ID: 1146467348

View in Genome Browser
Species Human (GRCh38)
Location 17:33096713-33096735
Sequence GGCTCGCTTGGTTGGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146467348 Original CRISPR GGCTCGCTTGGTTGGGAGTC AGG Intronic