ID: 1146471942

View in Genome Browser
Species Human (GRCh38)
Location 17:33131709-33131731
Sequence ATGGTCCTCTTGGAGAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146471942_1146471948 -3 Left 1146471942 17:33131709-33131731 CCTGTCCTCTCCAAGAGGACCAT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1146471948 17:33131729-33131751 CATGAGTGGCCATTGTTGGCAGG 0: 1
1: 0
2: 2
3: 6
4: 92
1146471942_1146471954 30 Left 1146471942 17:33131709-33131731 CCTGTCCTCTCCAAGAGGACCAT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1146471954 17:33131762-33131784 TTCATTTCCCTGGCCGGCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 109
1146471942_1146471949 3 Left 1146471942 17:33131709-33131731 CCTGTCCTCTCCAAGAGGACCAT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1146471949 17:33131735-33131757 TGGCCATTGTTGGCAGGCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 244
1146471942_1146471952 24 Left 1146471942 17:33131709-33131731 CCTGTCCTCTCCAAGAGGACCAT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1146471952 17:33131756-33131778 GGCCTCTTCATTTCCCTGGCCGG 0: 1
1: 0
2: 1
3: 25
4: 227
1146471942_1146471951 20 Left 1146471942 17:33131709-33131731 CCTGTCCTCTCCAAGAGGACCAT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1146471951 17:33131752-33131774 CAGAGGCCTCTTCATTTCCCTGG 0: 1
1: 0
2: 2
3: 39
4: 250
1146471942_1146471946 -7 Left 1146471942 17:33131709-33131731 CCTGTCCTCTCCAAGAGGACCAT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1146471946 17:33131725-33131747 GGACCATGAGTGGCCATTGTTGG 0: 1
1: 0
2: 0
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146471942 Original CRISPR ATGGTCCTCTTGGAGAGGAC AGG (reversed) Intronic
900342904 1:2197147-2197169 ATGGTCCTCCAGGACAGGGCAGG - Intronic
905438209 1:37974275-37974297 GTGGTCATCTTGGTGAGGAAAGG - Intronic
905580990 1:39082324-39082346 ATGGGCGTCTTGGAGAGGAATGG + Intronic
907470782 1:54672126-54672148 GTGGTGCCCTTGGAGAAGACTGG + Intronic
910617778 1:89218381-89218403 TTGATACTCTTTGAGAGGACTGG + Intergenic
914414844 1:147469861-147469883 ATGGCTCTCATGGAGAGGAATGG - Intergenic
915109219 1:153552540-153552562 TTTGTCCACTGGGAGAGGACTGG + Intergenic
917920484 1:179745451-179745473 GTGGGCCTCTGGGTGAGGACTGG - Intronic
918611726 1:186499943-186499965 ATGGGCCTCTCAGAGAAGACAGG - Intergenic
919398992 1:197085298-197085320 ATAGTCATCTTGGAGAGAAAGGG - Intronic
919691325 1:200530968-200530990 ATGGTCCTATAGCAGAAGACAGG + Intergenic
921013312 1:211163200-211163222 ATGGCTCTCATGGAGAGGAATGG - Intergenic
921936063 1:220798387-220798409 ACGGCTCTCTTGGAGAAGACAGG + Intronic
922168758 1:223137639-223137661 ATGGGGCACTTGCAGAGGACAGG + Intronic
922417749 1:225436944-225436966 ATGGTGCTCTTTGAGAGAGCAGG - Intergenic
922727019 1:227927357-227927379 ATGGGCCCCATGGGGAGGACAGG + Intronic
923232105 1:231996650-231996672 ATGGTGCTCTGGGAGAGGGTAGG - Intronic
924540026 1:244971296-244971318 GTGGTCCCCTGGGAGAGGCCCGG - Intronic
1064924421 10:20554432-20554454 ATGGAGCTCTTGGAGTGAACAGG + Intergenic
1069145630 10:64889450-64889472 ATGGGCCTTTTGGACAGGAATGG - Intergenic
1070246891 10:74740445-74740467 CTGGTCCCCTTTGAGGGGACAGG + Intergenic
1071565017 10:86667299-86667321 CTGGCCCTCTTGGAGGGGTCTGG - Intergenic
1074275738 10:112000204-112000226 AGGGTCCTCTTGGAGGTCACAGG - Intergenic
1075006172 10:118831813-118831835 ATGGTCCTGTGGCAGTGGACTGG - Intergenic
1076664886 10:132081577-132081599 AAGGTGCCCTTGGAGAGGTCTGG + Intergenic
1080901010 11:36490938-36490960 ATGTTAATCTTGGAGAGGACAGG - Intronic
1083690603 11:64406269-64406291 ATGGGCCTCCTGGAGTGGGCAGG + Intergenic
1083779087 11:64909007-64909029 ATGGTCCTCTTAGAGGAGAAGGG + Exonic
1083898861 11:65634111-65634133 ATGATGCTCTGGGAGAGGAGGGG - Exonic
1084312868 11:68326839-68326861 ATGGTCCTCATGGTGGGGAGGGG + Intronic
1086569445 11:88264868-88264890 GTGGTGCTCATGGAGAGGAATGG - Intergenic
1087137379 11:94734648-94734670 ATGCTCCCCTGGGAGAGGAGGGG + Intronic
1090520467 11:127473852-127473874 ATGGTACACTGGGAGAGGTCAGG + Intergenic
1095325056 12:40879723-40879745 ATGGTCCTCTGTGAGAAGACAGG + Intronic
1096685129 12:53283278-53283300 AGGGCCCTCTTGGAATGGACAGG + Intronic
1104963581 12:132499252-132499274 CTGGACCTCTGGGAGAGGCCAGG + Intronic
1104963605 12:132499336-132499358 CTGGACCTCTGGGAGAGGCCAGG + Intronic
1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG + Intergenic
1106666549 13:31857187-31857209 CAGGTCCTCATGGAGAAGACAGG - Intergenic
1109443951 13:62408324-62408346 AGGGTCCTCTTGTAAAGGAAGGG - Intergenic
1109460053 13:62644686-62644708 TTGGTCCTTTTGGAGATGACTGG - Intergenic
1112414435 13:99192514-99192536 ATGGTCCACCTGCAGAGGGCAGG - Intergenic
1112484526 13:99808387-99808409 AGGATCCTCTTGTAGAGGAACGG + Intronic
1116295113 14:43097759-43097781 ATGGTGATCTTGGAGAAGACAGG - Intergenic
1119981498 14:79086822-79086844 ATGTTCTTCATGGAGATGACAGG + Intronic
1120419671 14:84268012-84268034 ATGTTCCTCTTTGAAAGGATGGG - Intergenic
1121027647 14:90628342-90628364 AAGGTCCTCTAGGAGAGGAAGGG - Intronic
1124023319 15:25943251-25943273 ATGGGCTTCTGGGAGAGGAACGG + Intergenic
1124654139 15:31495024-31495046 ATGGACGTCTTGGGGAGGTCTGG + Intronic
1125715802 15:41819346-41819368 TTGGTACTCTTGGCAAGGACGGG - Exonic
1129151732 15:73693163-73693185 AAGGTCCTCAGGGAGAGGACAGG - Intronic
1133056414 16:3147595-3147617 CTTGACCTCTAGGAGAGGACAGG - Intronic
1133091128 16:3404450-3404472 AAGGTGCTCTTGGAGAAAACTGG + Exonic
1133237624 16:4394906-4394928 AGGGTCTTCCTGCAGAGGACAGG + Intronic
1135304214 16:21354840-21354862 AAGGGCCTCTGGGACAGGACGGG - Intergenic
1136300955 16:29333977-29333999 AAGGGCCTCTGGGACAGGACGGG - Intergenic
1136749454 16:32620084-32620106 ATTAACCTCTTTGAGAGGACAGG - Intergenic
1137274872 16:46926787-46926809 CTGGTCCTCTAGGAGCGGAAGGG + Intronic
1138616499 16:58171652-58171674 AAGGTCCTATTGGACAGGGCTGG - Intronic
1140976675 16:80066471-80066493 ATGGCCCTATTGGACAGCACAGG + Intergenic
1141117135 16:81318794-81318816 ATGGTCAGCTCAGAGAGGACTGG + Intronic
1142122552 16:88394022-88394044 CTGCTCCTCTTGGACAGCACAGG - Intergenic
1142122582 16:88394222-88394244 CTGCTCCTCTTGGACAGCACAGG - Intergenic
1203051585 16_KI270728v1_random:879294-879316 ATTAACCTCTTTGAGAGGACAGG - Intergenic
1146471942 17:33131709-33131731 ATGGTCCTCTTGGAGAGGACAGG - Intronic
1155322636 18:24633669-24633691 CTGGTCCTCTTGGAGAATATCGG - Intergenic
1155370063 18:25089440-25089462 AATGTCCTCATGGGGAGGACTGG - Intronic
1156998499 18:43496991-43497013 ATGGGCCTTTTGGACAGGAATGG - Intergenic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1159296725 18:66500119-66500141 CTGCTCCTCTGGGAGAGGATAGG - Intergenic
1165147147 19:33738181-33738203 ATCGGCCTCTGTGAGAGGACAGG + Intronic
1165991005 19:39813727-39813749 AATGTCCTATTGCAGAGGACAGG + Intergenic
926220776 2:10934310-10934332 ATGCTCTGCTTGGAGAGGGCAGG + Intergenic
927300346 2:21505104-21505126 ATGGTCCTTTTGGAGACTCCTGG - Intergenic
927554298 2:24021631-24021653 ATGGGCCTGTGGGACAGGACAGG - Exonic
927687113 2:25178803-25178825 ATGGTCCTTTTGTGGGGGACAGG + Intergenic
929541494 2:42826619-42826641 ATGTTCCACGTAGAGAGGACTGG - Intergenic
930012223 2:46946056-46946078 CTGGCACTCTTGGAGAGGCCGGG + Intronic
931791702 2:65669375-65669397 CTGGGCCTGATGGAGAGGACTGG + Intergenic
934032630 2:88061994-88062016 ATTGACCTATTGGAGATGACTGG - Intergenic
935438443 2:103062442-103062464 AAGGTCTACTTGGAGAGGACTGG + Intergenic
943656536 2:190514608-190514630 ATGGGCCCCTTGCAGACGACAGG - Exonic
1169265919 20:4167380-4167402 AAGGTCATCTCGGAGAGGGCGGG - Intronic
1169493344 20:6090033-6090055 GTGTTCCTCTTGGAGAAGAGAGG + Intronic
1169652226 20:7882304-7882326 ATGCTCCTCATGCAGTGGACAGG + Intergenic
1169852921 20:10072473-10072495 CTGGAGCTCTTGGAGAGGACAGG - Intergenic
1170729525 20:18961126-18961148 ATGGCCCCCATGGTGAGGACTGG - Intergenic
1174545822 20:51324431-51324453 ATGGTCCTCTAGGAGAGCCGAGG + Intergenic
1175341824 20:58236807-58236829 GAGGTCCGCTTGGAGAGAACTGG + Intergenic
1179905478 21:44420542-44420564 ATGGTCCACTTACAGAGGAGGGG + Intronic
1181419337 22:22786912-22786934 ATAGTCCTCTTGGGGAGGAGGGG - Intronic
1181796104 22:25312251-25312273 AAAGTCCTCTGGGAGAGGAGGGG + Intergenic
1181836648 22:25615861-25615883 AAAGTCCTCTGGGAGAGGAGGGG + Intronic
1185320276 22:50197497-50197519 ATGGCCCTCTTGAAGGTGACGGG - Exonic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
952867778 3:37866405-37866427 ATATTCCTCTGGGAGAAGACTGG + Intronic
954780564 3:53056478-53056500 ATGGCCCTTTTGGAGAAGCCAGG + Intronic
960342809 3:116496597-116496619 ATGGCTCTCATGGAGAGGAACGG + Intronic
960374903 3:116888205-116888227 ATGGGCCTCTGGTAGAAGACTGG + Intronic
962022867 3:131518346-131518368 AAAGTCCTCATGGAGGGGACAGG - Intergenic
964415128 3:156439500-156439522 AAGGTCCGCTTGGCAAGGACAGG - Intronic
965681835 3:171259813-171259835 ATGGATCTCTTGAAGAGCACTGG - Intronic
968900869 4:3431101-3431123 TTGGCCCTCTTGGAAAGGAGGGG + Intronic
974938495 4:68436195-68436217 AAGATCCTCTTGCAGAGTACTGG - Intergenic
980977250 4:139623234-139623256 AGGGTCCTCTATGAGTGGACTGG + Intergenic
987476186 5:18394672-18394694 ATGGTCTTCTTGATGGGGACCGG - Intergenic
987675694 5:21070245-21070267 GTGGTCCTCTTGGACAAGAGGGG - Intergenic
988179633 5:27773125-27773147 CTGGTCCTCCTGGAGAGTGCAGG - Intergenic
989665446 5:43848452-43848474 ATGATCCACTTGGAGAGGCAGGG + Intergenic
991429354 5:66528209-66528231 ATGGTCCTCTGGGAGAGATGGGG + Intergenic
991976323 5:72186804-72186826 AGGTTCCTCTTTGAGAGCACTGG + Intronic
994493922 5:100486184-100486206 ATGGTACTTTTGGAAAGGGCAGG + Intergenic
1002189478 5:177471280-177471302 CTGGTCCTCTTGGAAAGAAAAGG - Intronic
1007703892 6:43779859-43779881 CTGGTTCTCTTGAAGGGGACAGG + Intronic
1007915679 6:45559489-45559511 ATGGTCATTTTGTAGAGGATGGG + Intronic
1010155705 6:72789883-72789905 AAGGACCTCTTGGATAGGAGTGG + Intronic
1010409400 6:75543986-75544008 ATGGACCTCTTGGGGAGAAAGGG + Intergenic
1014124049 6:117757773-117757795 ATGGCTCTCATGGAGAGGAAAGG + Intergenic
1016530639 6:145054953-145054975 AGGGTCCTCTAGTAGAGGAAAGG + Intergenic
1016536206 6:145109553-145109575 GTGGTCATCTTGGACTGGACTGG + Intergenic
1018385784 6:163301685-163301707 ACTGTCCTCTGGGAGAGGACAGG - Intronic
1019545476 7:1572826-1572848 AGGGTTTTCTTTGAGAGGACAGG - Intergenic
1019775785 7:2911392-2911414 ATGGTCCTATTGGTGGGGAATGG - Intronic
1019960238 7:4452979-4453001 ATGGTACTGTCAGAGAGGACTGG - Intergenic
1026863780 7:73810589-73810611 AGGGGGCTCTTGGAGAGGAATGG - Intronic
1028954042 7:96668838-96668860 ATGGTCCTACTGGAGTAGACGGG + Intronic
1032542026 7:132711126-132711148 ATTGTCCTCTTGGAGAAGCTTGG - Intronic
1034351884 7:150421453-150421475 ATGGTCCTGTTAGAGATGAAAGG + Intergenic
1041271303 8:56111779-56111801 ATTGTCATCTTGGAGAGAAAGGG - Intergenic
1044930935 8:97251201-97251223 ATGGAGCCATTGGAGAGGACGGG - Intergenic
1049625156 8:143616599-143616621 CTGGACTTCCTGGAGAGGACTGG - Exonic
1049767277 8:144360702-144360724 GTGGTCCTCGTGGTGAGCACAGG + Exonic
1049949617 9:631400-631422 ATGGTCCTCAAGGAGATGAAAGG - Intronic
1052896323 9:33750906-33750928 AGGCTCCTCTAGGGGAGGACGGG + Intronic
1053259147 9:36646627-36646649 AAGGTCCCCTAGCAGAGGACTGG - Intronic
1055552912 9:77447521-77447543 ATGGTATTATTAGAGAGGACAGG + Intronic
1060283116 9:122227176-122227198 AAGGGCCTATTGGAGAGGAAGGG + Intronic
1061935244 9:133853800-133853822 GTGCTCCTCATGGTGAGGACAGG - Intronic
1062148763 9:135006756-135006778 GTGCTCCACTTTGAGAGGACAGG + Intergenic
1185591385 X:1279738-1279760 AGGTTCCTCTTGCAGAGGAACGG + Intronic
1186443379 X:9604917-9604939 ATGATCCTCTGGGAGAGGCTTGG + Intronic
1189865598 X:45323820-45323842 ATGGTCCACTTGTAGAAGAGTGG - Intergenic
1190958499 X:55220939-55220961 ATGGACCTCATGGAAAGGAATGG + Intronic
1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG + Intronic
1191976398 X:66876700-66876722 ATTGTTCTCTTGGAGAAGCCTGG - Intergenic
1199894198 X:152116278-152116300 CAGGTCCTCTTGGGAAGGACAGG + Intergenic