ID: 1146469680

View in Genome Browser
Species Human (GRCh38)
Location 17:33114005-33114027
Sequence CCTACTATGTGCAAGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146469677_1146469680 2 Left 1146469677 17:33113980-33114002 CCATCAATATTCATATGCATATA 0: 1
1: 0
2: 2
3: 34
4: 527
Right 1146469680 17:33114005-33114027 CCTACTATGTGCAAGGATTATGG 0: 1
1: 0
2: 2
3: 28
4: 242
1146469675_1146469680 29 Left 1146469675 17:33113953-33113975 CCTTTCTGCCTTGCTTTTCTCAT 0: 1
1: 1
2: 9
3: 143
4: 1194
Right 1146469680 17:33114005-33114027 CCTACTATGTGCAAGGATTATGG 0: 1
1: 0
2: 2
3: 28
4: 242
1146469676_1146469680 21 Left 1146469676 17:33113961-33113983 CCTTGCTTTTCTCATCAGTCCAT 0: 1
1: 0
2: 3
3: 42
4: 374
Right 1146469680 17:33114005-33114027 CCTACTATGTGCAAGGATTATGG 0: 1
1: 0
2: 2
3: 28
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146469680 Original CRISPR CCTACTATGTGCAAGGATTA TGG Intronic
901667321 1:10833717-10833739 CCTACTATGTGCCAGGCATTGGG + Intergenic
902804577 1:18852915-18852937 CCTACTATGTGCCAGGCCTGGGG - Intronic
904312683 1:29639535-29639557 CCTACTATGTGCCAGGCACAAGG + Intergenic
904417138 1:30370106-30370128 CCCACAAAGTGCTAGGATTATGG - Intergenic
905142100 1:35855550-35855572 CCCACTATCTGCAGGGATTAAGG - Exonic
906041696 1:42792922-42792944 GCTACTGGGGGCAAGGATTAGGG - Intronic
906804566 1:48767923-48767945 CCTACTATGTGCCAGGCTCTGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907479029 1:54731137-54731159 CCTACTATGTGCCAGGCCTCAGG + Intronic
907738978 1:57145084-57145106 CCTACTATGTGGAAATATTTTGG - Intronic
907864476 1:58386432-58386454 CTTAAGATGTGCAAGGACTAGGG + Intronic
909356504 1:74715802-74715824 GCGACTCTGTGCAAGGATTCAGG - Intronic
909547608 1:76865289-76865311 CCTACTATGTGCCAGGTATTAGG - Intergenic
909582117 1:77248122-77248144 CCTAAAATGTGCAGGTATTAAGG + Intergenic
909680660 1:78287810-78287832 CCTACTATGTGGAAGAAGTGGGG + Intergenic
912123703 1:106506455-106506477 GTTACTCTGTGCAAGGTTTATGG - Intergenic
912936234 1:114005771-114005793 CCTACTATGTGCCAGGCTGAAGG - Intergenic
912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG + Intergenic
914439878 1:147695410-147695432 CCTATTATGTGAAAGGAAAATGG + Intergenic
914952414 1:152128286-152128308 CCTACTAAGTGTTAGGATTTGGG + Intergenic
916572260 1:166038196-166038218 CCTACTATGTGCTAGGCATTAGG + Intergenic
916874982 1:168959557-168959579 CCTACTATGTGCCAGGCCTTGGG + Intergenic
917654251 1:177110589-177110611 CCTACTATGTGCAAGGTACATGG + Intronic
918252624 1:182717025-182717047 GCTACTATGTGCCAGGGATAGGG - Intergenic
920418797 1:205816150-205816172 CCTACTATGTGCCAGGAGCTGGG - Intergenic
920664817 1:207955341-207955363 CTTACTGTATACAAGGATTATGG + Intergenic
922220424 1:223554003-223554025 CCTACTATGTGCCAGGCTTTGGG + Intronic
1064270589 10:13861748-13861770 CTTACTCTGTGCAAGGTTGATGG - Intronic
1065275252 10:24079164-24079186 GCCACAATGTGCAGGGATTATGG + Intronic
1067697536 10:48546869-48546891 CCTACTATGAGCCAGGATCTGGG + Intronic
1068781691 10:60925971-60925993 CCCACAAAGTGCTAGGATTACGG - Intronic
1069100441 10:64313800-64313822 CCTACTACATGCAATAATTATGG - Intergenic
1070401571 10:76057339-76057361 CCTACTATGTGCCAGGCCTTAGG - Intronic
1071158500 10:82719288-82719310 TCTATTATGTGGAATGATTAGGG + Intronic
1071264770 10:83955122-83955144 CCTACTATGTGCAAGGTATGGGG - Intergenic
1072445864 10:95497894-95497916 CCTACTATGTGCCAGGCTCTGGG - Intronic
1072551874 10:96484852-96484874 CCTACTATGTGCCAAGAACAGGG - Intronic
1072719853 10:97773539-97773561 CCTACTATCTGCAAGGCATGGGG + Intergenic
1072859905 10:98992568-98992590 CCTACTATGTACAAGGCATTGGG + Intronic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1074883467 10:117676524-117676546 CCTACTATGTGCCAGGCATCAGG - Intergenic
1075853574 10:125608678-125608700 CCTACTGTGTGCCAGCACTAGGG + Intronic
1077637509 11:3853963-3853985 CTTACTATGTGCAGGGTCTATGG + Intergenic
1077795827 11:5490779-5490801 TCTACTAGCTGCAAGAATTAGGG + Intronic
1078607579 11:12790413-12790435 CCTACTGTGTCCAAGGGATATGG - Intronic
1079778869 11:24572597-24572619 ACTACTCTGTGCAAGGATAGTGG + Intronic
1083294026 11:61705701-61705723 CCTACTATGTGCCAGGGATTGGG - Intronic
1084059562 11:66661564-66661586 CCTACTATGAGCTAGGATGTGGG - Intronic
1085029590 11:73262796-73262818 TCCACTATCTGCCAGGATTAAGG - Intergenic
1085267581 11:75246419-75246441 CCTACTATGTGCCAGGGTCTGGG + Intergenic
1087639262 11:100737993-100738015 CCTACTATGTGCAAAACGTAAGG - Intronic
1087932709 11:103997031-103997053 CCTACTATGTGATAGAATGATGG - Intronic
1088274437 11:108069699-108069721 CCTACTACGTGCAGGCACTAAGG - Intronic
1088692548 11:112340066-112340088 GCTGCTATGTACAATGATTAAGG + Intergenic
1089550066 11:119267716-119267738 CCTACTATGTGCTAGGCTCGGGG - Intronic
1092438313 12:8472515-8472537 CCCAGTATGAGGAAGGATTATGG + Intronic
1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG + Intergenic
1093147595 12:15585423-15585445 CCTACTATGTTCAAGGGCTCTGG - Intronic
1094627862 12:32141902-32141924 CCTACTATGTGCTAGGCTCTGGG - Intronic
1097231634 12:57515597-57515619 CCCACTATCTGCTAGCATTATGG - Intronic
1098370130 12:69749886-69749908 CCTACTCTGTGCCAGGATCTGGG - Intronic
1098552477 12:71778568-71778590 CTTACTATGTGCCAGGCTTTGGG + Intronic
1098664535 12:73145174-73145196 CTGACTATGTGCTAGGATGAAGG - Intergenic
1099037434 12:77606554-77606576 CATACTATGTGCAAGGTTCTAGG - Intergenic
1100009133 12:89932961-89932983 CCTACTATGTGTAAGGCACATGG - Intergenic
1101295266 12:103416906-103416928 ACTAGTATGTGCAAGGAGAATGG + Intronic
1101734673 12:107454095-107454117 CCTACTATGTGCCAGGCACAGGG - Intronic
1102184027 12:110933892-110933914 CCTACTATGTGCCAGGACCGAGG - Intergenic
1102698919 12:114822318-114822340 CCTACAAAGTGCTGGGATTACGG - Intergenic
1102768899 12:115456315-115456337 GCTACTAAGTGGAAGGATTCTGG - Intergenic
1103252336 12:119511054-119511076 CCTACTGTGTGCTAGGATGAAGG - Intronic
1106683624 13:32033669-32033691 CCTACTATGTGCCAGGCTGTGGG + Intronic
1107913300 13:45125076-45125098 CCTACTATCTGCAAGGCTTTAGG - Intronic
1110321825 13:74168892-74168914 CCTATAATGTGAAAGTATTAGGG + Intergenic
1111293363 13:86196860-86196882 CTTACTATGTACATGGAATATGG + Intergenic
1112864846 13:103881978-103882000 CCTACTTTGTGCAAGGACCCTGG - Intergenic
1115748295 14:36460917-36460939 CTTACTATGTGCCAGGACTCAGG + Intergenic
1117595461 14:57322925-57322947 CCAAATATGTGCAAGCATAATGG - Intergenic
1118365184 14:65088690-65088712 CCTACTATGTGCAGGCACTGAGG + Intronic
1118745865 14:68772658-68772680 CCTACTATGTGCCAAGAGTGGGG - Intergenic
1119678487 14:76574315-76574337 CCTACTATGTGCCAGGCATTTGG - Intergenic
1119734874 14:76975384-76975406 CCTACTATGTGCCAGGCTCCAGG - Intergenic
1121428061 14:93867030-93867052 CCTAATATATGCCAGGATTAGGG - Intergenic
1121511851 14:94518543-94518565 CCTTTTATGTGCAAGGTTCAAGG - Intergenic
1122156575 14:99753692-99753714 CCTACTATGTGCCAGGGCTGGGG - Intronic
1125335620 15:38623514-38623536 CCTACTATGTGCCAGGAACTTGG - Intergenic
1126311993 15:47327872-47327894 CCTACTAAATGCCAGGATCAAGG + Intronic
1128385617 15:67146281-67146303 CCTACTATGTGCAAGGCACTTGG - Intronic
1128625344 15:69196184-69196206 CCTAGTATGTTCAAGGAACAAGG + Intronic
1129170676 15:73805684-73805706 CCTACTATGTGCCAGCTTTGAGG - Intergenic
1130075590 15:80686455-80686477 CCTACTATGAGCCAGAAATATGG - Intronic
1132262568 15:100439807-100439829 CATACAAACTGCAAGGATTATGG + Intronic
1133319524 16:4904309-4904331 CCTACTGTATGCAAGGAGTTGGG + Intronic
1134019884 16:10914154-10914176 CCTACTATGTGCCAGGCCCAGGG - Intronic
1135549510 16:23387478-23387500 CCTCCAAAGTGCTAGGATTACGG - Intergenic
1136297495 16:29312013-29312035 CCAACTGTGTGCAAGGATATCGG + Intergenic
1136653477 16:31693630-31693652 CCTACTAGGTGGGAGGATTCTGG + Intergenic
1136667075 16:31821189-31821211 CCCACAAAGTGCTAGGATTACGG + Intergenic
1136672256 16:31869043-31869065 CCTACTAGGTGGGAGGATTCTGG + Intergenic
1139684601 16:68593130-68593152 CCTACTATGTGCCAGTATTGGGG - Intergenic
1141780215 16:86154465-86154487 CCTACTGTGTGCAAGGCCTTGGG + Intergenic
1142059049 16:88018090-88018112 CCAACTGTGTGCAAGGATATCGG + Intronic
1143146576 17:4780524-4780546 CCTACTATGTGCCAAGATTGGGG + Intronic
1144620660 17:16816438-16816460 CCTACTATGTGCCAGGCATTGGG + Intergenic
1144884980 17:18451709-18451731 CCTACTATGTGCCAGGCATTGGG - Intergenic
1145147239 17:20492668-20492690 CCTACTATGTGCCAGGCATTGGG + Intergenic
1146469680 17:33114005-33114027 CCTACTATGTGCAAGGATTATGG + Intronic
1147572048 17:41577338-41577360 CCTACTATGTGCCAGGCATTGGG + Intergenic
1148126146 17:45238056-45238078 CCTACTATGTGTCAGGAACAGGG + Intronic
1150162616 17:62911658-62911680 CCTACTTTGTGGAAGACTTAGGG + Intergenic
1150245279 17:63670131-63670153 TCTACTATGTGCCAGAAATATGG + Intronic
1150840556 17:68601722-68601744 CCTACTATGTGCCAGGCATGTGG - Intergenic
1151392048 17:73793962-73793984 CCAACTATGTGCAAGGGCTCTGG - Intergenic
1152421600 17:80196208-80196230 CCTACTGTGTGCAAGGCCCAAGG - Intronic
1153225246 18:2894907-2894929 CCTACGATGTGCAAGGCTCTTGG + Intronic
1155222586 18:23698763-23698785 TCTACTATGTGCCAGGTATAGGG + Intronic
1155354805 18:24941884-24941906 CCTACTATGTGCAAGGTGCTTGG - Intergenic
1155373565 18:25131657-25131679 CCTACTATGTACAAGGCTCTGGG - Intronic
1155731999 18:29172099-29172121 CCCATGATGTGCAGGGATTATGG + Intergenic
1155919950 18:31593599-31593621 CCTACTGTGTGCAAGGCTGGGGG + Intronic
1156082370 18:33353236-33353258 CTTACTATTTGCATGGAATATGG + Intronic
1157443504 18:47727976-47727998 CCTACTATGGGCAAAGTGTAGGG + Intergenic
1157644835 18:49257397-49257419 TCTACTATGTGTAACCATTAGGG - Intronic
1159034544 18:63264169-63264191 CCTACTATGAGCAAATATGAAGG - Intronic
1159333518 18:67032398-67032420 CCCACAATATGCAGGGATTATGG + Intergenic
1161609300 19:5232029-5232051 CCTACTATGTGCCAGCACCAAGG + Intronic
1161609314 19:5232150-5232172 CCTACTATGTGCCAGCACCAAGG + Intronic
1161609492 19:5233484-5233506 CCTACTATGTGCCAGCACCAAGG + Intronic
1165638322 19:37362777-37362799 CCTTATGTGTGCAAGGATTGTGG + Exonic
1166884049 19:45948236-45948258 CCTACTATGTGCCAAGCATAGGG + Intronic
1168678237 19:58294658-58294680 CCTTATATGTGCAAGGAGTGTGG + Exonic
926107248 2:10160152-10160174 CGAACTATGTGCAAGGCGTAGGG - Intronic
931304071 2:61011399-61011421 CCTACTATGTGGAAGCATTGTGG - Intronic
931696932 2:64878182-64878204 CCTTTTGTGTGCAAGGATTAAGG + Intergenic
931859787 2:66342709-66342731 CCTACTATGTGCTAGGCATGGGG - Intergenic
932585139 2:73022901-73022923 CCTACCATGTGCCAGGAATGGGG - Intronic
941162508 2:162052060-162052082 CCTCCCAAGTGCTAGGATTACGG - Intronic
941278880 2:163525285-163525307 CCTCCCAAGTGCTAGGATTATGG + Intergenic
943196430 2:184757291-184757313 CAGACTTTGTGCAAGGATTTGGG - Intronic
943594215 2:189835995-189836017 CCTACAATTTGCAAGAATTTTGG + Intronic
943953852 2:194161712-194161734 CCTGCTATGTGCAAGGGGTAGGG + Intergenic
944211711 2:197212520-197212542 CCTACTATGTGCTAGCAGTTAGG - Intronic
944367336 2:198937710-198937732 CCTAATTTTTGCAAGGTTTAGGG + Intergenic
945987573 2:216367643-216367665 TCTATTATGTGGGAGGATTAGGG - Intronic
946252258 2:218420904-218420926 CCTACTATGTGCTAGGAGCTGGG + Intronic
1170746265 20:19101671-19101693 CCTACTGTGTGCAAGGCTCTTGG - Intergenic
1171118208 20:22545502-22545524 CCTACTCTATGCAAGGCTTCAGG + Intergenic
1172113170 20:32559352-32559374 CCTACTATGTGCCAGCATCTAGG - Intronic
1173990610 20:47299951-47299973 CCTACCATGCTCAAGAATTATGG - Intronic
1174212755 20:48892790-48892812 CCTCTTATGTGCCAGGATTCTGG + Intergenic
1174420927 20:50398841-50398863 CCTACTATGTACCAGGAGTGGGG - Intergenic
1174585392 20:51604257-51604279 CCTGCCGTGTGCCAGGATTATGG - Intronic
1174738641 20:52990329-52990351 CCTACTATGTGCAAATGTTTTGG - Intronic
1175192505 20:57221064-57221086 CCTACTATGTGCCAGGCTCTAGG + Intronic
1175260411 20:57670491-57670513 CCTCCTAGGTGCCAGGATCAAGG + Intronic
1175285048 20:57832258-57832280 CCTACTATGTGCAGTGGTGATGG + Intergenic
1175523305 20:59616771-59616793 CCAGCTACTTGCAAGGATTAGGG - Intronic
1176360159 21:5988515-5988537 CCTACTCTCTGCAGGGATTTGGG - Intergenic
1179344154 21:40540529-40540551 CCTACAATGTGGAAGAATTAAGG - Intronic
1179763359 21:43550035-43550057 CCTACTCTCTGCAGGGATTTGGG + Intronic
1181821451 22:25478949-25478971 CCTACTATGTGCCAGGTGCAGGG + Intergenic
1181997875 22:26897426-26897448 CCTACTATGTGCAAGGTCTTGGG + Intergenic
1182463650 22:30500791-30500813 CCTACTATGCGCCAGGCTGAGGG + Intronic
1182806725 22:33078388-33078410 CCTACTATGTGCCAGGACCCAGG + Intergenic
1183099402 22:35574700-35574722 CCTACTATGTGCCAGGTTCTAGG - Intergenic
1183307172 22:37088824-37088846 CTCACTATGTGTAAGGATCATGG + Intronic
1184128655 22:42504323-42504345 CTTACTAGGTGCCAGGATTGGGG - Intergenic
1184137450 22:42557638-42557660 CTTACTAGGTGCCAGGATTGGGG - Intronic
950368577 3:12507612-12507634 CCTACTATGTGCCAGGCATTGGG + Intronic
951975577 3:28503936-28503958 CTTCCAAAGTGCAAGGATTATGG - Intronic
952877749 3:37961247-37961269 CCAACTATGAGCCAGGATTTAGG + Intronic
954312279 3:49778880-49778902 CCTCCAAAGTGCTAGGATTACGG + Intronic
956630872 3:71315506-71315528 ACTACTAAGTGGAAGGAATAAGG + Intronic
957913697 3:86657478-86657500 CCTATTATGTGAAAACATTAAGG - Intergenic
958182370 3:90076611-90076633 CCTTCTCTGTGTAAGGTTTATGG + Intergenic
959297126 3:104550542-104550564 CCTACTATGTGCCAGGTCCAAGG - Intergenic
960544243 3:118894505-118894527 CCTACTATTTGAAAGCTTTAAGG - Intergenic
962469568 3:135693777-135693799 CCTACTATGCGAAAGGCTTAAGG - Intergenic
965681986 3:171261089-171261111 CCTACTGTGTGGAAGGATTGAGG + Intronic
965807851 3:172560277-172560299 CCTAATATGTGCTAGGAATTTGG - Intergenic
965897903 3:173600100-173600122 TCTACTAGTTGCAAGCATTAAGG + Intronic
965908511 3:173741365-173741387 CCTACTATGTGCCAGGTAAAAGG + Intronic
966022785 3:175236287-175236309 CCTCCAATGTGCTGGGATTACGG - Intronic
966042651 3:175510293-175510315 CCTACGATATACAGGGATTATGG + Intronic
966626487 3:182022274-182022296 CCTCCCAAGTGCTAGGATTACGG + Intergenic
966640003 3:182179141-182179163 CCCTCTGTGTGCAAGGCTTATGG + Intergenic
967051046 3:185784826-185784848 CCTACTATGTGCAAGGCAATGGG + Intronic
967355694 3:188568459-188568481 CTTCCTATGTGCTAGGGTTATGG + Intronic
967819705 3:193829771-193829793 CCTACTATGTGCCTGGCATATGG + Intergenic
970299723 4:14668407-14668429 CCTAGCATGTGCCAGGATTCCGG - Intergenic
971254967 4:25006090-25006112 CCCACTATGGGCAAGCACTAAGG - Intronic
974879760 4:67740600-67740622 CCTACTATGTCCTAGGAATTTGG - Exonic
975200735 4:71585282-71585304 CTTACTATTTTCAAGTATTATGG + Intergenic
975217174 4:71769218-71769240 CTTACTCTTGGCAAGGATTAAGG + Intronic
978620819 4:110633101-110633123 CCTACTGTGTGCTAGGCTTCAGG + Intronic
979464223 4:121017773-121017795 CCTACAAAGTGCTGGGATTATGG + Intergenic
980677649 4:136109793-136109815 CCTCCAAAGTGCTAGGATTATGG + Intergenic
981326417 4:143453233-143453255 TCTACTCTGTGCAAAGCTTAAGG - Intronic
983654072 4:170063538-170063560 CCTACTATGTGCTGTGATTAGGG + Intronic
984254031 4:177369057-177369079 CCTACTATGTGAAAGATTCAGGG + Intergenic
984446045 4:179837035-179837057 CCTGCTATGTGTTAGGATTTGGG + Intergenic
986274739 5:6263790-6263812 CCCATGATGTGCAGGGATTATGG - Intergenic
988282916 5:29173228-29173250 CCCACTATGTGTGAGGATTAGGG + Intergenic
988326739 5:29778078-29778100 CTTACTATGTATAAGGATTTAGG + Intergenic
991164986 5:63555396-63555418 CCTACTATTTTCAATGATAAAGG + Intergenic
991411308 5:66348102-66348124 CCTAATATCTCCAAGAATTATGG + Intergenic
995422683 5:111984687-111984709 CCTACTATGTGCAAGACACAAGG + Intronic
997816782 5:137026947-137026969 ACTACTCTGTGCCAGGATTCAGG - Intronic
998054965 5:139066638-139066660 TCTACTATGTGCCAGGTTTTAGG + Intronic
998501456 5:142636493-142636515 CCTACTATGTGCCAGACATAAGG + Intronic
999520656 5:152347566-152347588 CCTACTATATGTAAAGATTTTGG - Intergenic
999885156 5:155914371-155914393 CCTACTATGTGCCAGGCTCTAGG + Intronic
1003828723 6:9981210-9981232 CTTATTATGTGCAAGGCATATGG - Intronic
1004940676 6:20553250-20553272 CCTCCTAAGTGCTGGGATTACGG - Intronic
1005571532 6:27150030-27150052 CCTTCCATGTGCAATGATTGAGG - Intergenic
1005587103 6:27287532-27287554 CCTAGCATGTGAAAGGATTCTGG + Intronic
1006394348 6:33777353-33777375 CCTACTATGTGTCAGGCTCAGGG + Intronic
1007509516 6:42364469-42364491 CCTACTATGTGCCAGGCTCTGGG - Intronic
1012562885 6:100607498-100607520 CTTTCTGTCTGCAAGGATTATGG - Intronic
1013034334 6:106365543-106365565 CCTCCCAAGTGCTAGGATTACGG + Intergenic
1013932710 6:115553882-115553904 CTTACTATGTGAAAGCATCATGG + Intergenic
1015564830 6:134558608-134558630 CCTACGACGTGCAGGGATTATGG - Intergenic
1015635698 6:135271753-135271775 CCTACTATGTGCCAGCACTAAGG + Intergenic
1016662393 6:146596685-146596707 CCTACTACATGCAAGGTTTAGGG - Intergenic
1017504934 6:155059691-155059713 CCTACCATGTGCAAGGAGAGGGG - Intronic
1018886708 6:167944328-167944350 CCTACTATGTGCCGGGCCTATGG - Intronic
1021517908 7:21507291-21507313 CCTGCTGTGTGGAAGGAATAGGG + Intronic
1024474638 7:49797786-49797808 CCTATTGTGTGCCAGGAGTAGGG - Intronic
1025249903 7:57344619-57344641 CCTACTATGTGCCAGGAGTGGGG + Intergenic
1026004290 7:66588858-66588880 CCTACCCTGTTCAAGGATCAAGG + Intergenic
1026026946 7:66753134-66753156 CCTACCCTGTTCAAGGATCAAGG - Intronic
1028095411 7:86754629-86754651 CCTACTATGTGCTAAAACTATGG - Intronic
1028160663 7:87481041-87481063 CTTACTATGTGCAAGGACCTGGG + Intergenic
1028630875 7:92932493-92932515 CTTACTATGTGCAAGTGATATGG + Intergenic
1029165883 7:98590111-98590133 CCTACTATGTGCAAGGCACAAGG - Intergenic
1034051552 7:147989438-147989460 CTGACTATGTGCAAGGACTGGGG - Intronic
1034072792 7:148203284-148203306 CCTACTATGTGCTAGGAGTTGGG + Intronic
1037643786 8:20772013-20772035 CCTACTGTGTGCAGGTATCAGGG + Intergenic
1038217232 8:25573493-25573515 CCCAATATGTGCAAGGGTAAAGG - Intergenic
1039965440 8:42280556-42280578 CCCACTTTTTGCATGGATTATGG + Intronic
1041463268 8:58134589-58134611 CCTACTATGTGCATAGCTGAGGG + Intronic
1041857005 8:62468905-62468927 TCTACTAGGTGCTGGGATTAGGG - Intronic
1042476072 8:69249059-69249081 CCTACTATGTGCCAGGCATTAGG - Intergenic
1044753686 8:95440044-95440066 CCTACTATGTGCAACAATAATGG + Intergenic
1044766684 8:95583295-95583317 CCTACTATGTGCCTGGAGTCTGG + Intergenic
1047263512 8:123283363-123283385 CCTACTGTGTGCAAGGCATTAGG - Intergenic
1047799374 8:128293053-128293075 CCTGCTATGAGCAAGGCATATGG - Intergenic
1047995429 8:130330546-130330568 CCTACTATGTGCCTGGTTTTTGG - Intronic
1048071058 8:131021566-131021588 CCCACAATGTGTGAGGATTATGG - Intronic
1048228364 8:132612688-132612710 CCTACTATGTGCCAGGCATGGGG - Intronic
1049095540 8:140546064-140546086 CCTACTGTGTGCAGGGAGTTTGG - Intronic
1050825836 9:9944371-9944393 TCTACTATGTGCTAGCACTAAGG + Intronic
1052137182 9:24927221-24927243 CCTACTATATGCAATGATTAAGG - Intergenic
1052379299 9:27752907-27752929 CCTACTTTGTGCTAGAACTATGG + Intergenic
1052511950 9:29433417-29433439 CCCACTATATGTAGGGATTATGG + Intergenic
1052792728 9:32890919-32890941 CCTACTCTGTGAGATGATTAAGG + Intergenic
1055756929 9:79568162-79568184 CCTACTATGTGCCAGAATATGGG - Intergenic
1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG + Intergenic
1058703745 9:107621986-107622008 CCTACTATGTGCCAGGAAAAGGG - Intergenic
1059158948 9:112015580-112015602 TTTACTATGTGCCAGGAGTATGG + Intergenic
1059975443 9:119711593-119711615 CCTACTCTGTGCTAGGAGCATGG - Intergenic
1060029407 9:120201428-120201450 CCTACTGTGTGCCAGGCATAAGG - Intergenic
1186592758 X:10948753-10948775 CCTATTATGTGCTAGGTGTACGG + Intergenic
1187562698 X:20417719-20417741 CCTACTATGTGCCAGGGATTTGG - Intergenic
1188472921 X:30560492-30560514 CCTACTGTGTACCAGGACTATGG + Intronic
1190935038 X:54992193-54992215 TCTACTATGAGCCAGGATCAGGG + Intronic
1194994262 X:100575508-100575530 CCCACTATGTGGAAGGGATAGGG + Intergenic
1195005107 X:100678219-100678241 CCTACTATGTGCCAGGACTAGGG - Intronic
1196551850 X:117037694-117037716 CCTACAATGTGCAAGGCTCTGGG - Intergenic
1199158358 X:144576773-144576795 CCTACTTTATGCAAGGCTCAGGG - Intergenic
1199290672 X:146101636-146101658 CCTACCATGTGCTAGGCATAGGG + Intergenic
1199568120 X:149238863-149238885 TCTACTATGTGCAAGGTATTGGG - Intergenic
1199814684 X:151387049-151387071 CCTACTATGAGCCAGGCTTCGGG + Intergenic