ID: 1146470957

View in Genome Browser
Species Human (GRCh38)
Location 17:33124569-33124591
Sequence GCTTTTTACTACAGAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 167}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146470957_1146470959 -7 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470959 17:33124585-33124607 AAAAAGCAATGCCTGAAAGTGGG 0: 1
1: 1
2: 3
3: 69
4: 993
1146470957_1146470965 18 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470965 17:33124610-33124632 AGGGTTTGAGCAGGTGCCACAGG 0: 1
1: 0
2: 2
3: 11
4: 191
1146470957_1146470961 -2 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470961 17:33124590-33124612 GCAATGCCTGAAAGTGGGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 254
1146470957_1146470967 25 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470967 17:33124617-33124639 GAGCAGGTGCCACAGGGCAGTGG 0: 1
1: 1
2: 9
3: 70
4: 613
1146470957_1146470962 -1 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470962 17:33124591-33124613 CAATGCCTGAAAGTGGGGAAGGG 0: 1
1: 0
2: 3
3: 21
4: 297
1146470957_1146470958 -8 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470958 17:33124584-33124606 TAAAAAGCAATGCCTGAAAGTGG 0: 1
1: 0
2: 2
3: 67
4: 830
1146470957_1146470966 19 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470966 17:33124611-33124633 GGGTTTGAGCAGGTGCCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 174
1146470957_1146470960 -6 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470960 17:33124586-33124608 AAAAGCAATGCCTGAAAGTGGGG 0: 1
1: 0
2: 0
3: 28
4: 316
1146470957_1146470964 9 Left 1146470957 17:33124569-33124591 CCAGTGTCTCTGTAGTAAAAAGC 0: 1
1: 0
2: 0
3: 5
4: 167
Right 1146470964 17:33124601-33124623 AAGTGGGGAAGGGTTTGAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146470957 Original CRISPR GCTTTTTACTACAGAGACAC TGG (reversed) Intronic
902889374 1:19430812-19430834 GCTTTTTACAACATATACAATGG + Intronic
907106393 1:51886820-51886842 GCTTTTTGCTCCAGTCACACTGG + Intergenic
909387381 1:75074614-75074636 GCTCTTTTCTACAAAGTCACTGG + Intergenic
909862683 1:80629080-80629102 GGATTTTAATACAGACACACTGG - Intergenic
912211257 1:107559637-107559659 AAGTTTTACTACAGAGAGACAGG - Intergenic
913336334 1:117711984-117712006 GCTTTATACCTTAGAGACACTGG - Intergenic
914354865 1:146875817-146875839 GCTATTTACTGCAAAGCCACTGG - Intergenic
914703417 1:150152907-150152929 GCTTTTAGGTACAGAGACAGAGG + Intronic
915289574 1:154874184-154874206 GCTTCTTACCTCAGAGAGACAGG + Intergenic
915778797 1:158522079-158522101 TCTTTTTCCTTCTGAGACACCGG - Intergenic
917453103 1:175163519-175163541 GCTTTTCTCTACAGAGAGCCTGG - Intronic
919443892 1:197676834-197676856 GCTTATTACTAGAGATACACTGG - Intronic
921154604 1:212429397-212429419 CCCTTCTACTACAGAAACACAGG + Intergenic
923211227 1:231806280-231806302 CCCTTTTACTACAGGTACACTGG - Intronic
1064963390 10:20991047-20991069 GCTTTTCTCTACAGGGACACAGG + Intronic
1072476542 10:95766784-95766806 GCTTTTTGCTATACAGACTCTGG + Intronic
1072718427 10:97766580-97766602 GCTATGTACTACAAAAACACAGG + Intergenic
1073498337 10:103914523-103914545 GCTTTTTAAAACTCAGACACGGG + Intronic
1077853603 11:6099698-6099720 GGTTTTTAGTAGAGAAACACAGG + Intergenic
1081570196 11:44286060-44286082 GCCTTTTCCTGCAGACACACTGG - Intronic
1083212206 11:61195177-61195199 GCTTTTTATTACAGTGACTGAGG + Intergenic
1083469508 11:62873644-62873666 ACTTTTTTTTATAGAGACACGGG + Intronic
1086434793 11:86770573-86770595 ACTTCTTTCTACACAGACACAGG + Intergenic
1086916554 11:92536265-92536287 TCTTTCTACTACAGAGCAACAGG - Intronic
1088637995 11:111842955-111842977 GTTTTTAAAAACAGAGACACAGG + Intronic
1091152557 11:133342391-133342413 GATTTCTAGTACAGAGACAGCGG - Intronic
1092559667 12:9598645-9598667 GTTTTTTACTTTAGAGAGACCGG - Exonic
1093164979 12:15793780-15793802 GCTTTTTACTCAAGTAACACTGG - Intronic
1095908965 12:47406221-47406243 GCTGGCTGCTACAGAGACACTGG - Intergenic
1097310731 12:58115819-58115841 GCTTTTTGCTATTGAGACAAAGG + Intergenic
1099052954 12:77803595-77803617 TCATTCTACTACAAAGACACAGG - Intergenic
1099309550 12:81001249-81001271 GCTGCTTACTACAGAAACTCTGG - Intronic
1099420875 12:82458926-82458948 AGTTTGTAGTACAGAGACACAGG + Intronic
1099696600 12:86030120-86030142 CCATTTTACAAGAGAGACACAGG + Intronic
1100613601 12:96213221-96213243 GCTTTGTGCTACAGAGAAATAGG + Intronic
1103335101 12:120183538-120183560 CCTTGCTACTTCAGAGACACAGG + Intronic
1105268252 13:18842728-18842750 GCTTTCTACTAAAGAGTCAAAGG + Intergenic
1108553072 13:51565696-51565718 TATTTTTACTAAAGAGAGACAGG + Intergenic
1111388666 13:87562024-87562046 ACTTCTTTCTACACAGACACCGG - Intergenic
1112147626 13:96718857-96718879 GCTTTTTACTACAAAGTGAAAGG - Intronic
1114466702 14:22928313-22928335 GGTTTTTTCTACATAGACATGGG + Intronic
1114720768 14:24879742-24879764 TCTTTTTACAATAGAGAAACAGG + Intronic
1118524228 14:66621828-66621850 GCTGTATCCTGCAGAGACACAGG - Intronic
1119083216 14:71716512-71716534 GCTTTCTACAACACAGACAGTGG + Intronic
1121412567 14:93758016-93758038 GCTTCTCACTCCAGAGATACGGG + Intronic
1127362193 15:58253890-58253912 GGCTTTTACTACATAGACAATGG + Intronic
1127608838 15:60617365-60617387 TATTTTTACCACAGAAACACAGG + Intronic
1139979155 16:70839712-70839734 GCTATTTACTGCAAAGCCACTGG + Intronic
1140296926 16:73717889-73717911 GCTCTTTACACCAGAGCCACAGG - Intergenic
1141335882 16:83154852-83154874 GATTTTTGCTACAGAAAAACCGG - Intronic
1142855839 17:2729544-2729566 GCGTTATACTTCAGAGACAATGG + Intergenic
1143279802 17:5745013-5745035 CCTTCTTACTACAGAGACCTGGG - Intergenic
1146342724 17:32035551-32035573 GCTTTCTTCTTCAGAGACATGGG + Exonic
1146470957 17:33124569-33124591 GCTTTTTACTACAGAGACACTGG - Intronic
1148277961 17:46322939-46322961 GCTTTCTTCTTCAGAGACATGGG + Exonic
1148300168 17:46540793-46540815 GCTTTCTTCTTCAGAGACATGGG + Exonic
1149206715 17:54256244-54256266 ACTTTTTTCTCCAGAGACACAGG + Intergenic
1150243128 17:63651837-63651859 ATTTTCTACTACAGAGTCACAGG - Intronic
1150402334 17:64868528-64868550 GCTTTCTTCTTCAGAGACATGGG - Exonic
1150755960 17:67913883-67913905 GCCTGTGGCTACAGAGACACAGG + Intronic
1154003350 18:10505828-10505850 ACTTCTTTCTACACAGACACAGG + Intergenic
1154312458 18:13277811-13277833 GCTTGTTCCTGCAGAGGCACGGG - Intronic
1154360111 18:13653873-13653895 GCTTCTCACAACGGAGACACAGG + Intergenic
1155472269 18:26203576-26203598 GCTTTCTTCTACAGAGAAATAGG - Intergenic
1156313503 18:35946726-35946748 GTTTTTTACTACAGAGGAAGGGG - Intergenic
1157092720 18:44654933-44654955 GCTTTTGTTTGCAGAGACACAGG - Intergenic
1158586127 18:58736931-58736953 GCTCTTTACTACTAAGACAGGGG - Intronic
1159403676 18:67972108-67972130 TCATTTTACCAAAGAGACACAGG - Intergenic
1160380072 18:78447773-78447795 GCTTTTTACAACAGAGAGTAAGG + Intergenic
925732162 2:6927031-6927053 TGTTTTTACTACAGTGAAACTGG - Intronic
927861062 2:26560419-26560441 GCTTTTTCCTAAAGATGCACAGG - Intergenic
928797579 2:35040649-35040671 GCTGTAAACTACAGAGCCACAGG + Intergenic
929976115 2:46636677-46636699 GCTTCTTTCAACAGCGACACTGG - Intergenic
930435467 2:51335549-51335571 ACTTTTGAGTACAGAGATACAGG + Intergenic
933178254 2:79200733-79200755 GCCTTTTAATACAAACACACAGG + Intronic
935038168 2:99399210-99399232 GCTTTTTAGTACAGTGAGAGCGG + Intronic
937940090 2:127278610-127278632 GCTTGCTCCTACAGTGACACAGG - Intronic
939247791 2:139647321-139647343 TCATTCTACTACAAAGACACAGG - Intergenic
940682536 2:156804520-156804542 GCTTTCTACTTCAGGGACCCTGG - Intergenic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
947128299 2:226895100-226895122 GCATTTTATTGTAGAGACACTGG + Intronic
947896705 2:233681108-233681130 GCTGTGTATTGCAGAGACACAGG + Intronic
1169113593 20:3048271-3048293 TCTTTTTACTACAGTGGCAAAGG + Intergenic
1171029393 20:21663720-21663742 GCTTTTGAAGACAGAGAAACTGG + Intergenic
1173299538 20:41789475-41789497 GCTCTTTACTACTGTGAGACAGG - Intergenic
1173316916 20:41952896-41952918 GCTTTTTAGTGCTGAGACAGAGG - Intergenic
1173709578 20:45142778-45142800 GCTTTATATTACAGCCACACAGG + Intergenic
1175231278 20:57474999-57475021 GCTTGTTACTACAGAGAGAAAGG - Intergenic
1176263943 20:64198800-64198822 GCTCTGTACTCCAGAGGCACTGG + Intronic
1179582740 21:42353730-42353752 GCTTTTGACTATGGAGTCACTGG + Intergenic
1180024425 21:45151600-45151622 GCCTTTTGTTCCAGAGACACAGG + Intronic
1182340708 22:29618449-29618471 TCTTTTTACTGCAGAGATAGGGG + Intronic
949230378 3:1743757-1743779 GCTTTATCCTGCAGAGCCACAGG - Intergenic
953126751 3:40097737-40097759 ACTTCTGTCTACAGAGACACAGG - Intronic
953556527 3:43950644-43950666 GCCTTTTACTAGAGAGAGAGAGG - Intergenic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
955498033 3:59556608-59556630 GCTTTCTTCTAAAGAGATACTGG - Intergenic
963471556 3:145748123-145748145 GCTGTACCCTACAGAGACACAGG - Intergenic
964323877 3:155526037-155526059 GCTTTTTACTACAGGCAGAAAGG + Intronic
965707643 3:171525137-171525159 GCTTATTACAAAACAGACACAGG + Intergenic
967783417 3:193464653-193464675 GGTTTTGACTGCAGAGAAACAGG + Intronic
967908094 3:194518339-194518361 GCTATTTATTACAGAAACATTGG + Intergenic
971190737 4:24426902-24426924 TGTTTTTACAACAGAGACTCGGG + Intergenic
971791372 4:31173952-31173974 TCTTTTTATTATAAAGACACAGG - Intergenic
972954315 4:44370183-44370205 GCTTTCTCCTACAGAGAAAATGG + Intronic
974202264 4:58657073-58657095 GCTGTACACTGCAGAGACACAGG + Intergenic
974667969 4:64990277-64990299 GTTTTTATCTACAGAGAGACAGG + Intergenic
974987319 4:69044020-69044042 GATTTTTAGTAGAGAGAGACAGG - Intronic
975054448 4:69911978-69912000 GCTTTTTACCAAAGTGACAATGG - Intergenic
975118308 4:70704057-70704079 GCTAATTACTAGCGAGACACGGG + Intergenic
977499473 4:97821357-97821379 GCTGTATCCTGCAGAGACACAGG - Intronic
981882785 4:149635402-149635424 GCTTTTTGCTGGAGAGATACTGG - Intergenic
984593142 4:181638642-181638664 CATTTTTACTACAGAGAAAATGG - Intergenic
992775142 5:80082677-80082699 GCTTTTTACTTCTGGTACACAGG - Intronic
994328272 5:98474995-98475017 GCTTTGAACTACAGAGTCAAGGG + Intergenic
994580235 5:101632429-101632451 GCTGTATACTACAGAGCCACAGG - Intergenic
996250758 5:121328650-121328672 TCTTTCTACTATAAAGACACAGG - Intergenic
996283918 5:121766507-121766529 GCTTTATATTAGAGAGACATTGG + Intergenic
996916631 5:128720144-128720166 CCTTTATGCTACAGAGACAGAGG - Intronic
1000135230 5:158341871-158341893 GTGTTTTACCACAAAGACACAGG + Intergenic
1000856592 5:166405424-166405446 GCTTCTTCTTACAGAGACAAGGG - Intergenic
1002337857 5:178492808-178492830 GCATTCTACTACAGAGAGCCTGG - Intronic
1002527536 5:179823166-179823188 GCTGTTTAAGACAGAGACATAGG + Intronic
1002715305 5:181223472-181223494 GCCTCTTACCACAGAGACGCGGG + Exonic
1004054853 6:12125198-12125220 GGTTTGTACTACAGAGCCCCTGG + Exonic
1006877555 6:37311733-37311755 CCCTTGTGCTACAGAGACACAGG - Intronic
1007397538 6:41586242-41586264 GCTATTCAATAGAGAGACACAGG - Intronic
1010361585 6:75001388-75001410 TCTTTCTACTATAAAGACACAGG + Intergenic
1010551737 6:77231759-77231781 GCTTATTTCTCCAGATACACTGG - Intergenic
1011655699 6:89549901-89549923 TCTTTTTTTTAAAGAGACACAGG - Intronic
1017213952 6:151887257-151887279 GCTCTTTACCAAAGAGAGACTGG + Intronic
1019128271 6:169856325-169856347 ACTTCTTTCTACACAGACACAGG + Intergenic
1019516173 7:1441174-1441196 GCTTTTTTCTACACACACCCAGG + Intronic
1020847756 7:13308747-13308769 GCTTTTTAGTGCACAAACACAGG + Intergenic
1022106327 7:27200102-27200124 GCTTTTTAAAACAGCGCCACTGG - Exonic
1022342230 7:29479543-29479565 GATTTTTAATAAAGAGACATAGG + Intronic
1022542796 7:31153832-31153854 ACTTCTTTCTACACAGACACAGG - Intergenic
1029411991 7:100419182-100419204 GATTTTTCCTGCAGAGACAAGGG + Exonic
1031202296 7:118703574-118703596 GCATCTTTCTCCAGAGACACTGG + Intergenic
1031640131 7:124152937-124152959 GCTTTTCACTATAGACTCACAGG - Intergenic
1032863809 7:135905932-135905954 GCTTTTCTCTACATAGGCACAGG + Intergenic
1033185929 7:139226563-139226585 ACTTCTTTCTACACAGACACAGG - Intergenic
1034299738 7:150005044-150005066 GCATTTTCTTACAGAGGCACAGG - Intergenic
1034358985 7:150477580-150477602 GCTTTTAACAACAAAGAAACAGG + Exonic
1034428376 7:151027045-151027067 ACTTCTTTCTACACAGACACAGG - Intergenic
1034806312 7:154092259-154092281 GCATTTTCTTACAGAGGCACAGG + Intronic
1038124405 8:24655635-24655657 GCCTTTGACAACAGAGATACAGG - Intergenic
1044304740 8:90626136-90626158 GCTTTTTGGTACAAAGAGACAGG - Intronic
1045171949 8:99680860-99680882 GTTTTATTCAACAGAGACACAGG - Intronic
1045206791 8:100050635-100050657 GCTCTTTACTTCTGAAACACAGG + Intronic
1046921432 8:119733585-119733607 GCTTTTTCCTCCAGACCCACAGG + Intronic
1048270569 8:133024987-133025009 TTATTTTACTAGAGAGACACAGG + Intronic
1048819484 8:138367563-138367585 CCTTTTTACCACAGCTACACAGG + Intronic
1050176074 9:2870612-2870634 GCTTATTTCTATAGAGACATGGG - Intergenic
1050460316 9:5872030-5872052 GGTTTTTCCTGCAGTGACACTGG - Intergenic
1050818655 9:9849082-9849104 GTTTTTAAATACATAGACACAGG + Intronic
1051375012 9:16393710-16393732 GGTGTTTTCTACAGACACACAGG + Intergenic
1052801687 9:32974044-32974066 GCTTTCTTCTACATATACACAGG + Intronic
1052888026 9:33667958-33667980 ACTTCTTTCTACACAGACACAGG - Intergenic
1052965735 9:34339253-34339275 CCTTTTTGCTACACAGTCACTGG - Intronic
1054360694 9:64113260-64113282 GCTTTCTACTAAAGAGTCAAAGG - Intergenic
1055848343 9:80594535-80594557 GAATTTTACTACAGAGGCAGAGG + Intergenic
1056923486 9:90812688-90812710 GCCTTTGACTGCAAAGACACTGG + Intronic
1058072390 9:100614745-100614767 TATTTTTACTTAAGAGACACTGG + Intergenic
1059932149 9:119271869-119271891 TCTTTTTAATACATAGAGACAGG + Intronic
1060411599 9:123403940-123403962 TCTTTTTACAACAGAATCACAGG + Intronic
1186900889 X:14054407-14054429 GCTTTTTAATACAGGGGCTCAGG + Intergenic
1187633430 X:21200625-21200647 GCTTTTTATTCCAGCCACACTGG - Intergenic
1189162231 X:38821162-38821184 GCTTTTTATTAGAAAAACACAGG - Intergenic
1191824930 X:65354228-65354250 GCTTTGTACTAAAGGGGCACCGG - Intergenic
1193614604 X:83671901-83671923 GCTGTATCCTACAAAGACACAGG + Intergenic
1199435077 X:147804045-147804067 GACTTTTACTACAGAGAAAAAGG - Intergenic
1201900465 Y:19042791-19042813 GCTTTCTTTTACAGAGACAGAGG - Intergenic