ID: 1146471024

View in Genome Browser
Species Human (GRCh38)
Location 17:33125046-33125068
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 4, 1: 12, 2: 19, 3: 26, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905351340 1:37348634-37348656 CGGGATACACAGATGAACCTGGG - Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
908388985 1:63668427-63668449 CTGTAAACACTGAAACAGCTGGG + Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
910315484 1:85877656-85877678 TTAAAAACACACATGAAGCTGGG - Intronic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
913478472 1:119261693-119261715 CTGTAACCATAGATGAGGATGGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917336071 1:173925497-173925519 CAGTAACCACAGCAGAAGCTGGG - Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918519057 1:185394849-185394871 CTGTAAACACAGATAGTTCTGGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG + Intronic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063377108 10:5561085-5561107 CTGTAAACACATAGGATGCAGGG - Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063841381 10:10075876-10075898 CTTTAAAGGCAGATGAAGGTGGG - Intergenic
1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG + Exonic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1069658834 10:70110034-70110056 CTGTAATCACACATCAACCTAGG + Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070769965 10:79076495-79076517 CTGTAAAGACACATGCTGCTGGG - Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080785554 11:35472055-35472077 AAGTAAACACTGATGAAACTCGG - Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG + Intronic
1083919684 11:65775595-65775617 CTGTAAGCACCCAGGAAGCTGGG - Intergenic
1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1090434231 11:126673558-126673580 GTGAAAACACAGATGAATTTTGG - Intronic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1093316253 12:17654834-17654856 CATTAAACATAGATGAAGCCAGG + Intergenic
1094312848 12:29104437-29104459 CTGAAAACACAAAAGAACCTTGG - Intergenic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG + Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099101203 12:78442785-78442807 ATGTAACCACTGATGAAGTTAGG + Intergenic
1100032702 12:90212501-90212523 CTGGAAAGAAAGATGAAACTTGG - Intergenic
1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG + Intronic
1101049001 12:100841490-100841512 CTACAAAGAAAGATGAAGCTGGG + Intronic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG + Intronic
1107605848 13:42055852-42055874 CTGGAAACACATTTGTAGCTGGG + Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1110454497 13:75675422-75675444 TTGTAAACAAAGTTTAAGCTAGG + Intronic
1110527559 13:76556491-76556513 CTATAAGCATAGATGAAACTTGG - Intergenic
1110880239 13:80562838-80562860 CTGTAAGCATAGATCAGGCTGGG + Intergenic
1111928208 13:94485330-94485352 TTGGAAACACTGATGATGCTCGG - Intergenic
1112265581 13:97920377-97920399 CTATTAACACAGGTGAGGCTGGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112904687 13:104402383-104402405 GTGACAACACAGATGAACCTGGG + Intergenic
1113096373 13:106668326-106668348 GTGTGAACATAGAGGAAGCTGGG - Intergenic
1113104325 13:106756825-106756847 TTGTCAACACAGATGGCGCTGGG + Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113418702 13:110152764-110152786 CTTTAAACTCTAATGAAGCTGGG - Intronic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1117835221 14:59797782-59797804 GTGTTAACAAAGATGACGCTAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119597237 14:75946590-75946612 CTGAACACACAGAAGATGCTTGG - Intronic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1119967766 14:78936056-78936078 CTGTAAGCAATGATGAATCTTGG - Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1125122833 15:36183111-36183133 CTGTAACCAGAGAGGAAGGTAGG + Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127726940 15:61759605-61759627 TTGTAACCACACATGCAGCTGGG - Intergenic
1128192914 15:65720732-65720754 CAGTTAACAAGGATGAAGCTGGG - Intronic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128463724 15:67891059-67891081 CTGTAATCCCAGCTGAAGCAGGG - Intergenic
1130897934 15:88184983-88185005 CTGAAGTCTCAGATGAAGCTAGG - Intronic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135712267 16:24728151-24728173 TTGTAAAGCCAGTTGAAGCTGGG + Intergenic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1139747638 16:69087331-69087353 CTGAAAAAGCAGTTGAAGCTTGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143611397 17:8019897-8019919 GTGTAAACACATCTGAAGGTGGG - Intronic
1144082545 17:11777989-11778011 ATGTAAAGAGACATGAAGCTGGG + Intronic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146496182 17:33324552-33324574 CTGTACACACAGATCTAGGTAGG - Intronic
1147926146 17:43947204-43947226 CTGCAAACAGGGATGAAGCCAGG - Intergenic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151416741 17:73971243-73971265 CTGTAAATACCCATGAATCTGGG - Intergenic
1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG + Intronic
1152895730 17:82910058-82910080 CTGGAAACCCAGATGAGCCTGGG - Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156612889 18:38748445-38748467 CTGTAAGGACAGAATAAGCTGGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1156890769 18:42187180-42187202 CTGTGCACACACATGAAGCCTGG + Intergenic
1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG + Intergenic
1158102847 18:53850009-53850031 TTGTAAACTGAGATGAAACTAGG + Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG + Intergenic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1166438024 19:42786080-42786102 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166466926 19:43040743-43040765 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166473057 19:43096818-43096840 CAGTGAACACAGAGGAAGTTTGG - Intronic
1166486729 19:43220357-43220379 CAGTGAACACAGAGGAAGTTTGG - Intronic
925107513 2:1305504-1305526 TTGTAAACATAGAGGAAGCCTGG + Intronic
925394564 2:3523718-3523740 CTGTTAACACCCATGAATCTGGG - Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG + Intergenic
930156792 2:48114123-48114145 CTGAAAACAGAAATGAAACTAGG - Intergenic
930217577 2:48712351-48712373 CTTCAAACACAGCTGATGCTTGG + Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
935044804 2:99471289-99471311 TTTTAAACACAGATGACCCTGGG - Intronic
936760666 2:115777031-115777053 CTATAAACACAGATCAAGGCAGG - Intronic
937081156 2:119140942-119140964 CTGTAAAGAAAACTGAAGCTAGG + Intergenic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
937744314 2:125393173-125393195 ATGCAAACACATATGAAGGTTGG + Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
940844903 2:158629854-158629876 CTGTAATCCCAGCTGAGGCTGGG - Intronic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG + Intergenic
1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG + Exonic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
949240109 3:1860948-1860970 ATATAATCACAGATGAACCTCGG - Intergenic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG + Intergenic
952941627 3:38449551-38449573 ATGAAAACACAGAGTAAGCTGGG - Intergenic
955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG + Intergenic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969595968 4:8149474-8149496 CTGTGGACACAGACCAAGCTGGG - Intronic
971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG + Intergenic
973938410 4:55876523-55876545 CTGAAAACTCAGACTAAGCTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974715451 4:65664433-65664455 TTGTAAACACAGATTAAAATGGG - Intronic
974822057 4:67079834-67079856 CTGTCACCACAGATGAGTCTGGG + Intergenic
974881233 4:67759869-67759891 ATTAAAACAAAGATGAAGCTTGG + Intergenic
976757809 4:88516897-88516919 CTGTGAACAGATATGAAGCCAGG + Intergenic
977323073 4:95544455-95544477 TAGTAAACATAGGTGAAGCTAGG - Intronic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979392513 4:120143277-120143299 TTGGAAGCACAGATAAAGCTTGG - Intergenic
979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG + Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG + Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
985873220 5:2575456-2575478 TTGTAAGCTCAGGTGAAGCTGGG - Intergenic
988005311 5:25402867-25402889 CTCTAAAAACAGCTCAAGCTAGG - Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989509559 5:42269165-42269187 CTTTAAACACCAATGAGGCTGGG + Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
994261602 5:97665774-97665796 CTGTGAGCAGAAATGAAGCTTGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994715902 5:103321201-103321223 ATGTAAACAAAAATGAGGCTGGG - Intergenic
994994362 5:107041006-107041028 TTGTGAACAGAGATGAACCTAGG + Intergenic
995817456 5:116187927-116187949 CTGTAATCACAGAAGCAGTTTGG + Intronic
997605678 5:135174243-135174265 CTCTTAACACAGAAGAGGCTGGG - Intronic
999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000850569 5:166335151-166335173 CTGAAAACACTGAGGTAGCTGGG - Intergenic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1001923009 5:175615515-175615537 CTATAAACACGGCTGTAGCTGGG - Intergenic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004935168 6:20500306-20500328 GTGAAAACATAGATGAACCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005622824 6:27635670-27635692 TTGTAAACTCTGATGAAGCCGGG - Intergenic
1008087739 6:47262102-47262124 CCGTAAGCTCAGATGAACCTTGG + Intronic
1011057915 6:83226048-83226070 CTGTAGGCACAGGTGAAGATAGG - Intronic
1011793784 6:90930071-90930093 GTGTAAACTAACATGAAGCTAGG + Intergenic
1013085714 6:106855384-106855406 CTGTCATCAAAGATGAAGCTTGG - Intergenic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013634393 6:112015577-112015599 CTATAAAGAGAAATGAAGCTGGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018253662 6:161896679-161896701 TTGTAAACACTTACGAAGCTTGG - Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1019234754 6:170601369-170601391 TTGTAAACAGAAATGAGGCTGGG - Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020661378 7:10987853-10987875 CTGTTAAAACAGATCTAGCTGGG + Intronic
1020838659 7:13186350-13186372 CTTTAAAAAAAGATGAGGCTGGG + Intergenic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027999277 7:85470430-85470452 ATAGAAACACTGATGAAGCTAGG + Intergenic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1031229646 7:119089200-119089222 CTAAAAACATAGATGAATCTGGG - Intergenic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039533909 8:38290234-38290256 CTATAAACACAGATTATTCTAGG - Intronic
1042437490 8:68784185-68784207 CTTTAAACACAGGGAAAGCTTGG - Intronic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1043798441 8:84576938-84576960 CTGTAAACTAACATGAAGGTTGG - Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1047565092 8:126035207-126035229 GTGAAGACACTGATGAAGCTGGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1052382352 9:27785161-27785183 CTGGAAACAGAGCTGAAGCCAGG - Intergenic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1055342489 9:75299176-75299198 GTGTCCACACAGATGAAGCATGG - Intergenic
1057238637 9:93388606-93388628 CTGTAAAGACATATGATGTTGGG + Intergenic
1057352669 9:94313648-94313670 CTAAAAACATGGATGAAGCTTGG + Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1059656386 9:116361408-116361430 CTGGTAACACAGATAAAGCGTGG - Intronic
1060847411 9:126848381-126848403 AAGTAAAGACAGATGATGCTGGG - Intergenic
1185654818 X:1676451-1676473 ATGTAAACACACATGTAGATAGG - Intergenic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1188091631 X:25971482-25971504 CTGTGATCACAGACGATGCTTGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1194560082 X:95409640-95409662 ATGTAAAGAGAGATGAAGCATGG - Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201721354 Y:17101036-17101058 CTGTAAACTCAGATGCTTCTTGG - Intergenic