ID: 1146474852

View in Genome Browser
Species Human (GRCh38)
Location 17:33154495-33154517
Sequence AATACCTGCTTCACCAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146474852_1146474857 24 Left 1146474852 17:33154495-33154517 CCAATCTTGGTGAAGCAGGTATT 0: 1
1: 0
2: 3
3: 37
4: 174
Right 1146474857 17:33154542-33154564 GAAGTTAAGAAACTTTTCCCAGG 0: 1
1: 1
2: 18
3: 153
4: 970
1146474852_1146474854 -6 Left 1146474852 17:33154495-33154517 CCAATCTTGGTGAAGCAGGTATT 0: 1
1: 0
2: 3
3: 37
4: 174
Right 1146474854 17:33154512-33154534 GGTATTAGCCCTAGGAAATTAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146474852 Original CRISPR AATACCTGCTTCACCAAGAT TGG (reversed) Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910198329 1:84669371-84669393 TATACTTTCTTAACCAAGATTGG + Intronic
911177645 1:94833144-94833166 AAAACCTGTTTCAGCAAGCTGGG - Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
911938961 1:104018326-104018348 TATACCTGTTTCTCCAGGATTGG + Intergenic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920564438 1:206962168-206962190 AGAACGTGCTTCACCAAGCTTGG + Intronic
920664135 1:207947885-207947907 TATTCCTACTTCACCAAGCTAGG - Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922273194 1:224053260-224053282 AACACCTGCTACTCAAAGATGGG + Intergenic
922667880 1:227488231-227488253 AAGACCAGCTTCACCAACAAGGG - Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1065570530 10:27067392-27067414 AATACCTGGTCATCCAAGATGGG + Intronic
1066524901 10:36266991-36267013 AATCCCTGCCTCAGCAGGATGGG - Intergenic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068635441 10:59343220-59343242 AACACCTGCTTCATTATGATAGG - Intronic
1068684762 10:59858719-59858741 CATACCTGGTTCAAGAAGATGGG + Intronic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1072423559 10:95309984-95310006 AATACCTGCATCATCAATAGAGG + Intergenic
1073764005 10:106662216-106662238 TTTACCTGCTTCTCCATGATGGG - Intronic
1078249951 11:9608630-9608652 AATGTCTGAGTCACCAAGATAGG - Intergenic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080166192 11:29240746-29240768 ACTACCTGCTTCATAAAGAAAGG - Intergenic
1080465846 11:32496202-32496224 AATTCCTCCTTCAACAAAATGGG + Intergenic
1081001754 11:37682418-37682440 ATATCCTGCTTCACTAAGATAGG - Intergenic
1081399514 11:42626510-42626532 AATACCTCTGTCACCAACATTGG + Intergenic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1083625534 11:64070209-64070231 AATCCCTGCTGCACCAAGTGGGG + Intronic
1089980938 11:122771972-122771994 AACTGCAGCTTCACCAAGATAGG + Intronic
1090709372 11:129372322-129372344 AAAACCTACTTCACAAGGATGGG - Intergenic
1093651057 12:21646117-21646139 AACACCAGATTCACCAGGATGGG + Intronic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1105227557 13:18450544-18450566 AATATCAGCTTCTCCAAGATAGG + Intergenic
1106855795 13:33851235-33851257 ATTTCCTGCTTTACAAAGATTGG + Intronic
1107499545 13:40958999-40959021 AATAGCTGGATCACCAAGCTGGG + Exonic
1108142468 13:47438959-47438981 AATACCTGCTTCAGCATCCTGGG - Intergenic
1109531780 13:63659247-63659269 AGTACCTGCTTCTCCAAGGGAGG + Intergenic
1112992695 13:105533594-105533616 ACTACCTGCTTCTCCAAATTCGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118719679 14:68585306-68585328 AATTCCTGCTTCACCATGGCAGG + Intronic
1118987155 14:70766297-70766319 AATTCCTGCTTCTACAAAATGGG + Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1127789459 15:62386566-62386588 AAGACCAGCTTCACCAACATAGG - Intergenic
1129053517 15:72802566-72802588 AATACCTTCTCAACCAAGGTTGG + Intergenic
1130091572 15:80825441-80825463 AATGCCTGCTTCACCGAGGGTGG - Intronic
1130680611 15:85993046-85993068 AATGCTTACTTCAACAAGATGGG + Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131656470 15:94465221-94465243 AATACCTTGTTGACCAATATTGG + Intronic
1134059868 16:11192755-11192777 CACACCAGCTTCACCAAGAGGGG + Intergenic
1134512111 16:14856870-14856892 AAGACGTGGTTCACCAAAATGGG + Intronic
1134699746 16:16255371-16255393 AAGACGTGGTTCACCAAAATGGG + Intronic
1134972079 16:18539294-18539316 AAGACGTGGTTCACCAAAATGGG - Intronic
1136049199 16:27638575-27638597 AAAAGCTGCTCCACCAAGAGAGG + Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1146474852 17:33154495-33154517 AATACCTGCTTCACCAAGATTGG - Intronic
1147236336 17:39060303-39060325 ATTACTTCCTTCGCCAAGATGGG - Intergenic
1147691616 17:42319039-42319061 AAGACCAGCCTCACCAACATGGG + Intronic
1148190651 17:45676575-45676597 CACACCTGCTTCTCCAAGGTGGG + Intergenic
1148455621 17:47809543-47809565 ATGACCTGCTTCAGCAAGACAGG - Intronic
1149092687 17:52803507-52803529 AATCTCTGTTTCACCAATATTGG + Intergenic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1149867163 17:60157344-60157366 CATCCCAGCTTCACCCAGATGGG - Intronic
1151253509 17:72856466-72856488 AATACCTGCTACTCCCAGCTAGG - Intronic
1152707986 17:81855160-81855182 AATACCAGCTCGACAAAGATGGG - Exonic
1154525821 18:15288933-15288955 AATATCAGCTTCTCCAAGATAGG - Intergenic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1157640910 18:49213513-49213535 AAGACCAGCTTGACCAATATGGG - Intronic
1158755749 18:60322440-60322462 AAGACCTGCTGCACCAATGTAGG + Intergenic
1158786200 18:60714213-60714235 AATACCTGTTTCAGAAAGAATGG + Intergenic
1158947776 18:62462561-62462583 AATACGTGCTTAACAAATATCGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160834888 19:1119971-1119993 AATGCCGGCTCCACCAAGATGGG - Exonic
1164061101 19:21674898-21674920 AATATCAGCTTCCCCAAGATAGG - Intergenic
1164417587 19:28059524-28059546 AATACCTGGTTGTCCTAGATGGG + Intergenic
1166863482 19:45822782-45822804 AAGACTTCCTTCACCACGATGGG + Exonic
1167840439 19:52113215-52113237 CAAATCTGCTTCTCCAAGATTGG - Exonic
1167844711 19:52152510-52152532 CAAGCCTGCTTCTCCAAGATTGG - Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
931484292 2:62674667-62674689 AATATCTGCTTTAGCAATATTGG - Intronic
933051579 2:77609394-77609416 ACTTACTGCTTCCCCAAGATGGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
934138053 2:89017084-89017106 AATACCTGCATAACCATGACTGG - Intergenic
934231191 2:90183542-90183564 AATACCTGCATAACCATGACTGG + Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
938524927 2:132120296-132120318 AATATCAGCTTCTCCAAGATAGG - Intergenic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
943938171 2:193953110-193953132 AATAAATGCTTCAGCAAGCTTGG - Intergenic
944133102 2:196368947-196368969 AATACCTGCCTCTCCAGGATTGG + Intronic
945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG + Intronic
945965028 2:216177740-216177762 AATACATGCTTGACAAAAATGGG - Intronic
1170263240 20:14435904-14435926 AAGACCAGCCTCACCAACATGGG - Intronic
1170581282 20:17701339-17701361 AACACCTGCTTCACAGAGGTCGG - Intronic
1172727911 20:37060820-37060842 AATTCCAGCTTGGCCAAGATAGG - Intronic
1174735387 20:52961006-52961028 AAGACCAGCTTGACCAATATGGG + Intergenic
1175694980 20:61095740-61095762 GAAAACTGCTTCACAAAGATAGG + Intergenic
1176771602 21:13079554-13079576 AATATCAGCTTCTCCAAGATAGG + Intergenic
1177038228 21:16071732-16071754 AATACATGCTTCTCCAAGTTGGG + Intergenic
1177844659 21:26274956-26274978 AATATCTGCTTTACCAATTTAGG - Intergenic
1178218389 21:30626584-30626606 AATATCTGCCACAGCAAGATGGG - Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1180518733 22:16174002-16174024 AATGTCAGCTTCTCCAAGATAGG + Intergenic
1180908733 22:19433218-19433240 AATATCTGCTTCTCCAGGCTAGG - Intronic
1184603380 22:45557096-45557118 TCTACCTGCTTCACGACGATGGG + Intronic
950126463 3:10512860-10512882 AATCCCTGCTTTACCGTGATGGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
954120684 3:48497460-48497482 AAGACCTGCCTGGCCAAGATGGG - Intronic
955378726 3:58419656-58419678 AATCCCTCCTTCTCCAAGGTGGG - Intronic
955496191 3:59535215-59535237 AATACCTGTTTCAGAAAGAGAGG - Intergenic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964106867 3:153048947-153048969 AATACATATTTCACCCAGATGGG + Intergenic
966957675 3:184900326-184900348 TATACCAGCTTCACAAAAATGGG + Intronic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
968748579 4:2374019-2374041 ACTGCCTGATCCACCAAGATGGG + Intronic
969608417 4:8213696-8213718 AAGACCAGCTTCAGCAACATAGG + Intronic
970762620 4:19509504-19509526 AAGACCAGCTTAGCCAAGATGGG - Intergenic
974670972 4:65029681-65029703 CATGCATGCTTCACCAAGAAAGG + Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982484971 4:155955529-155955551 AATACCAGCTTCAACAGGGTGGG - Intergenic
983106422 4:163691949-163691971 AATAGCTGCTTGACAGAGATGGG + Intronic
986207602 5:5640093-5640115 AATAGCTGCTTGACCAACATAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987610381 5:20195988-20196010 AATACCTGCTTTACCACTGTGGG + Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
992024640 5:72658284-72658306 ATTACCTGCTCCTCCAAGGTGGG + Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996161780 5:120174849-120174871 TATATCTGCTTCTCCAGGATTGG - Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998846493 5:146315466-146315488 AGTACCTGCTTCACAGGGATAGG - Intronic
1000013512 5:157256656-157256678 AATACCTCATTCAGCAAGACAGG + Intergenic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1003836972 6:10081783-10081805 AATGCCTACATCACCAAGAATGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004862685 6:19821686-19821708 AAGACCAGCCTCACCAACATGGG + Intergenic
1006867059 6:37217092-37217114 AATACCAGCCTGACCAACATGGG + Intronic
1006979535 6:38135890-38135912 AATACCTGCTCCACAGAGAAGGG - Intronic
1007837397 6:44684249-44684271 ACTACCTGCAACACCAAGACAGG - Intergenic
1009947575 6:70357440-70357462 AAAATGTGCTTCTCCAAGATTGG + Intergenic
1010642688 6:78348875-78348897 AATACATGCTTTACAAAGATGGG - Intergenic
1011322689 6:86114924-86114946 CATACCTGTTTCTCCAGGATTGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013568973 6:111401258-111401280 AATACAACCTTCACAAAGATGGG + Intronic
1015558496 6:134488045-134488067 GATACCTGTTTCTGCAAGATAGG - Intergenic
1016030306 6:139330437-139330459 CATACCTGCTTGACTCAGATTGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018980913 6:168601196-168601218 AATGCCTGTTTCACCAAGATCGG + Intronic
1024062970 7:45712850-45712872 AATTTCTGCTTCACAAAGTTAGG - Intronic
1026236510 7:68531877-68531899 AATATCTGCCTCACCAAAATAGG - Intergenic
1026456653 7:70578510-70578532 AATAATTACTTCAGCAAGATGGG - Intronic
1027642498 7:80754584-80754606 AATACTTGCTTAACTAAGTTAGG + Intronic
1029814220 7:103076633-103076655 AAGACCAGCTTGACCAACATGGG + Intronic
1031888466 7:127265557-127265579 ACTACCTGGTCAACCAAGATTGG - Intergenic
1033882320 7:145901518-145901540 AATATCTGTTTCTCCAGGATTGG + Intergenic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1041450056 8:57995971-57995993 AATACCTTCTTCACCAACAAAGG - Intronic
1041530055 8:58855599-58855621 AATAGCTGCTTAACTAAAATTGG + Intronic
1041956655 8:63563783-63563805 AATACCTCCTTCAGCTAAATTGG - Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043538743 8:81235160-81235182 ATTCCTTCCTTCACCAAGATGGG - Intergenic
1044455579 8:92389099-92389121 AATACCTGCCTCAAAGAGATGGG + Intergenic
1044940290 8:97335191-97335213 AATAACTCCTTCACCTAGCTGGG + Intergenic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046474236 8:114719680-114719702 AATACCTGTTTCAAGAAGAGTGG - Intergenic
1046514177 8:115237217-115237239 AAGACCAGCCTGACCAAGATGGG - Intergenic
1047841314 8:128755826-128755848 AATTCCTGTTTCTCCAAGATTGG - Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050754855 9:8990071-8990093 AATACCTTCTTCACAAATAATGG - Intronic
1052063471 9:23988173-23988195 CATATCTGTTTCTCCAAGATTGG - Intergenic
1052781016 9:32782668-32782690 AATGCCTGCTTCAGCAAGGGAGG + Intergenic
1053009242 9:34624005-34624027 AGCACCTGCTTCGCCATGATGGG + Exonic
1053703668 9:40727901-40727923 AATATCAGCTTCTCCAAGATAGG - Intergenic
1054413728 9:64851365-64851387 AATATCAGCTTCTCCAAGATAGG - Intergenic
1055785848 9:79867969-79867991 GATTCCCGCTTCACCAAGAGAGG + Intergenic
1056007424 9:82286831-82286853 CATATCTGTTTCTCCAAGATTGG - Intergenic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058232647 9:102447991-102448013 TATCTCTGTTTCACCAAGATTGG - Intergenic
1059480453 9:114585338-114585360 AAGACCAGCTTGGCCAAGATGGG + Intergenic
1185484679 X:473426-473448 AAGACCAGCCTCACCAACATGGG - Intergenic
1186063535 X:5737498-5737520 AATCCCTGCTTCACCTTTATGGG - Intergenic
1186195562 X:7107865-7107887 AATATCTGCTCCTCCCAGATAGG + Intronic
1186714527 X:12236673-12236695 AATACCTGATAAAACAAGATAGG + Intronic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188565044 X:31517378-31517400 AATACCTACTGCATGAAGATGGG + Intronic
1189415171 X:40806377-40806399 AATGCCAACTTCACCAAGAATGG + Intergenic
1193489553 X:82132634-82132656 AATCTCTGTTTCTCCAAGATTGG - Intergenic
1194348420 X:92794644-92794666 CATACCTCCTTCTTCAAGATTGG - Intergenic
1196107504 X:111912411-111912433 AAGACCTGCTGGACCAAGCTCGG - Exonic
1197470139 X:126856773-126856795 TATCTCTGCTTCTCCAAGATTGG - Intergenic
1197958984 X:131983304-131983326 AATACCTGTTACACCAAAAGAGG - Intergenic
1198184511 X:134240275-134240297 AAAAACTGCTCCACCAAAATAGG - Intronic
1199173734 X:144759857-144759879 TATACCTGTTTCTCTAAGATTGG - Intergenic
1200656749 Y:5911272-5911294 CATACCTCCTTCTTCAAGATTGG - Intergenic
1201533268 Y:15015981-15016003 AATCCCTGCTTCACCTTTATGGG + Intergenic
1201589604 Y:15600545-15600567 AGCAGCTGCTTCACCAGGATAGG - Intergenic