ID: 1146474852

View in Genome Browser
Species Human (GRCh38)
Location 17:33154495-33154517
Sequence AATACCTGCTTCACCAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146474852_1146474854 -6 Left 1146474852 17:33154495-33154517 CCAATCTTGGTGAAGCAGGTATT 0: 1
1: 0
2: 3
3: 37
4: 174
Right 1146474854 17:33154512-33154534 GGTATTAGCCCTAGGAAATTAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1146474852_1146474857 24 Left 1146474852 17:33154495-33154517 CCAATCTTGGTGAAGCAGGTATT 0: 1
1: 0
2: 3
3: 37
4: 174
Right 1146474857 17:33154542-33154564 GAAGTTAAGAAACTTTTCCCAGG 0: 1
1: 1
2: 18
3: 153
4: 970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146474852 Original CRISPR AATACCTGCTTCACCAAGAT TGG (reversed) Intronic