ID: 1146471479

View in Genome Browser
Species Human (GRCh38)
Location 17:33128435-33128457
Sequence ACTGGGAAGCAGAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 613}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146471479 Original CRISPR ACTGGGAAGCAGAATGGGGA TGG Intronic
900394090 1:2446093-2446115 ACAGGGAAGCAGGACGGGGGTGG - Intronic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900908760 1:5579272-5579294 TCTGGAAAGCAGAATGAGCAAGG - Intergenic
900961399 1:5923370-5923392 GCTGGGAAACAGAAGAGGGAAGG + Intronic
901182013 1:7348314-7348336 ACTGGGAAACAGCATGGGCATGG - Intronic
901187585 1:7385064-7385086 ACAGGCAAGCAGGATGGGCAGGG - Intronic
901376574 1:8843852-8843874 AATTGGAAAGAGAATGGGGAAGG - Intergenic
901547724 1:9971637-9971659 ATTGGGAATGAGAATGTGGAAGG + Intronic
901700582 1:11043152-11043174 TGTGGGAGGCAGAGTGGGGAGGG - Intronic
902220686 1:14962703-14962725 CCTGGGACACAGAATGGGAAAGG - Intronic
902759138 1:18569482-18569504 ACAGGGCAGGAGAGTGGGGATGG + Intergenic
902797279 1:18807885-18807907 ACCGGGAAGGAGAACTGGGAAGG - Intergenic
902811906 1:18892716-18892738 AGTGGGAGGCAGAGTGGGGGTGG - Intronic
903006790 1:20303879-20303901 ACTGGGAAGCAGCCTGAGCAGGG + Intronic
903234665 1:21942058-21942080 ACAGGGAGGCAGAATGGGTGTGG - Intergenic
903292569 1:22324083-22324105 ACTGGGAAGCACAGTGAGTATGG - Intergenic
903548553 1:24142135-24142157 GCTGGGAAGCAGACTGGAGGGGG + Intronic
904269771 1:29342360-29342382 ACCTGGGAGAAGAATGGGGAAGG - Intergenic
904385414 1:30138832-30138854 ACTGGGAAGCATGGTGGGGTTGG - Intergenic
905194047 1:36260343-36260365 GCTGGGAAGGGGAGTGGGGAAGG - Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905489408 1:38331916-38331938 ACTGGGAAGCTGGAGGGGAAGGG - Intergenic
905869282 1:41394039-41394061 GCTGGGAGGCAGAAAGGTGAGGG - Intergenic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906282813 1:44565805-44565827 ACTGGGTTGCAGGACGGGGATGG - Intronic
906745134 1:48216084-48216106 AATGGGAAGCTGGATGGGGCAGG + Intergenic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
906990634 1:50733820-50733842 CCTGGGCAGCAGAGTGGGTATGG - Intronic
907119766 1:51998143-51998165 CCTGGGAAGTAGAATGGGCTGGG - Intergenic
907165975 1:52411700-52411722 AAAGGGAAGCAGGATGGTGAAGG - Intronic
907328831 1:53658304-53658326 TCTGGGAAGCAGCTTGAGGAAGG + Intronic
907569637 1:55470978-55471000 AGTGGGATGCAGAGTGGGAAAGG - Intergenic
907627435 1:56043816-56043838 TCTGGGAAGCAGAACTGAGAAGG - Intergenic
908021869 1:59906306-59906328 AGTAGGAAGCAAAAGGGGGAAGG - Intronic
908230060 1:62095657-62095679 ACTGGGAAGCACAATGTGAAAGG - Intronic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
909404089 1:75266922-75266944 ACTAGGAAGAGGAATGGTGACGG + Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
910655009 1:89610219-89610241 ACTGACAAGCACAGTGGGGAGGG - Intergenic
910922850 1:92368098-92368120 AATAGGGACCAGAATGGGGAAGG + Intronic
912217151 1:107627415-107627437 ACTGGGTATGAGAATTGGGAAGG + Intronic
915507759 1:156368278-156368300 ACAGGGAAGCAGGCTGGGCAGGG - Intergenic
915602906 1:156933447-156933469 ACGGGGAAGCAGAAGGGAGCGGG - Intergenic
915617641 1:157051988-157052010 CCTGGGGACCAGAATAGGGAAGG - Intergenic
915631737 1:157157954-157157976 ACTGGGACCCAGCAGGGGGATGG - Intergenic
916349825 1:163836584-163836606 ACTGGGCAAGAGAATGGGGTAGG - Intergenic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
918596780 1:186303498-186303520 ACTGAGAAGCGGAAAAGGGAAGG + Intronic
918638150 1:186804674-186804696 ACTGGGAAACTGAATATGGAAGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920439006 1:205966201-205966223 ACTGGGTAGCAGCATGGTGCAGG + Intergenic
920574596 1:207050436-207050458 ACCAGAAAGCGGAATGGGGAAGG + Intronic
920637250 1:207715802-207715824 ACTGGGAGGCTGAAGTGGGAGGG - Intronic
920674357 1:208029083-208029105 AGTGGGCAGCAGAAGGGGCACGG - Intronic
921250365 1:213291748-213291770 AGAGGGAAGCAGAATGGTGTGGG - Intergenic
921281106 1:213569040-213569062 AGTGGGAAGTACACTGGGGAGGG - Intergenic
921357544 1:214299982-214300004 ACTAGGAAGGAGAGAGGGGAGGG + Intronic
921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG + Intronic
921945529 1:220883640-220883662 CATGGGAAGCAGAAAGGGAAAGG - Intronic
923494436 1:234512059-234512081 GCTGGGAACCATAGTGGGGAGGG - Intergenic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
923845175 1:237722203-237722225 ACTGGAAAACAAAATGGGTAAGG - Intronic
924119358 1:240780618-240780640 TCTGGGAAGAAGAATGGGCCGGG + Intronic
1063109882 10:3026364-3026386 AGTGGGAGGAGGAATGGGGAGGG - Intergenic
1063505440 10:6593824-6593846 ACTGGGAAGAGGGATGGGGAGGG - Intergenic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1064336972 10:14452409-14452431 GCTGGGAAGGGTAATGGGGATGG + Intronic
1064452890 10:15459357-15459379 TCTGTGAAGCAGTATGGGGAGGG - Intergenic
1065621539 10:27587201-27587223 TCTGGGAAGCACAATGGGTTGGG + Intergenic
1067394779 10:45904916-45904938 ACTGTGTAGCAGAATGGTTAAGG + Intergenic
1067751374 10:48973945-48973967 ACTGGGAAGAAGAAAAGGGGAGG - Intronic
1067863102 10:49874047-49874069 ACTGTGTAGCAGAATGGTTAAGG + Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068733641 10:60387789-60387811 ACTTGGAAGCAAAATAGGGAAGG - Intronic
1069093762 10:64232989-64233011 ACTGGGAAGGATAGTTGGGAGGG + Intergenic
1069307222 10:66985608-66985630 AGTGGAAAGCAGAATGGAGAAGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070310869 10:75272959-75272981 ACTGGGCATCAGAGTGAGGATGG + Intergenic
1070769864 10:79075937-79075959 ACTGGCAGGGAGGATGGGGACGG + Intronic
1071086311 10:81872467-81872489 ACTGGAAGTGAGAATGGGGAGGG - Intergenic
1071251689 10:83825483-83825505 CCTGGGAAGCAAAGTGGGGCTGG + Intergenic
1071893797 10:90041989-90042011 GATGGGAGCCAGAATGGGGATGG + Intergenic
1071972273 10:90920323-90920345 ACTGGAAAGAAGAATGGCAATGG - Exonic
1071972377 10:90921226-90921248 TCTGGGAAGCTGAAGAGGGAGGG + Exonic
1072105143 10:92266609-92266631 AATGGGAAGCGGGAGGGGGAAGG + Intronic
1072573042 10:96675219-96675241 CCTGGGAAGGAAAATGGGGAGGG + Intronic
1072729902 10:97838837-97838859 AGTGGGAAGGAGGATTGGGAAGG + Intergenic
1073112334 10:101070100-101070122 ACTGGGGCCCAGCATGGGGAAGG - Intergenic
1073247605 10:102102614-102102636 TGTGGGAAGCTGAATGGGAATGG - Intergenic
1074878709 10:117634629-117634651 AGTGGGAAGTAGGATAGGGAAGG + Intergenic
1074879841 10:117647327-117647349 ACTGAGAAGCAGCATGGACAGGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075658617 10:124177789-124177811 AGGGGAAAGCAGAATGGAGAGGG - Intergenic
1075938294 10:126363537-126363559 TCAGGGAAGCAAACTGGGGAAGG - Intronic
1076238306 10:128882952-128882974 TCTGGAAAGCACAATGAGGAAGG + Intergenic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1077436162 11:2540184-2540206 GCTGGGCAGCAGCCTGGGGAGGG + Intronic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080818689 11:35784039-35784061 ACTGGGGAGCAGAATGTGCTAGG + Intronic
1081231984 11:40596602-40596624 GCTGGGAAGGGGAGTGGGGAGGG - Intronic
1082897280 11:58205277-58205299 TCAGGGAGGAAGAATGGGGATGG - Intergenic
1082972954 11:59042920-59042942 GCTGGGAAACAGGATGGGGTTGG + Intronic
1082977356 11:59086490-59086512 GCTGGGAAACAGGATGGGGTTGG + Intergenic
1083107647 11:60373932-60373954 ACAGGGAGCCAGAACGGGGATGG - Intronic
1083629284 11:64087452-64087474 TCTGGGAACCAGACTGGGCAGGG + Intronic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1084035410 11:66506876-66506898 ACTGGGTAGCAGAACAGAGAGGG - Intronic
1084360315 11:68664839-68664861 ACAGGGGAGCAGACTGGGGCTGG - Intergenic
1084384677 11:68835757-68835779 TCTGGGAAGCAGCCTGGGAAAGG + Intronic
1084479397 11:69409989-69410011 CGTGGGAAGGAGAGTGGGGAGGG - Intergenic
1084677130 11:70642039-70642061 ACTGGGTACCAGGATGGGTAAGG + Intronic
1084935953 11:72586735-72586757 ACTGGGGAGCTGCATGGGGCTGG + Intronic
1084986930 11:72882398-72882420 GCTGGGAAGGATTATGGGGAAGG + Intronic
1085880881 11:80464643-80464665 ACTTGGAGGCAGAAGAGGGAAGG - Intergenic
1087140015 11:94756013-94756035 ACGGGAAACCAGAAAGGGGATGG + Intronic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087983129 11:104642204-104642226 GCTGGGAAGCAGAGTGGGAATGG - Intergenic
1088774519 11:113069481-113069503 ACCTGGAAGCAGTATGGAGAAGG + Intronic
1088852842 11:113719474-113719496 GCAGGGAATCAGGATGGGGAAGG - Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089138716 11:116269824-116269846 AGTGGGAAGGAGACTGGGGCAGG - Intergenic
1089169081 11:116500046-116500068 AATGGACAGCAGCATGGGGAGGG + Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089488010 11:118862059-118862081 CCTGGGAGGCTGAGTGGGGAAGG - Intergenic
1089715219 11:120352934-120352956 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1089775750 11:120834606-120834628 GATGGGAAGCAGAGTGGGCAGGG + Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1091033542 11:132213257-132213279 AGTGGGAAACAGAATTGGGCAGG + Intronic
1091035261 11:132227438-132227460 AAAGGGAAGCAGAATATGGAGGG + Intronic
1091937855 12:4447504-4447526 GCTGGTAAACTGAATGGGGAGGG + Intergenic
1092283772 12:7116797-7116819 AGTGGGCAGAAGAATGGGGTTGG - Intergenic
1092296285 12:7201685-7201707 AGTGGGGAGTAGCATGGGGAGGG + Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1093474939 12:19544320-19544342 AATGGAAAGGGGAATGGGGAGGG - Intronic
1093975564 12:25417256-25417278 GCTGGGAAGGATAGTGGGGAGGG - Intronic
1094046599 12:26174453-26174475 CGTGGGTAGCAGGATGGGGAAGG - Intronic
1094227099 12:28057864-28057886 CCTGGGAAACACAATGGAGAGGG + Intergenic
1094527831 12:31244329-31244351 ACTAGGAAGGAGAATGGGAAGGG + Intergenic
1094805168 12:34083438-34083460 CCTGGGAAGCACAAGGGGGCAGG + Intergenic
1095170286 12:39026879-39026901 ACAGGGAAGCAGAAGAGAGATGG + Intergenic
1095382494 12:41612409-41612431 AATGGGAAGCATTTTGGGGAAGG + Intergenic
1095599101 12:43994799-43994821 ACTGGGAAGAGGAATTGGGATGG + Intronic
1096502175 12:52070663-52070685 TGTGGGAAGGAGAATGGGGTTGG + Intronic
1096504110 12:52082017-52082039 CCGGGGAAGCAGGATGGGAAGGG - Intergenic
1096521051 12:52184895-52184917 ACCAGGAAGCAGGAAGGGGATGG - Intronic
1096539677 12:52299099-52299121 GCTGGGAAGGGTAATGGGGAGGG - Intronic
1096803050 12:54124140-54124162 ACTGGGGAACTGAAAGGGGAGGG + Intergenic
1097051944 12:56229016-56229038 TCTGAGAACCAGAATGGGAATGG + Exonic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1097658783 12:62403651-62403673 AAGGGGAAGTAGAATGGAGAGGG + Intronic
1098038595 12:66332299-66332321 AATGGGAACAAGAAAGGGGAGGG - Intronic
1098151956 12:67555986-67556008 TCTGGGAAGCACAAGGGGTAGGG - Intergenic
1098198262 12:68025468-68025490 TCAGGGAAGGAGAATGAGGAGGG + Intergenic
1098874091 12:75848838-75848860 TCTGGGAAGCAGCATGATGAGGG - Intergenic
1099022599 12:77424811-77424833 CCTGGGAAGCACAAGGGGTAAGG - Intergenic
1099983127 12:89629827-89629849 ACTTAGAAGCAGGGTGGGGAGGG + Intronic
1101521120 12:105483383-105483405 ACATGGAAGCAGAATGTGCAAGG + Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101907131 12:108835512-108835534 GCCGGGAAGCAGGAAGGGGAAGG + Intronic
1102019220 12:109670182-109670204 GCTGGGTAGCAGAGTAGGGAGGG - Intergenic
1102757506 12:115354783-115354805 TCTGGAAAGGACAATGGGGATGG + Intergenic
1102928661 12:116845924-116845946 ACTGGGCAGAAGAGAGGGGATGG - Intronic
1103016701 12:117500232-117500254 ACCGGAATGCAGAAGGGGGATGG + Intronic
1103036583 12:117661862-117661884 TCTGGGAAGCAGGATTGGGGAGG + Intronic
1103197546 12:119058030-119058052 ACTGGGAAAGAAGATGGGGAAGG + Intronic
1103319254 12:120081167-120081189 TCTGGGGAGGAGAATGGGAATGG - Intronic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1106883001 13:34152258-34152280 ACTGCAAAGCAGAATGAGAAGGG + Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107703789 13:43078066-43078088 AATGGGAACCAGACTGTGGATGG - Intronic
1107798402 13:44079233-44079255 AATGGGACGGAGAATGGAGAGGG - Intergenic
1107813186 13:44219529-44219551 TCAGGGAGGCAGAATAGGGAGGG - Intergenic
1107968920 13:45622642-45622664 ACTGGGAAGCACAAGGGGTCAGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110470372 13:75853344-75853366 ACTGTGAAGCTGAAGGGGAATGG - Exonic
1110679215 13:78288634-78288656 ACTGGGAAGGGTAGTGGGGAGGG - Intergenic
1110951524 13:81498706-81498728 TCTGGGAAGGATAACGGGGAGGG + Intergenic
1111427558 13:88107543-88107565 ACTCTGAAGCATAATGGTGAAGG - Intergenic
1113033746 13:106025163-106025185 GCTGGGAAGGAAAATGGGGTGGG + Intergenic
1113654722 13:112061020-112061042 TCTGGGCAGCAGAAGAGGGAGGG + Intergenic
1114149142 14:20015390-20015412 GCTGGGAAGGAGAAGGGTGAGGG + Intergenic
1114263983 14:21060416-21060438 ACTGGGAAGAAGCCAGGGGATGG - Intronic
1114341874 14:21753955-21753977 TCTGGGAAGCAGAAGGGGTCAGG + Intergenic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115801487 14:36999130-36999152 ACTGGGAAGCAGTAGGTGAATGG + Intronic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116486672 14:45458154-45458176 CCTGTGAAGCATAAAGGGGAAGG + Intergenic
1118459984 14:65978825-65978847 ACTGGGTAGCAGACAGGGGATGG + Intronic
1118586692 14:67359970-67359992 GCAGGGAAGCTGGATGGGGAGGG - Exonic
1118787760 14:69060280-69060302 ACTGGGAAGAACAAAGGGCAGGG + Intronic
1119547924 14:75486637-75486659 ACTGGGATGCAGAGTGGGGTTGG + Intergenic
1119556911 14:75560297-75560319 ACTGGCAGTCAGAATGGGGTCGG + Intergenic
1120024467 14:79567385-79567407 AATGGGAAACAAAATGGGGAAGG + Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120852750 14:89186167-89186189 ACTTGGAAGCACACTGGGGAGGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1123164773 14:106315675-106315697 CCTGGGAAGCAGCAGGGAGAGGG - Intergenic
1202916162 14_GL000194v1_random:174368-174390 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1124017491 15:25889659-25889681 ATTTGGAAGCATTATGGGGAAGG + Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124600276 15:31128091-31128113 ACTGGTCAGCAGAGCGGGGAGGG - Intronic
1125352192 15:38779515-38779537 ACTGGGAAGTACAAGGGGTAGGG - Intergenic
1125426473 15:39554164-39554186 ACTGGGAAGCAGATGGGTGGAGG + Intergenic
1125537692 15:40451832-40451854 ACTGGGAAGAAGCTGGGGGAAGG + Intronic
1125546182 15:40507323-40507345 ACTGGGAAGCAGCAGGCGGGCGG - Intergenic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1126396954 15:48228328-48228350 AGTGGGAAGAAAAGTGGGGAGGG - Intronic
1126809064 15:52382328-52382350 ACTGGGAGGCCGAGTGGGGACGG + Intronic
1126903799 15:53342956-53342978 CCAGGGAAGCAGAATTAGGAAGG + Intergenic
1127867364 15:63043211-63043233 ACTGGGAATCAGTTTGGGGGAGG + Intronic
1128808842 15:70555369-70555391 TCTGGGAAGCAGACTGGGACAGG + Intergenic
1129113270 15:73350728-73350750 CCTGGGGAGGAAAATGGGGATGG - Intronic
1129644396 15:77417425-77417447 ACTAGGAAGGAGAGTGGGGTGGG + Intronic
1129753951 15:78084625-78084647 TCTAGGAAGCAGAAAGGTGAAGG - Intronic
1129824928 15:78628668-78628690 CCTGGGAAGCACAGTGAGGAAGG - Intronic
1129838189 15:78727085-78727107 ACTGTAATGCAGAATGGGGCGGG - Intronic
1130138142 15:81198656-81198678 GCTGGGAACCAGAAAGGGGGAGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131423317 15:92325701-92325723 ACTGAGAGGCAGAATGGTTATGG - Intergenic
1131508597 15:93036585-93036607 ACTGGGAGGCTGACTGAGGAGGG - Intronic
1131891832 15:96980789-96980811 TCTGGGAAGAAGCATGGAGATGG + Intergenic
1133241142 16:4415401-4415423 ACTGGGATGGAGAATGGAGGGGG - Intronic
1133510720 16:6454784-6454806 AATGGGAAGAAGCAAGGGGAGGG - Intronic
1133654558 16:7847891-7847913 ACTGGGAGGGAAAATGAGGATGG + Intergenic
1134049083 16:11124414-11124436 ACTGGGAAGGGGAAGGAGGAAGG - Intronic
1134449426 16:14354283-14354305 ACAGGGAAGGGGAAAGGGGAGGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135139373 16:19908443-19908465 ACAGGGATGGAGGATGGGGAAGG + Intergenic
1135420923 16:22305036-22305058 TCAGGGAAGCAGTTTGGGGAAGG - Intronic
1136023526 16:27455398-27455420 TCTGGGAAGGAGATTGGGAAGGG - Intergenic
1137830137 16:51536496-51536518 ACTGGGAAGTAGATAGGGCATGG + Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1138753968 16:59459596-59459618 CCTGGGAAGCAGATTATGGAAGG + Intergenic
1139271426 16:65687059-65687081 ACTGGGAAGCAAGATCTGGAGGG + Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141556384 16:84839308-84839330 ACCTGGAGGCAGAGTGGGGAGGG + Intronic
1141638883 16:85329808-85329830 CCTGGGAAGAAGGCTGGGGACGG + Intergenic
1143430780 17:6881589-6881611 GCTGGGAAGCATAATGTGGTGGG - Intronic
1143451003 17:7036642-7036664 ACTGGGAAGTGGAAGGGCGAGGG + Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1146453959 17:32995273-32995295 GGTGTGAAGCAGGATGGGGAAGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146634181 17:34491899-34491921 TCTGGGAAGGGGAATGGGGATGG - Intergenic
1146648613 17:34592209-34592231 CCTGGGAAGGAAAGTGGGGAGGG - Intronic
1146717792 17:35100891-35100913 ACTGGGAAGAAAAGTTGGGAGGG + Exonic
1146720660 17:35121290-35121312 CCTGGGAAGGAGAATAAGGATGG - Exonic
1146962325 17:36993263-36993285 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1147785445 17:42975178-42975200 ACTTGGAAGCAAGCTGGGGAGGG + Intronic
1148492499 17:48032351-48032373 ACTGGGAAGGAGAATGTGAAGGG + Intronic
1148554705 17:48571410-48571432 AGTAGGAGGGAGAATGGGGAGGG + Intronic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149585474 17:57783326-57783348 ACTCTGATGCAGAATGAGGAAGG + Intergenic
1150152029 17:62817850-62817872 GCTGGGAAGGATAGTGGGGAGGG + Intergenic
1150293926 17:63998127-63998149 TCTGGGAACCAGCAAGGGGAGGG + Intergenic
1150316590 17:64174377-64174399 ACTAGTAAGCAGAATGGGGAGGG + Intronic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1151062196 17:71108472-71108494 ACTGGGAAACTGAAGTGGGAGGG - Intergenic
1151833602 17:76569594-76569616 ACTGGGAGGGAGACTGGGTAGGG + Intronic
1152016285 17:77752880-77752902 GCTGGGAAGAAGCCTGGGGAAGG + Intergenic
1152024912 17:77802720-77802742 TCTAGGTAGCAGAAGGGGGAGGG - Intergenic
1152526967 17:80893875-80893897 CCTCGGAAGCAGAAAGGGGCAGG - Intronic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1152870470 17:82751054-82751076 ACGGGGATGGAGGATGGGGACGG - Exonic
1153226419 18:2903416-2903438 CGTGGGAAGAAGGATGGGGAAGG - Intronic
1156250567 18:35348243-35348265 ACAGGGAAGCAGAATGGTCATGG - Intergenic
1156323768 18:36053983-36054005 ACAGGGAAGAGGAATGGGAATGG + Intronic
1156470323 18:37373720-37373742 GCTGGAAAGCAGCCTGGGGAGGG + Intronic
1157119593 18:44896480-44896502 ACTTGGATGTAGAGTGGGGAGGG - Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157520641 18:48342789-48342811 CCTGGGGAGTGGAATGGGGAGGG + Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1160451395 18:78968740-78968762 ACTGGGAAGCAGGCTCAGGAGGG - Intergenic
1161202963 19:3025961-3025983 GCTGGGAAGGAGAAGGGGGTGGG - Intronic
1161310552 19:3591683-3591705 ACTGGGCTGCAGGATGGGGATGG - Exonic
1161431915 19:4237422-4237444 ACTGGGAAGCCGACGTGGGAGGG + Exonic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162062169 19:8102693-8102715 GCTGGGAAGAAGGTTGGGGAGGG + Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162860499 19:13503285-13503307 ACTAGGAGGCGGTATGGGGAGGG + Intronic
1163020385 19:14478227-14478249 ACTGGGAACCAGGGAGGGGATGG + Exonic
1163392638 19:17039633-17039655 CCTGGGGAGCTGAATGGCGAGGG - Intergenic
1164463833 19:28470823-28470845 TTTGGGAAGCTGAGTGGGGAGGG + Intergenic
1164655029 19:29914639-29914661 ACTGGAAAGCTGAAGGGGCAGGG + Intergenic
1165003790 19:32787874-32787896 CCTGGGAAGCACAAGGGGAAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166356368 19:42229881-42229903 ACTGGGGATCAGAGAGGGGAAGG - Intergenic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166866728 19:45843009-45843031 ACTCGGAAGGAGACTGGAGAAGG - Intronic
1166966233 19:46530824-46530846 ACCTGGAAGGAGAGTGGGGAGGG - Intronic
1167383301 19:49150591-49150613 ACTGGGCAGGAAAAAGGGGAGGG - Exonic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167628397 19:50607519-50607541 ACTGAGAAAGAGGATGGGGACGG - Intergenic
1167813699 19:51858554-51858576 ACTGTCAAACAAAATGGGGAAGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1202674051 1_KI270710v1_random:24140-24162 CCTGGGAAGCACAATGGGTCAGG - Intergenic
925048679 2:794717-794739 ACTTGGAAGCTGAGTGGGGCTGG + Intergenic
925187092 2:1855515-1855537 GCTGGGGAGCAGAGTGGGGTTGG + Intronic
926113619 2:10197468-10197490 ACTGGGAAGCAGAAGGGCTGGGG + Intronic
926834340 2:17000924-17000946 ACTGTGAAGTAGAATGAGGTAGG - Intergenic
926976015 2:18517530-18517552 AGTGGGGAGCAGGGTGGGGAGGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927946480 2:27137897-27137919 ACTGGCAAGGTGAGTGGGGAAGG + Exonic
928763091 2:34607551-34607573 GCTGGGAAGGATAATGGGGTTGG - Intergenic
928919112 2:36507537-36507559 ATTGGGAAGCTGAATGTAGATGG + Intronic
929655072 2:43722571-43722593 ACTGGGAACCATAACAGGGAAGG + Intronic
930160808 2:48154866-48154888 ACTTGGAAGAAGTATGGGAAGGG + Intergenic
930865954 2:56121996-56122018 ACTTGGTAGCAAGATGGGGATGG + Intergenic
931665345 2:64606489-64606511 ACTGTGATGCAGAACAGGGAAGG - Intergenic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
932691486 2:73917429-73917451 GTTGGGAGGCAGTATGGGGAAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932881152 2:75503342-75503364 CCCAGGAAGCAGAGTGGGGAGGG + Intronic
933206209 2:79511768-79511790 ACTTGGAAGCAAAAGGGGGGAGG + Intronic
934946049 2:98542814-98542836 ACAGGGTAACAGAAGGGGGAAGG - Intronic
935018083 2:99203084-99203106 ACTGGGAAGGGTAGTGGGGATGG - Intronic
935308371 2:101759581-101759603 AATGGGGAGGTGAATGGGGAGGG - Intronic
935393012 2:102573435-102573457 ACTGGGAAGTGTAGTGGGGAGGG - Intergenic
935899909 2:107780371-107780393 GCTGGGAAGGGTAATGGGGAGGG - Intergenic
936898507 2:117456964-117456986 ACTGGGAAGTATAGTGGTGAGGG - Intergenic
937302015 2:120848370-120848392 ACCGGCGAGCAGAGTGGGGATGG + Intronic
937708558 2:124950484-124950506 CCAGGGATGCAGAATGGAGAAGG - Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938901196 2:135799738-135799760 ACTAGGAAGCCGACTGGGCAAGG - Intronic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940640529 2:156341590-156341612 TCCGGGCAGCAGAAAGGGGATGG + Intronic
941642031 2:167999091-167999113 ATTGGGAATAAGGATGGGGAGGG - Intronic
941744766 2:169074984-169075006 AGGGGGAAGCAGAATGGACAAGG + Intronic
941867644 2:170351306-170351328 TCTGGGAAAAAGAATGGGGTAGG + Intronic
941940609 2:171033416-171033438 GCTGGGAAGGACAGTGGGGAAGG + Intronic
942113075 2:172701182-172701204 TCTGGGAAGCAGAATTTGGTGGG - Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
944287879 2:197972867-197972889 ACTGGAAGGGACAATGGGGAAGG - Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944614419 2:201445737-201445759 AGTGGGAAGAATTATGGGGAAGG + Intronic
944721720 2:202429363-202429385 ACTGGAATGCAGAGTGGGAAAGG - Intronic
945324024 2:208462422-208462444 CCTGGGAATAAGAATGTGGAAGG + Intronic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
945827173 2:214736398-214736420 ATTGGGAAGGAGATTTGGGAAGG - Intronic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946159248 2:217826065-217826087 ACTGGGAAGGAGAAAGGAGGTGG - Intronic
946326427 2:218986787-218986809 AGTGGGAGGCAGAGTGTGGAGGG + Intergenic
946614128 2:221491103-221491125 ACTGGAGAGGAGAATGGGAAAGG - Intronic
947291516 2:228580808-228580830 ACGGGTAGGTAGAATGGGGAAGG + Intergenic
947382468 2:229558658-229558680 ACTGGGCTGCAGGATGGGGTGGG + Intronic
947561586 2:231158646-231158668 CCTGGGATGGAGACTGGGGAGGG - Intronic
947669658 2:231928154-231928176 ACTAGAAAGCAGTATAGGGAGGG + Intergenic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169443761 20:5654464-5654486 ACTGGAAAGGGGAAAGGGGAAGG - Intergenic
1169710609 20:8558009-8558031 CCTGGGAAGGATAATGGGTAGGG + Intronic
1170010127 20:11713838-11713860 ATTGGGAAGCAGATGTGGGAGGG + Intergenic
1170253940 20:14318748-14318770 ACAGGAAAGCAGAGTGGGAAGGG - Intronic
1170580610 20:17696981-17697003 AATGGGGAGGAGAATGTGGAAGG + Intronic
1170624174 20:18018906-18018928 TCTGTGCAGCAGAATGGGGATGG - Intronic
1170686714 20:18576039-18576061 CCTGGGAACTAGACTGGGGAGGG + Intronic
1170805046 20:19622159-19622181 ACTTGAAAGGAGACTGGGGATGG + Intronic
1171793710 20:29550448-29550470 ACTGGGGAACTGAAAGGGGAGGG - Intergenic
1172838045 20:37885604-37885626 CCTGGGAAGCAGCATGGGGTGGG - Intergenic
1173301436 20:41807189-41807211 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173336135 20:42113685-42113707 AGTGGGAAGCAGGAGAGGGAAGG - Intronic
1175414453 20:58792638-58792660 ACGGGGAAGGGGAATGGAGATGG + Intergenic
1175503632 20:59467188-59467210 CCAGGGAAGGGGAATGGGGAGGG + Intergenic
1175674481 20:60934946-60934968 ACAGGGAGGCGGAAAGGGGAGGG - Intergenic
1176044015 20:63083137-63083159 ACTGTGAAGCAGGCTGGAGAGGG + Intergenic
1176070475 20:63223611-63223633 GCTGGGAGGCAGCATGTGGAAGG + Intergenic
1176635513 21:9189014-9189036 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177418492 21:20825460-20825482 ACAGGGTAGCAGAATGGAGTGGG + Intergenic
1179603323 21:42495879-42495901 AATGGGAGGCAGGATGGGGGTGG + Intronic
1180371083 22:12037288-12037310 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181455189 22:23055326-23055348 ACTGGGAAGAAGAAAAGTGAAGG - Intergenic
1181611687 22:24018143-24018165 ACTGAGAAACAGGATGGGCATGG - Intronic
1182083437 22:27544853-27544875 TCTGGGAAGCAACATGGGGAGGG - Intergenic
1182453290 22:30433746-30433768 ACGGGGTGGCAGAGTGGGGAGGG - Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183597951 22:38823386-38823408 ACTGGGCAGGAGGATGGAGAGGG - Intronic
1184642267 22:45878980-45879002 CCTGGGGAGCTGAATGGGGCTGG + Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
950594347 3:13965637-13965659 ACTGGACAGCAGAGAGGGGATGG - Intronic
950750082 3:15121507-15121529 CCTGTGAAGGAAAATGGGGAAGG + Intergenic
951106521 3:18750222-18750244 GTTGGGAGGCAGAATTGGGAGGG + Intergenic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
952069535 3:29617468-29617490 ACTAGGAAGGAGCATGAGGAAGG + Intronic
952101322 3:30016546-30016568 TTTGGGAGGCAGAATGGAGATGG + Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952674146 3:36006832-36006854 ATTGGCAAGGAGAATGGGAATGG + Intergenic
953411054 3:42690712-42690734 ACAGGGAAGGGGAATGGGGTTGG + Intronic
953703752 3:45215907-45215929 TGAGGGAAGCAGAATGGGGCAGG - Intergenic
953932422 3:47012348-47012370 ACAGGGAAGGAGTATGGGTAGGG + Intergenic
954141060 3:48605798-48605820 ACTGAGAAGAATAATGGGGCAGG - Exonic
955451630 3:59074560-59074582 AATGGAAAACAGAATGGGGTAGG + Intergenic
956153444 3:66267929-66267951 ACTGGGAAGGAGACTTTGGAGGG - Intronic
956540446 3:70332405-70332427 ACTTGCAACCAGAATGAGGATGG - Intergenic
957555018 3:81755812-81755834 GCTGGGAAGGACAGTGGGGAAGG + Intronic
958867584 3:99519069-99519091 ACAGGAAAGCAGGATGGAGAGGG - Intergenic
960265712 3:115618725-115618747 ACAGGGACACAGAATGGGGAAGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962248432 3:133818949-133818971 TCTGGATAGCAGAAAGGGGAAGG + Intronic
962870184 3:139482063-139482085 ACTGGGAAGAGTAGTGGGGAGGG - Intergenic
963020129 3:140864896-140864918 AGTGGGAAGGGTAATGGGGATGG - Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963387143 3:144611738-144611760 AGAGGGAAGCTGAGTGGGGAAGG - Intergenic
964676556 3:159288810-159288832 ACTGGCAAGGTGAATGGGAATGG + Intronic
964877549 3:161385457-161385479 ACTAGGAGGGAGAAAGGGGAAGG + Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965909370 3:173752782-173752804 ACTGGGAAGTAGAAGGAGAATGG - Intronic
966770694 3:183501100-183501122 ACAGGTCAGCAGAGTGGGGATGG + Intronic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
967669899 3:192220309-192220331 ATAGGGAAGTAGAATGGTGAAGG - Intronic
968745274 4:2356661-2356683 AATGGGAAGAAGAGTGGGGTTGG + Intronic
969334542 4:6499920-6499942 ACTTGGAAGAAGAAAGGGGAAGG - Intronic
969568211 4:7992639-7992661 GCAGGGAGGCAGAGTGGGGAGGG + Intronic
970091303 4:12411088-12411110 ACTGGGAAGATGCTTGGGGATGG + Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
970657761 4:18250568-18250590 AATGGGATACAGATTGGGGAGGG - Intergenic
970661242 4:18288091-18288113 ACTGGGGAGCAGCCTGTGGATGG + Intergenic
970909576 4:21258975-21258997 ACTGGGATGCTGGATGTGGATGG + Intronic
973067245 4:45811044-45811066 GCTGGGAAGAAGAAGGGGAAGGG - Intergenic
973091880 4:46147386-46147408 ACTTGGGAGCAGAATCAGGAGGG + Intergenic
975809630 4:78153315-78153337 TCTGGGATCCAGAATGGGGCCGG + Intronic
976392351 4:84518341-84518363 ACTGGGAAGTTGCATGGTGACGG - Intergenic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
979346325 4:119591817-119591839 AGAAGGAAGGAGAATGGGGAGGG + Intronic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
982200505 4:152955853-152955875 TCTGGGAAGAAGAGTGGGAAAGG - Intronic
982353657 4:154443789-154443811 TTTGGATAGCAGAATGGGGAGGG - Intronic
982717747 4:158826689-158826711 CCTTGGAACCAGAATGGGAATGG + Intronic
983167765 4:164497982-164498004 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
983389353 4:167108653-167108675 GCTGGGAAGCATAGTGGGGTGGG + Intronic
984483016 4:180330219-180330241 ACTATGGAGCAGAATGGGAAGGG - Intergenic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
984884765 4:184440461-184440483 TGTGGGAAGGAGAATGGGGCCGG - Intronic
984940016 4:184922685-184922707 CCAGGGAAGCAGAGTGGGGAGGG + Intergenic
1202752777 4_GL000008v2_random:24538-24560 CCTGGGAAGCACAATGGGTCAGG + Intergenic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986241227 5:5961629-5961651 ACTGGGGAGCAGTATGGTGCAGG + Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986605376 5:9517800-9517822 ACAGGAAAGCAGACTGGAGAGGG - Intronic
986753446 5:10811551-10811573 AATGGGGATCAGAGTGGGGAGGG + Intergenic
988567603 5:32331842-32331864 ACTGGGAGCCAGAAAGGGGGCGG + Intergenic
988589569 5:32536981-32537003 ACTGGGTAGGAGCATGGGGCTGG - Intronic
990194932 5:53303911-53303933 ACTGGGAAGTAGAAGATGGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG + Intergenic
991280802 5:64910889-64910911 CCTGGGAAGCACAAAGGGTAGGG - Intronic
992502625 5:77357292-77357314 TCTGGGCAGCAAAGTGGGGATGG + Intronic
993362223 5:86991677-86991699 ACTGGAAAGGAGAATGATGAGGG - Intergenic
993603130 5:89953450-89953472 ACTTGGACGCAGAATGGGTAAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994521739 5:100846793-100846815 ACTGGGAAGCATATTGGTCAGGG + Intronic
995042602 5:107605853-107605875 ACTGGGAGGAAGCAGGGGGAGGG + Intronic
995636414 5:114197673-114197695 GCTGGGAGGCAGAATAGGGGTGG + Intergenic
996632951 5:125659251-125659273 ACTAGGCAACAGACTGGGGAGGG + Intergenic
997688804 5:135811213-135811235 CCTGGGAAGGAGGATGGGCAGGG + Intergenic
997697713 5:135874511-135874533 ACTGGGAGGAGGAGTGGGGAAGG - Intronic
997879761 5:137579159-137579181 GCTGGGAGCCAGTATGGGGAGGG - Intronic
998219237 5:140262719-140262741 AATGGGAATGAGACTGGGGAAGG + Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999030873 5:148289825-148289847 TCTGGGAATCAGAATTAGGATGG + Intergenic
999120555 5:149206333-149206355 TGTGTGAAGCACAATGGGGAAGG + Intronic
999291184 5:150427597-150427619 ACCAAGAAGGAGAATGGGGAAGG - Intergenic
999408496 5:151328299-151328321 AGTAGCAGGCAGAATGGGGAAGG + Intronic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
1000574782 5:162964626-162964648 ACTGGGAAGCACAAGGGGTCAGG - Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001302734 5:170548605-170548627 ACTAGGAAGGTGGATGGGGAAGG - Intronic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001879730 5:175233064-175233086 AATGTGAAGGAGAATGGGCACGG + Intergenic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1002189399 5:177470866-177470888 ACAGGGAATCAGGATGGGGTAGG + Intronic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1002673131 5:180886355-180886377 CCTGGGAAGCACAAGGGGCAGGG - Intergenic
1002761938 6:209185-209207 CCTAGGAAGAAGAAAGGGGAAGG + Intergenic
1003638776 6:7858999-7859021 ACTCGGTAGCAGAGTCGGGATGG + Intronic
1003661397 6:8065329-8065351 TCTGGGGAGCAGATTGGGGCTGG + Intronic
1004092584 6:12519246-12519268 TCTGGGAAGCAAATTTGGGATGG + Intergenic
1004100684 6:12607284-12607306 ATTGGGAAATTGAATGGGGATGG - Intergenic
1004278479 6:14258827-14258849 ACAGGGAGGCAGAGAGGGGAGGG + Intergenic
1004313014 6:14562512-14562534 ACAGGGAAGCAGAATTGGGCAGG - Intergenic
1005932028 6:30491235-30491257 ACCTGGCAGCAGGATGGGGAGGG + Exonic
1005948975 6:30617147-30617169 TCTGGGAAGCGGGATAGGGATGG - Intronic
1006093047 6:31639472-31639494 ACCTTGAAGCAGAATAGGGATGG - Intronic
1006671595 6:35732688-35732710 ACTGGTAAAGAGAATGAGGAAGG + Intergenic
1007408376 6:41647646-41647668 GCTGGGAAGTGGAGTGGGGAGGG - Intronic
1007662634 6:43496076-43496098 ACTGGGGAGCACATGGGGGAAGG + Intronic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1008111248 6:47497362-47497384 ACAGGGAAGGAGAAGGGGAAGGG - Intronic
1008236386 6:49056934-49056956 ACTGGGAACAAGAAGGGGGGTGG + Intergenic
1008510779 6:52273741-52273763 CCTGGGGAGCAGGATGGCGATGG - Exonic
1009323704 6:62323381-62323403 ACTGGAAAGCAGAATATGGCAGG + Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1009715070 6:67380684-67380706 GCTGGGAAGTATAATGGGGAGGG + Intergenic
1009729228 6:67578501-67578523 ACTGGGAAACAGGCTGGGGTTGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1012524405 6:100160229-100160251 AGTGGGGAGCAGAATAGGAAAGG + Intergenic
1013225270 6:108116087-108116109 ACTGGTATGCAGAAAGGGGTGGG + Intronic
1013675101 6:112450636-112450658 CCTGGAAAGAGGAATGGGGAAGG - Intergenic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1016486299 6:144543295-144543317 CCTGGGAAGCAGGTGGGGGATGG + Intronic
1016745377 6:147573743-147573765 GCTGGGCAGTAGAATGTGGAGGG + Intronic
1017122416 6:151037143-151037165 ACAGCAATGCAGAATGGGGAGGG - Intronic
1017377321 6:153786384-153786406 ACTGTGAAGCAGATTAGGAAAGG + Intergenic
1017467803 6:154710960-154710982 ACAGGGAAGGAGGATGGGGCTGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017777756 6:157692616-157692638 ACTGGGAGGCAGTAAGGAGATGG - Intergenic
1018115490 6:160579626-160579648 CTTGGGAGGCATAATGGGGAAGG - Intronic
1018738989 6:166713066-166713088 CTTGGGAAGAAGCATGGGGAAGG - Intronic
1018961034 6:168448570-168448592 ACTGGGGAGGAGGATGGTGATGG + Intronic
1019313633 7:374758-374780 AATGGGAAGGTGAATGGGGTGGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019717474 7:2546330-2546352 CTCGGGAAGCTGAATGGGGAGGG + Intronic
1019875039 7:3802580-3802602 ACAGGGCAGCACAAGGGGGATGG - Intronic
1019884355 7:3891150-3891172 ACTGGGAAAGAGGATGGGGGAGG + Intronic
1020143535 7:5625264-5625286 GCTGGGGAGAAGGATGGGGAGGG + Intronic
1020774173 7:12432288-12432310 CCTGGGAAGCACAAAGGGTAGGG - Intergenic
1020956850 7:14750503-14750525 AATGGGCATCAGAATGGAGATGG - Intronic
1021515821 7:21485428-21485450 TCTGGAAAGCAGGATGGGGTGGG - Intronic
1021572596 7:22081530-22081552 TCTGTGAACCAGAGTGGGGAGGG + Intergenic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1022652372 7:32288946-32288968 ACTAGGAAGAAGAAAAGGGAAGG + Intronic
1023494072 7:40776008-40776030 AGTGGCAGGCACAATGGGGAAGG - Intronic
1023963230 7:44945180-44945202 ACTGGGAGGAGGAATGGGGGTGG + Intergenic
1024461655 7:49665945-49665967 ACTGGGAAGCACAAGGGGTCAGG + Intergenic
1024516618 7:50264800-50264822 ACCAGGCAGCAGAGTGGGGAGGG + Intergenic
1025944007 7:66092677-66092699 CCTAGGAGGCAGCATGGGGAAGG - Intronic
1026350517 7:69511397-69511419 GCTGGGCAGGAGGATGGGGATGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027582793 7:80020006-80020028 CCTGGGAAGCACAAGGGGTAGGG + Intergenic
1027626438 7:80550851-80550873 AATGGGAAGGAGAATGGAGCAGG - Intronic
1027640082 7:80722523-80722545 ACTGGGAGGAAGAATGAGGGAGG - Intergenic
1028112261 7:86955733-86955755 ACTTGGAATCTGAATTGGGATGG - Intronic
1028114457 7:86981865-86981887 ACTGGGAAGCACAAGGGGTCAGG + Intronic
1028668526 7:93373749-93373771 AGTGGGAAGGAGGATAGGGATGG + Intergenic
1030221054 7:107099446-107099468 ACTGGGAAGCACAAGGGGTCAGG - Intronic
1030278731 7:107747193-107747215 TCTGTGAAGCAGAGTGGGAAGGG + Intronic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1032870300 7:135977527-135977549 ACTGGGAGGCAGAATGAAGGAGG + Intergenic
1032975890 7:137221798-137221820 ACATGGAAGCAGAATGTAGATGG + Intergenic
1033352625 7:140573920-140573942 ACTAGGAAGCTGAGTCGGGATGG - Exonic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034227552 7:149495699-149495721 ACTGAGAACTAGAATGCGGATGG + Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1036225710 8:6955855-6955877 ACTGGAAAACAGATTGTGGATGG - Intergenic
1037665561 8:20966735-20966757 ACTGGGAAATAGATTGGTGAAGG + Intergenic
1037705359 8:21312437-21312459 ACTGGGATCCAGTCTGGGGATGG + Intergenic
1037705561 8:21313224-21313246 ACTGGGAACCAGTCCGGGGATGG + Intergenic
1037864147 8:22429613-22429635 AATTGGGAGCAGCATGGGGATGG + Intronic
1037912023 8:22749136-22749158 AGTAGGAAGGAGAGTGGGGATGG + Intronic
1038035219 8:23681639-23681661 TCTGGAAAGGAGAGTGGGGAAGG + Exonic
1038379051 8:27075112-27075134 TCTGGGAATCAGGATGGAGAGGG + Intergenic
1039387304 8:37147441-37147463 ACTGGCAAGCAAATGGGGGACGG - Intergenic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1040793260 8:51258560-51258582 AATGGGAAGAAGAATGAGAAGGG + Intergenic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1042281802 8:67064071-67064093 CCTGGAAAGAAAAATGGGGAGGG - Intronic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1043938900 8:86174323-86174345 CCTGGGAAGCAGAAGGGGTGGGG - Intergenic
1044497083 8:92899391-92899413 ACTGGGAAGAGTATTGGGGAGGG - Intronic
1044787510 8:95810078-95810100 CCTGTGAAGCATAAAGGGGAGGG - Intergenic
1046234934 8:111411345-111411367 ACTGGAAAATACAATGGGGAAGG - Intergenic
1046631745 8:116628666-116628688 GCTGGGAAGCAGCGTGGGGTGGG + Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1047348553 8:124051712-124051734 TCTGGGGAGCATAATGAGGAAGG + Intronic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048015218 8:130491101-130491123 AGTGGGAAGTTGAATGTGGAAGG + Intergenic
1048946579 8:139454015-139454037 AGTGGGAAGCAGAATGTAGGTGG - Intergenic
1049094445 8:140540240-140540262 ACTGGGAAGGCAAATGGGGGAGG + Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049352469 8:142171538-142171560 GCTGTGAAGGAGAGTGGGGAGGG - Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049542936 8:143216567-143216589 ACTGGGTAGCAGAGCCGGGAAGG + Intergenic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1050404408 9:5292954-5292976 ACTGGGAAGCACAAGGGGTGAGG + Intergenic
1050866793 9:10510851-10510873 GCTGGGAAGGATACTGGGGAGGG - Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051208524 9:14715438-14715460 TCTGGGAATCAGAGAGGGGATGG + Intergenic
1051273619 9:15378659-15378681 ACTAGGATGCAAAATGTGGAGGG - Intergenic
1051431659 9:16985801-16985823 ACTGGGAGGAAGGATGGGGTGGG + Intergenic
1051961929 9:22776521-22776543 ACTGGGAAGGATTGTGGGGAGGG + Intergenic
1052460659 9:28758531-28758553 ACTGTGAAGCAATATGGGAATGG - Intergenic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1053573279 9:39331880-39331902 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1053792582 9:41697223-41697245 ACTGGGGAACTGAAAGGGGAAGG + Intergenic
1054094849 9:60890586-60890608 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1054116316 9:61166490-61166512 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1054123865 9:61287131-61287153 TCTGGATAGGAGAATGGGGAAGG - Intergenic
1054152592 9:61617597-61617619 ACTGGGGAACTGAAAGGGGAGGG - Intergenic
1054180996 9:61909244-61909266 ACTGGGGAACTGAAAGGGGAGGG + Intergenic
1054472369 9:65548745-65548767 ACTGGGGAACTGAAAGGGGAGGG - Intergenic
1054591443 9:67016054-67016076 TCTGGATAGGAGAATGGGGAAGG - Intergenic
1054656595 9:67671898-67671920 ACTGGGGAACTGAAAGGGGAGGG - Intergenic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1055237705 9:74143883-74143905 ACTGGAAATGGGAATGGGGAAGG - Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055474667 9:76650081-76650103 ACTGGGAAGCAGCATGGGCCAGG + Intronic
1056480753 9:87003158-87003180 ACTGGGAAGCATACTAGAGAGGG - Intergenic
1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG + Intronic
1057847506 9:98536893-98536915 ACTGAGGAGCAGGATGGAGAAGG - Intronic
1058610107 9:106766732-106766754 TCTGAGAAGTAGAATGGGTATGG + Intergenic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1059382999 9:113943065-113943087 ACTGGGAAGGAGATAGGGTAGGG + Intronic
1059946940 9:119418841-119418863 ACTGGAAAAAAGAATAGGGATGG + Intergenic
1060208507 9:121696678-121696700 ACTGGGGACCAGAGTAGGGAAGG - Intronic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1061149609 9:128821307-128821329 ACTGGGGACCTGCATGGGGAAGG - Exonic
1061149618 9:128821346-128821368 ACTGGGGACCTGCATGGGGAAGG - Exonic
1061149629 9:128821385-128821407 ACTGGGGACCTGCATGGGGAAGG - Exonic
1061525568 9:131158783-131158805 AAAGGGAAACAGAATGGGTATGG - Intronic
1061628309 9:131855559-131855581 GCTGGGAAGGAGAGTGGGGGAGG + Intergenic
1061649474 9:132035485-132035507 ACAGGGAAGCAGATGGGGGGTGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062182059 9:135196207-135196229 ACTGGGAAGGGAAATGGGAAGGG - Intergenic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1062182262 9:135196758-135196780 AGTGGGAAGAAGAAGAGGGAAGG - Intergenic
1203651872 Un_KI270751v1:132581-132603 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1186612069 X:11147455-11147477 ACTTGGAAGCAGAATTGTGAGGG + Intronic
1186927602 X:14352296-14352318 TCTGGGCAGCAGAATGGAGATGG + Intergenic
1187260593 X:17682104-17682126 ACTGCCAAGCAGAGTGGGCAAGG + Intronic
1187349652 X:18501141-18501163 ACTGGGAATCAGAATGTGAGTGG - Intronic
1187520678 X:20011264-20011286 ACAGGGAAGCAGATTGAGCAGGG + Intronic
1188050251 X:25475856-25475878 GCTGGAGAACAGAATGGGGAAGG - Intergenic
1188310757 X:28613666-28613688 ACTGGGCAAGAGAATGTGGATGG - Intronic
1188353982 X:29167281-29167303 AAGGGGAAGCGGAATGGGAAGGG - Intronic
1188737048 X:33729901-33729923 AATGGGATGGAGAGTGGGGATGG - Intergenic
1188920534 X:35971205-35971227 TGAGGGAAGCAGAATAGGGAAGG + Intronic
1189159135 X:38792696-38792718 ACTGGAAGCCAGAATGGGGTGGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190750753 X:53359543-53359565 TCTGGCAAGCAGAAAGGGGGCGG + Intergenic
1190801847 X:53796493-53796515 TCTGGCAAGCAGAAAGGGGCGGG + Intergenic
1192205243 X:69091477-69091499 GCTGAGAACCAGAGTGGGGAAGG - Intergenic
1192486817 X:71534219-71534241 ACTGGGCTGAAGAATGGGGATGG - Intronic
1192936425 X:75863177-75863199 ACTGGGAAGCACAAGGGGTTGGG - Intergenic
1192949167 X:75998065-75998087 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
1193415414 X:81216587-81216609 ACTGGGAAGGATAATGGGTAGGG - Intronic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1193896759 X:87123833-87123855 ATTGGGAAATAGAATGGGGCAGG + Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1194613798 X:96076352-96076374 ACTGGGAAGACTGATGGGGAAGG - Intergenic
1195494447 X:105514016-105514038 AAATGGCAGCAGAATGGGGAAGG + Intronic
1196331606 X:114476778-114476800 ACTGGGAAGGGTAATGGGGAGGG + Intergenic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1197761152 X:130029319-130029341 ACTGGGAAGCAGGGTAGGGGAGG - Intronic
1197838822 X:130723715-130723737 CCTGGGAAACAAAATGGGGAGGG - Intronic
1199067612 X:143438837-143438859 ACTGGGAAGGAGAATGAGCCAGG - Intergenic
1200063915 X:153495870-153495892 ACTGGGACTCAGAATGGGTGTGG + Intronic
1200751136 Y:6945243-6945265 AAAGGGAAGAAGAATGGGAAAGG - Intronic
1201171818 Y:11273928-11273950 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1201689112 Y:16743440-16743462 ACTGGGAAGGGTATTGGGGAGGG - Intergenic
1201916838 Y:19191036-19191058 ACTGGGAAGCAAAAGGGGTCAGG - Intergenic