGTCGCTTGGGTGGGGGACAGG - Intronic
1168298142 19:55387914-55387936 CGCTGGCCTGGTTGGGGGTCAGG - Exonic
1168500492 19:56888722-56888744 GGATCACTTGCTTGGGAGTAGGG + Intergenic
1202686643 1_KI270712v1_random:55579-55601 GGCTGGCTTGGCTGGGTGGCCGG + Intergenic
1202686673 1_KI270712v1_random:55705-55727 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
1202686692 1_KI270712v1_random:55793-55815 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
1202686698 1_KI270712v1_random:55814-55836 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
1202686851 1_KI270712v1_random:56496-56518 GGCTCTCTTGGTTGGTTGGCTGG + Intergenic
1202687443 1_KI270712v1_random:59023-59045 GGCTGGCTTGGCTGGCAGGCTGG + Intergenic
927506379 2:23617611-23617633 AGCTTCCTTGGTTGGGAGTGTGG + Intronic
928748379 2:34442423-34442445 GGATCACTTGGATGGGAGGCGGG + Intergenic
928849953 2:35734044-35734066 ACCTCCCTTGGTTGGGAGTAGGG - Intergenic
933958854 2:87396318-87396340 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
933958909 2:87396562-87396584 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933960812 2:87407042-87407064 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933960914 2:87407503-87407525 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
933960969 2:87407747-87407769 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933961193 2:87408774-87408796 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
933961399 2:87409707-87409729 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
933961455 2:87409951-87409973 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933962133 2:87413176-87413198 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
933962158 2:87413281-87413303 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933962191 2:87413420-87413442 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933962631 2:87415345-87415367 GGCTGGCTTGGCTGGCTGTCTGG - Intergenic
933962634 2:87415362-87415384 GGCTCGCTTGGCTGGCTGGCTGG - Intergenic
933963146 2:87417656-87417678 GGCTGGCTTGGCTGGCTGTCTGG - Intergenic
933963149 2:87417673-87417695 GGCTCGCTTGGCTGGCTGGCTGG - Intergenic
933963264 2:87418156-87418178 GGCTGGCTTGGTTGGCTGGCTGG - Intergenic
933963570 2:87419443-87419465 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933963656 2:87419835-87419857 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
933963680 2:87419940-87419962 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933963713 2:87420079-87420101 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933963979 2:87421307-87421329 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933964180 2:87422215-87422237 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933964398 2:87423320-87423342 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
933964665 2:87424559-87424581 GGCTGGCTTGGTTGGCTGGCAGG - Intergenic
933964694 2:87424680-87424702 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933964803 2:87425163-87425185 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933964916 2:87425672-87425694 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933964971 2:87425927-87425949 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
933964993 2:87426032-87426054 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933965168 2:87426832-87426854 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
933965464 2:87428204-87428226 GGCTGGCTTGGTTGGCTGGCAGG - Intergenic
933965493 2:87428334-87428356 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933966108 2:87430984-87431006 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
933966204 2:87431385-87431407 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
934243281 2:90289652-90289674 GGCTGGCTTGGCTGGGTGGCCGG - Intergenic
934244814 2:90297425-90297447 GGCTCGCTTGGCTGGCTGTCTGG - Intergenic
934264033 2:91500016-91500038 GGCTGGCTTGGCTGGCTGTCCGG + Intergenic
934264235 2:91500969-91500991 GGCTGGCTTGGTTGGCTGGCTGG + Intergenic
934269980 2:91527438-91527460 GGCTGGCTTGGCTGGCAGACTGG + Intergenic
934270126 2:91528064-91528086 GGCTGGCTTGGCTGGGTGGCCGG + Intergenic
934270158 2:91528203-91528225 GGCTGGCTTGGCTGGGTGGCCGG + Intergenic
934270182 2:91528308-91528330 GGCTGGCTTGGCTGGGTGGCTGG + Intergenic
937361979 2:121235920-121235942 GGCTCCCCTGGGTGGGAGTAGGG - Intronic
938371826 2:130774082-130774104 GGCTTTCTTTGTTGGGAGACTGG - Intergenic
938376112 2:130807837-130807859 GGCTCTCTTGGTTGGGGCACAGG + Intergenic
947360390 2:229340204-229340226 GGCTCCCTGGGCTGGGAGTCTGG - Intergenic
1169900867 20:10550597-10550619 GGCTCTCTTGGGTAGGAGTGTGG - Intronic
1170148608 20:13204948-13204970 GTCTCTCTTGGAGGGGAGTCTGG - Intergenic
1170927946 20:20742825-20742847 GGTTGACTTGGTTGGGAGTGGGG + Intergenic
1176308818 21:5138900-5138922 GGCTCACCTGGGTGGGGGTCAGG - Intronic
1180553694 22:16559980-16560002 GGCTGGCTTGGCTGGTTGTCTGG - Intergenic
1180553872 22:16560781-16560803 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
1180553961 22:16561178-16561200 GGCTGGCTTGGCTGGGTGGCTGG - Intergenic
1180554982 22:16565934-16565956 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
1180555479 22:16568050-16568072 GGCTGGCTTGGCTGGCAGGCTGG - Intergenic
1180904113 22:19396623-19396645 GGCTCTCTGGGGTGGGACTCTGG - Intronic
1182584437 22:31335912-31335934 GGTGCACTTGGTGGGGAGTCAGG - Intronic
1183276638 22:36902343-36902365 GGCTTGTTTCCTTGGGAGTCTGG + Intergenic
955208371 3:56918023-56918045 AGCTTGCTTTGTGGGGAGTCAGG - Intronic
955997594 3:64693291-64693313 GGCTCTCTGGGTCAGGAGTCAGG - Intergenic
958650690 3:96932088-96932110 GCCTCCCTTGGTTGGGGGTGGGG + Intronic
961439270 3:126943097-126943119 GGCTGGCATGGTTGAGAGACTGG - Intronic
970453245 4:16193497-16193519 GGGCTGGTTGGTTGGGAGTCAGG - Intronic
971808977 4:31398869-31398891 GGCTCCCTTGCTTGGGAGGGTGG + Intergenic
972227389 4:37029139-37029161 TGCTCTTTTGGTTGGAAGTCAGG - Intergenic
972907419 4:43768160-43768182 AGCTCTCGTGGTTTGGAGTCAGG + Intergenic
973872021 4:55176262-55176284 CTCTCTCTTGGTTGGGAGTGGGG - Intergenic
975181894 4:71355542-71355564 GGACCACTTGGTAGGGAGTCTGG - Intronic
980129159 4:128802845-128802867 AGCTGGCTTGGTGGGGAGGCGGG - Intergenic
984680528 4:182603572-182603594 GTCTCACTTGGTTGGAACTCTGG + Intronic
987808963 5:22808633-22808655 GTCTCGCTTTGTTGCCAGTCTGG + Intronic
989676773 5:43981948-43981970 GCCTCCCTTGGCTGGGAGTGGGG + Intergenic
992005804 5:72476302-72476324 GGATCTCTTGGGTGGGAGTCAGG + Intronic
997096853 5:130923485-130923507 GCCTCCCTTGGTTGGGAGGTGGG - Intergenic
997583767 5:135033141-135033163 GGCTGGCCTTGCTGGGAGTCCGG + Intronic
1008715877 6:54288980-54289002 GCCTGACTTGGATGGGAGTCTGG + Intergenic
1015953539 6:138577484-138577506 GGCTGGTTTGGCTGGGAGTGAGG + Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1020968512 7:14903035-14903057 AGCTAGCTTGAGTGGGAGTCTGG - Intronic
1032850316 7:135789357-135789379 GGCTCTGTGGGTTGGAAGTCTGG - Intergenic
1034456923 7:151175640-151175662 GGCTCCCTTGCAGGGGAGTCGGG - Intergenic
1039658156 8:39433178-39433200 GCCTCCCTTGGCTGGGAGTGGGG - Intergenic
1040333741 8:46405612-46405634 GGTTGGCATGGTTGGGAGGCAGG + Intergenic
1040532104 8:48274432-48274454 GGCTCACATGCTTGGGAGTGGGG + Intergenic
1041709178 8:60877216-60877238 GGCTCGCGCTGATGGGAGTCCGG + Intergenic
1044018450 8:87074657-87074679 GCTTCCCTTGGCTGGGAGTCAGG + Intronic
1046690092 8:117273949-117273971 GTCTTGCTTGGTTGGAAATCAGG - Intergenic
1047658997 8:127012094-127012116 GTCTCGCTTGGTTGCCAGGCTGG + Intergenic
1049685325 8:143937111-143937133 GGCTGGCTTGGTGAGGGGTCTGG + Intronic
1054710666 9:68507925-68507947 AACTCCCTTGGTTGGGAATCTGG + Intronic
1059326853 9:113508913-113508935 GGCTTGCATGGAAGGGAGTCAGG + Intronic
1061839152 9:133347715-133347737 GGCCCCCTAGGTTCGGAGTCTGG + Intronic
1185500944 X:597113-597135 GTTTCACTGGGTTGGGAGTCTGG - Intergenic
1192980096 X:76330290-76330312 GCCTCCCTTGGTTGGGGGTTGGG - Intergenic
1194397560 X:93404233-93404255 GGCTGGAGTGGTTGGGATTCAGG + Intergenic
1200152809 X:153959579-153959601 GGCCTGCTTGTGTGGGAGTCTGG + Intronic