ID: 1146470592

View in Genome Browser
Species Human (GRCh38)
Location 17:33121323-33121345
Sequence CCCCACTGGGTGATTCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146470592_1146470604 13 Left 1146470592 17:33121323-33121345 CCTTTAGGAATCACCCAGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 102
Right 1146470604 17:33121359-33121381 GACAGGTACTGGGTGGTGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1146470592_1146470605 21 Left 1146470592 17:33121323-33121345 CCTTTAGGAATCACCCAGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 102
Right 1146470605 17:33121367-33121389 CTGGGTGGTGCCAGGCACTGTGG 0: 1
1: 1
2: 8
3: 77
4: 753
1146470592_1146470600 2 Left 1146470592 17:33121323-33121345 CCTTTAGGAATCACCCAGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 102
Right 1146470600 17:33121348-33121370 GGTGGCCTGCAGACAGGTACTGG 0: 1
1: 0
2: 0
3: 26
4: 184
1146470592_1146470602 6 Left 1146470592 17:33121323-33121345 CCTTTAGGAATCACCCAGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 102
Right 1146470602 17:33121352-33121374 GCCTGCAGACAGGTACTGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 218
1146470592_1146470601 3 Left 1146470592 17:33121323-33121345 CCTTTAGGAATCACCCAGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 102
Right 1146470601 17:33121349-33121371 GTGGCCTGCAGACAGGTACTGGG 0: 1
1: 0
2: 0
3: 18
4: 176
1146470592_1146470606 22 Left 1146470592 17:33121323-33121345 CCTTTAGGAATCACCCAGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 102
Right 1146470606 17:33121368-33121390 TGGGTGGTGCCAGGCACTGTGGG 0: 1
1: 0
2: 3
3: 34
4: 312
1146470592_1146470599 -4 Left 1146470592 17:33121323-33121345 CCTTTAGGAATCACCCAGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 102
Right 1146470599 17:33121342-33121364 GGGGAGGGTGGCCTGCAGACAGG 0: 1
1: 0
2: 6
3: 41
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146470592 Original CRISPR CCCCACTGGGTGATTCCTAA AGG (reversed) Intronic
908048886 1:60205948-60205970 CCCGACTGGGTAATTTATAAAGG - Intergenic
911143448 1:94530457-94530479 CCCCACTGAATGTTTCATAAAGG - Exonic
911526643 1:98995575-98995597 CCCCAGTGGCTTATTCTTAATGG + Intronic
913238870 1:116810538-116810560 CCCCAGTGGGTGACTCCCAGTGG - Intergenic
917905636 1:179585030-179585052 CCCCACTTGGTACTTCCTACCGG - Intergenic
920890995 1:209985598-209985620 CCCCACTGGGACACTCCTAGTGG - Intronic
923886026 1:238157183-238157205 TGACACTGGGTGATTTCTAAAGG + Intergenic
1063908928 10:10810479-10810501 CCCCATTGGGGGATGCTTAAGGG - Intergenic
1065159725 10:22907780-22907802 CCAGACTGGGTAATTCATAAAGG + Intergenic
1066082252 10:31943055-31943077 CCCCACTGGCTGATACAGAATGG + Intergenic
1069493110 10:68878506-68878528 TCCCACTGGGTGATTCTCAGAGG - Intronic
1076500323 10:130931402-130931424 CCAGACTGGGTGATTCCTACAGG + Intergenic
1077022259 11:422665-422687 TCCCACTGGGTGAAAACTAAGGG - Intronic
1078420911 11:11211865-11211887 CCACTCTTGGAGATTCCTAATGG + Intergenic
1087299827 11:96419203-96419225 CCCAACTGGGTAATTTATAAAGG - Intronic
1088294668 11:108278812-108278834 CCCCATTAGGTTATGCCTAATGG - Intronic
1089195110 11:116689725-116689747 GCCCATTGGGTCATTCATAAGGG - Intergenic
1091443168 12:527354-527376 CCCCACTGGGTGCCCCCTAAGGG - Intronic
1097206096 12:57322316-57322338 TCCTACTGTTTGATTCCTAAAGG - Intronic
1100351496 12:93788139-93788161 CAACACTGGGTAATTTCTAAAGG + Intronic
1103198583 12:119068036-119068058 CCCCACTTGGACATTCCTAGTGG - Intronic
1112183998 13:97111114-97111136 CCCCACTGGGTGACTGCTGTTGG + Intergenic
1113035046 13:106039019-106039041 CAAAACTGGGTGATTCATAAAGG + Intergenic
1113185055 13:107678602-107678624 CCAGACTGGGTAATTCATAAAGG + Intronic
1118296154 14:64571728-64571750 CCCAACTGGGTAATTTATAAAGG + Intronic
1118605841 14:67502750-67502772 CCCCAGAAGGTGATTTCTAAAGG + Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1127492470 15:59478173-59478195 CCCCACTGCATGGTTCCCAAAGG - Intronic
1128452056 15:67811427-67811449 CCCCACAGGGTGGTTCAGAAGGG + Intergenic
1129093842 15:73182198-73182220 TCCCACTGGGTGATTCCACTGGG + Intronic
1130707599 15:86247914-86247936 GCCAGCTGGGTGATTCCTGAAGG + Intronic
1130830688 15:87595394-87595416 CTCCACTGGGGGTTTTCTAAAGG + Intergenic
1131280899 15:91020433-91020455 GCCCACTGGGTGATTCAGCATGG - Intronic
1131344130 15:91630466-91630488 CAACACTGGGTGATTTCTAAAGG + Intergenic
1132941309 16:2509782-2509804 CCCCTCTGGGTGTGTCCTCAGGG + Intronic
1135609387 16:23852978-23853000 CCCCAATGGGTGATTCCAGAAGG - Intronic
1140986736 16:80165196-80165218 CCCCACTGCTTTATTCATAATGG + Intergenic
1141548311 16:84787060-84787082 CCCTCCTGGGTGCTCCCTAAGGG - Intergenic
1142140785 16:88471880-88471902 TTCCACTGGGTTATTCCTGAGGG + Intronic
1143328317 17:6116153-6116175 GCACAGTGGGTGATTCCTAGGGG - Intronic
1146470592 17:33121323-33121345 CCCCACTGGGTGATTCCTAAAGG - Intronic
1148350040 17:46934704-46934726 CCTCATTGGGTGTCTCCTAAAGG - Intronic
1151234146 17:72706411-72706433 CTCCACTGGGAGTTTCCAAAGGG - Intronic
1152191266 17:78889357-78889379 CCCCGCTGGGTGATTCCCTCTGG - Intronic
1157583102 18:48784629-48784651 CCCCACTGGGGGTGTCCTATTGG + Intronic
927423237 2:22954500-22954522 CCCAACTGGGTAATTTATAAAGG - Intergenic
928257474 2:29735879-29735901 CCAGACTGGGTAATTCATAAAGG - Intronic
929837904 2:45425493-45425515 CCCTACTGTGTGATTTTTAATGG - Intronic
936257317 2:110927917-110927939 TCCCACTAGATGATTCCAAAGGG - Intronic
939665022 2:144941116-144941138 CCAAACTGGGTAATTCATAAAGG + Intergenic
944531889 2:200675203-200675225 CCCCAGTGGGTGGTTCATACTGG + Intronic
945596005 2:211793775-211793797 CCCCACTGGGTCAGCCCTCAAGG + Intronic
947017051 2:225632626-225632648 CCCCACAGGGTGATTCTTGAAGG + Intronic
1169933111 20:10855010-10855032 CCTCACTGCATGATTCCCAAAGG - Intergenic
1170164716 20:13349033-13349055 CACCACTGGCTGATCCCTCAAGG - Intergenic
1170228734 20:14021475-14021497 CCCTTCTGGGGGATACCTAAAGG - Intronic
1172512734 20:35511836-35511858 CCCCTCTGGGTGATTCCATAGGG - Exonic
1172990944 20:39036423-39036445 CCGCACTAGGTGATTTCTAAAGG - Intronic
1173132905 20:40411408-40411430 CCTCACTGTGTGCTTCCCAAAGG - Intergenic
1173740868 20:45400882-45400904 CCCCACTGGGGCATTGCTTATGG + Intronic
1173941432 20:46914423-46914445 CCCAACTGGGTAATTTATAAAGG + Intronic
1175088695 20:56484089-56484111 CCCCACTGGGTTATTTCTCCAGG + Exonic
1175323674 20:58107643-58107665 AGCCACTGGATGATTCCAAATGG - Intergenic
1175700695 20:61135004-61135026 CCACATGGGCTGATTCCTAAAGG - Intergenic
1178002822 21:28182637-28182659 CCCCACTGGGGCATGCCTAATGG + Intergenic
949189581 3:1235894-1235916 CCACACAGCGTGAGTCCTAAAGG - Intronic
949361163 3:3233490-3233512 CCCCAATGAGTGATCCATAAAGG - Intergenic
949981231 3:9502854-9502876 CCTCACAGGGTAATTCCGAAGGG + Intronic
950216115 3:11160865-11160887 CCCAACTGGGTGATTGAGAAAGG + Intronic
951326888 3:21313444-21313466 CCCCACAGGGTCATGCCTAGTGG + Intergenic
951455637 3:22889189-22889211 GCCCATTTTGTGATTCCTAATGG + Intergenic
955671185 3:61404889-61404911 CCAGACTGGGTAATTCATAAAGG + Intergenic
966642947 3:182210651-182210673 CCCCACTGTGTGCTCCCAAAAGG + Intergenic
967834798 3:193951887-193951909 CCTCAGTGGGTGATTCCTTAGGG + Intergenic
969762706 4:9201042-9201064 CCACACTGGGTAATTCACAAAGG - Intergenic
972087846 4:35242039-35242061 CTCCACTGGGACAATCCTAATGG + Intergenic
973717130 4:53688066-53688088 CCCCTCTGAGTTTTTCCTAAAGG + Intronic
974492781 4:62588538-62588560 CCCCACTGGGGCATTCCTAGTGG - Intergenic
979908983 4:126335897-126335919 CCCCACTAGGTGCTTCCTAGTGG - Intergenic
984905155 4:184619655-184619677 CACCACTGGGGGACTCCTAGCGG + Intergenic
989132891 5:38125155-38125177 CCAGACTGGGTGATTTATAAAGG + Intergenic
989224583 5:39011437-39011459 CCCCACTGGGTACTGCCTAGTGG + Intronic
997036956 5:130203799-130203821 CAACACTGGGTGATTTATAAAGG + Intergenic
999235750 5:150092492-150092514 CAAGACTGGGTGATTTCTAAAGG + Intronic
1000087027 5:157896576-157896598 CCACACTGTGTGCCTCCTAATGG - Intergenic
1000676934 5:164132643-164132665 CCCCACTGGGTACTGCCTAGTGG + Intergenic
1003621632 6:7705898-7705920 CCCCACTTCATGCTTCCTAAAGG - Intergenic
1004679388 6:17878081-17878103 CCTCACTGGGAGCTTCATAAGGG - Intronic
1007123453 6:39402674-39402696 CCCCACTGGGTGGTTTATAAGGG + Intronic
1008320333 6:50104396-50104418 ACCCACTGGTTGAATCCTATGGG + Intergenic
1011018587 6:82786011-82786033 ACCCACTAGATGATTTCTAAAGG + Intergenic
1013233571 6:108177032-108177054 TACCAGTGGGTGTTTCCTAAAGG - Intronic
1013289577 6:108708712-108708734 TTCCACTGGTTGTTTCCTAATGG + Intergenic
1019600945 7:1883497-1883519 CCCCACTGGCTGCTGCCTGAAGG + Intronic
1020604277 7:10316452-10316474 CCCCACTGTGTGATTCACATTGG - Intergenic
1021359976 7:19700609-19700631 CCCCACTGCAGGATTCCTTAGGG + Intronic
1021773601 7:24029709-24029731 CTCCACTGAGTCATTCCAAAAGG - Intergenic
1033669893 7:143481741-143481763 TCCCACTGGGTGATCACTCATGG + Intergenic
1035240239 7:157524360-157524382 CCCCACCGGGTGGTCCCAAAAGG + Intergenic
1036106580 8:5847019-5847041 CCCAACTGGGTAATTTATAAAGG + Intergenic
1037093134 8:14947262-14947284 CCTCACTGTGTGTTTGCTAATGG - Intronic
1037863791 8:22426614-22426636 CTCCTCTGGGAGATTCCTGATGG - Intronic
1043297443 8:78683209-78683231 CCCCACTGGGGCATGCCTAGTGG - Intronic
1046249819 8:111614822-111614844 CCATACTGGGTAATTCCTAAAGG - Intergenic
1046552462 8:115733968-115733990 CCCCACTGACCTATTCCTAAAGG - Intronic
1047402336 8:124557524-124557546 CCCCAATGGGAGTTTCCTGAGGG + Intronic
1047622439 8:126621582-126621604 ACCCACTGGGTGATTACAAAAGG + Intergenic
1047767605 8:128002221-128002243 CCGCCCTGGGTGATTCCCCATGG + Intergenic
1056456365 9:86764692-86764714 CCCCACTTGGATATTCCTAAGGG - Intergenic
1058798391 9:108520395-108520417 CCCCACTGGGGGGCTCCAAATGG + Intergenic
1061785655 9:133026415-133026437 CCAGACTGGGTAATTCCTACAGG + Intergenic
1185893206 X:3838023-3838045 CTTCACTGGGTGATTCCTCCAGG + Intronic
1186734659 X:12448906-12448928 CCCCTCTGGTTGATGCTTAAGGG + Intronic
1188980309 X:36721160-36721182 CACCACTGGGTGATTCCTTATGG + Intergenic
1189056274 X:37702244-37702266 CACCACTGCATGATTCCTTAGGG - Intronic
1189083214 X:37995492-37995514 CACCACTGGATGATTCCTTATGG + Intronic
1190044493 X:47101214-47101236 CCCCAGTGGGTCCTCCCTAAAGG - Intergenic
1193060416 X:77200136-77200158 CTACACTGGGCGATTCCTCAGGG - Intergenic
1194579532 X:95654986-95655008 CCCGACTTGGTGATTTATAAAGG + Intergenic
1199591758 X:149474224-149474246 TCACACTGTGTGATTTCTAAGGG - Intergenic