ID: 1146475897

View in Genome Browser
Species Human (GRCh38)
Location 17:33162556-33162578
Sequence ATCAGGGCTCAGCCTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146475897_1146475906 24 Left 1146475897 17:33162556-33162578 CCAGCTGTAGGCTGAGCCCTGAT 0: 1
1: 0
2: 0
3: 15
4: 203
Right 1146475906 17:33162603-33162625 TCCTCCAGCCACTTCTCCTCAGG 0: 1
1: 0
2: 2
3: 49
4: 441
1146475897_1146475908 25 Left 1146475897 17:33162556-33162578 CCAGCTGTAGGCTGAGCCCTGAT 0: 1
1: 0
2: 0
3: 15
4: 203
Right 1146475908 17:33162604-33162626 CCTCCAGCCACTTCTCCTCAGGG 0: 1
1: 0
2: 3
3: 53
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146475897 Original CRISPR ATCAGGGCTCAGCCTACAGC TGG (reversed) Intronic
900130464 1:1085114-1085136 CTCAGGGCCCAGCCTCCAGTCGG - Intronic
900313755 1:2047255-2047277 AACAGGGCCCAGCCCTCAGCCGG + Intergenic
900698904 1:4031918-4031940 ATCAGGCTTCAGCCTGCTGCTGG + Intergenic
900940493 1:5795549-5795571 ATCAGGGCTCAGTCACCACCAGG + Intergenic
900940590 1:5796126-5796148 ATCAGGGCTCAGTCACCACCAGG + Intergenic
901139678 1:7020602-7020624 ATGAGCCCTCAGCCTACAGTAGG - Intronic
904702689 1:32367249-32367271 ACCAGGGCTTAGCCGACAGCAGG - Intronic
905284814 1:36872352-36872374 CTCAGGGCTCATCCGACTGCAGG - Exonic
906104955 1:43286077-43286099 ATGGGGGCTCAGCCTTCATCTGG + Intergenic
906259747 1:44378013-44378035 CTGAGGGCTCAGCTTGCAGCAGG - Intergenic
907581267 1:55574778-55574800 GCCAGGGCCCAGCCTGCAGCAGG + Intergenic
909486926 1:76184723-76184745 ATCGGGGCTCACTCTACAGAGGG + Intronic
911229011 1:95340155-95340177 AACAGAGCTCAGACTATAGCAGG - Intergenic
913069275 1:115284776-115284798 TCCAGGGTTCAGCCTGCAGCAGG - Intergenic
913537495 1:119786980-119787002 ATCAGGGGTCTCCCTACAGTTGG + Intergenic
914461809 1:147891788-147891810 CTGGGGGCTCAGCCTGCAGCTGG + Intergenic
917237735 1:172912869-172912891 ATCCATGCTCAGCCTGCAGCTGG + Intergenic
919156322 1:193770441-193770463 AACAGGGTTCATGCTACAGCAGG - Intergenic
919893851 1:201996150-201996172 GGCAGGGCTCAGCCCACACCCGG - Exonic
920375542 1:205505928-205505950 CACAGGGCCCAGGCTACAGCTGG - Intronic
921169467 1:212533642-212533664 ATCAGGTCTCTGCCTAAAGGTGG - Intergenic
921319244 1:213921987-213922009 ATCAGGGTCTAGCATACAGCAGG + Intergenic
1062860032 10:803712-803734 AGCAGGGCTGAGCCTGCAGAGGG - Intergenic
1063425533 10:5947307-5947329 ATCAGTGCTCTCCCTTCAGCTGG + Intronic
1065385010 10:25125674-25125696 ACAAGGGCCCAGCCTCCAGCAGG - Intergenic
1066549429 10:36539182-36539204 ATGTGGCCTCAGCCTTCAGCAGG - Intergenic
1067958792 10:50824127-50824149 TTCAGGGCACAGTCTGCAGCTGG - Intronic
1069822276 10:71235349-71235371 TTCAGGGCTCTGGCTACAGTGGG - Intronic
1074943835 10:118261250-118261272 ATCAGTGCTCTTTCTACAGCAGG + Intergenic
1076787959 10:132760420-132760442 ATGAGGGCTCTGCTCACAGCGGG - Intronic
1076843401 10:133057456-133057478 ATCAAGGCACAGCCCACAGGTGG - Intergenic
1076961361 10:133764630-133764652 ATCTAGGCTCTGCCTACAGGGGG - Intergenic
1077651047 11:3973050-3973072 ATCAGGGCAGTGGCTACAGCAGG - Intronic
1080646792 11:34193448-34193470 ATCAGGTCTCAGCAGCCAGCTGG + Intronic
1081888833 11:46523098-46523120 ATGAGGGCAGAGACTACAGCTGG + Intronic
1083764235 11:64834424-64834446 CTCACCGCTCAGCCTGCAGCTGG + Exonic
1084957273 11:72698013-72698035 AGCTGGCCTGAGCCTACAGCGGG - Exonic
1084975421 11:72794606-72794628 CTCAGGGCTCAGCTGTCAGCTGG + Intergenic
1085386604 11:76161460-76161482 GCCTGGGCTCAGCCTCCAGCAGG + Intergenic
1086458761 11:86985000-86985022 ATCTGGGCTCAACCTGCACCTGG + Intergenic
1086818621 11:91406236-91406258 ATCCATGCTCAGCCTGCAGCTGG + Intergenic
1087191366 11:95258027-95258049 CTCCTGTCTCAGCCTACAGCTGG + Intergenic
1087375223 11:97331461-97331483 ATCAGGGCTCAGTCTGAAGCTGG - Intergenic
1087766346 11:102159281-102159303 CGCAGTGCTCAGCCTGCAGCAGG + Intronic
1089216415 11:116837188-116837210 CTCAGATCTCAGCCCACAGCTGG - Intronic
1089589858 11:119533361-119533383 AACAGGGCTGAGCCCACAGCAGG + Intergenic
1091091429 11:132774797-132774819 ATCAGGGCTGTGCATACAGTAGG + Intronic
1092580700 12:9837951-9837973 CTCAGGGCTCACCCTGAAGCAGG - Intronic
1093870396 12:24284299-24284321 TCCAGGGATCAGCCTACACCAGG - Intergenic
1096355411 12:50937301-50937323 ATCTGTACTCAGCCTGCAGCTGG + Intergenic
1096547177 12:52348132-52348154 ATCAGGTCTCAGCCTCCACCCGG - Intergenic
1096573446 12:52538217-52538239 CTCTGGGCCCAGCCTCCAGCAGG - Intergenic
1100288177 12:93187536-93187558 ATCAGGGCCCATCCTGGAGCTGG + Intergenic
1101325381 12:103710971-103710993 ATCAGGGCTTTGCACACAGCAGG - Intronic
1101827141 12:108229210-108229232 ATCAGGGCTTAGCACACAGTAGG - Intronic
1102571366 12:113828870-113828892 CTCAGGGCTCTGTGTACAGCAGG + Intronic
1106394995 13:29371142-29371164 ATCAGTGCTCAGAATACATCAGG - Intronic
1109116725 13:58398154-58398176 ATCCAGGCTCAGCCTCCAGCTGG + Intergenic
1109287902 13:60433659-60433681 AACAGGGCTCAGCCTGCATGTGG - Intronic
1113299516 13:109002216-109002238 CCCAGGGCTCTGCCTTCAGCTGG + Intronic
1113354580 13:109566372-109566394 CTCAGAGCACAGCCTAGAGCAGG - Intergenic
1113942544 13:114025860-114025882 CCCGGGGCTCAGCCTCCAGCTGG + Intronic
1120229323 14:81825759-81825781 ATGAGGGCTCAGCCTATATGGGG + Intergenic
1121217655 14:92261044-92261066 ATCAGGGCTCAGCCACCCACCGG - Intergenic
1122793923 14:104196266-104196288 TTCAGGGCTCAGACTTCACCAGG + Intergenic
1122812625 14:104296521-104296543 TTCAGGCCCCAGGCTACAGCTGG - Intergenic
1122983129 14:105200465-105200487 ATCAGGGCTCAGCAGCCTGCTGG - Intergenic
1123056054 14:105571392-105571414 GGCAGAGCTCAGCCTGCAGCTGG + Intergenic
1123056617 14:105573980-105574002 GGCAGAGCTCAGCCTGCAGCTGG + Intergenic
1123057329 14:105577551-105577573 GGCAGAGCTCAGCCTGCAGCTGG - Intergenic
1123080485 14:105691523-105691545 GGCAGAGCTCAGCCTGCAGCTGG + Intergenic
1123081592 14:105697805-105697827 GGCAGAGCTCAGCCTGCAGCTGG - Intergenic
1202868812 14_GL000225v1_random:140560-140582 GTCTGGGCTCTGCCTACAGGGGG + Intergenic
1202868962 14_GL000225v1_random:141857-141879 GTCAAGGCTCTGCCTACAGGGGG + Intergenic
1124112075 15:26799751-26799773 GTCAGTGCTCAGCCTCCATCAGG + Intronic
1124179601 15:27460309-27460331 ACCATGGCTCAGCCTCCAGCAGG - Intronic
1127658574 15:61078723-61078745 ACCAGGGCACAGCCTACACAGGG + Intronic
1128695532 15:69759264-69759286 ATGTGGGCTGAGCCTACTGCCGG - Intergenic
1130044124 15:80430906-80430928 AACAGGGCCCAGCACACAGCAGG - Intronic
1130652669 15:85770945-85770967 CTCAAGGCTCAGCCAACAGGCGG + Intronic
1130750807 15:86710974-86710996 TTCAGGGCTCAACATATAGCAGG + Intronic
1130870789 15:87970389-87970411 GTGAGGGCTGAGCCTAGAGCTGG + Intronic
1135099564 16:19594249-19594271 ATCAGGGCTCATCTGTCAGCTGG - Intronic
1136012040 16:27370049-27370071 ATCAGAGATCAGCCTATAGCTGG - Intergenic
1136990847 16:35150680-35150702 ATCAGATCTCAGCCTCCAGGTGG + Intergenic
1138745373 16:59356981-59357003 AGCAGGGATCAGCTTTCAGCTGG + Intergenic
1138898836 16:61244160-61244182 CTCTGTGCTCAGCCTGCAGCAGG + Intergenic
1139236722 16:65347322-65347344 ATCAGGGATCAGCCTCGTGCTGG + Intergenic
1140771688 16:78211383-78211405 ATCAGTGCTCAGCACACAGTAGG - Intronic
1141195274 16:81855959-81855981 GTCAGGGCTCAGCCTGCAGGTGG - Intronic
1141805175 16:86337206-86337228 GTCTGGGGTCAGCCTGCAGCGGG - Intergenic
1142375445 16:89704613-89704635 ATGAGGTCCCAGCCGACAGCTGG + Intergenic
1142381150 16:89732926-89732948 ATGAGGGCGCAGGGTACAGCAGG - Intronic
1143304197 17:5933045-5933067 GTCATGTCTCAGCCTAAAGCTGG + Intronic
1144481139 17:15629976-15629998 GACTGGCCTCAGCCTACAGCTGG - Intronic
1144917170 17:18733761-18733783 GACTGGCCTCAGCCTACAGCTGG + Intronic
1146475897 17:33162556-33162578 ATCAGGGCTCAGCCTACAGCTGG - Intronic
1147627992 17:41912243-41912265 ATCAAGACTGAGCCTACTGCTGG + Intronic
1147935399 17:44007790-44007812 GTCAGGGCCCAGCCCAGAGCTGG - Intronic
1148129747 17:45255662-45255684 CTCAGAGCACAGCCTGCAGCGGG - Exonic
1148147568 17:45375711-45375733 AGCAGTGCCCAGTCTACAGCTGG - Intergenic
1148214519 17:45827180-45827202 CACAGTGCTCAGCATACAGCAGG + Intronic
1148248074 17:46048624-46048646 ATCTGTGCCCAGCCTACAGAAGG - Intronic
1148291377 17:46453257-46453279 TCCAGGGCTCTGGCTACAGCAGG + Intergenic
1148313564 17:46670960-46670982 TCCAGGGCTCTGGCTACAGCAGG + Intronic
1151440996 17:74129020-74129042 ATCAGGGCTGAGCCAAGAGACGG + Intergenic
1152305026 17:79515298-79515320 TGCAGTGCCCAGCCTACAGCTGG + Intronic
1152669848 17:81596708-81596730 TTCAGGGCTCAGCCCATGGCGGG - Intronic
1153665969 18:7367917-7367939 ATCAGGTCTCCGCCCTCAGCGGG - Intergenic
1158325361 18:56307966-56307988 ATGAGGCCTCAGCCTTCACCAGG - Intergenic
1158859241 18:61576083-61576105 AACAGCACTCAGCCCACAGCAGG + Intergenic
1161504542 19:4636731-4636753 ATCAGACCTCAGCCTAGAGGGGG - Intergenic
1161808041 19:6456376-6456398 AAGAGGGCACAGCCTTCAGCTGG + Intronic
1161988583 19:7670879-7670901 ATCATGTCTCAGCCCAGAGCTGG + Intergenic
1163433970 19:17284099-17284121 TTCAGGGCACAGCCTAGAACTGG + Exonic
1163575473 19:18108879-18108901 AGCAGGGCCCAGTGTACAGCAGG - Intronic
1164088896 19:21930393-21930415 ATCAGGACACAGCCTGCAGGTGG + Intergenic
1164127377 19:22330892-22330914 ATATGGACACAGCCTACAGCTGG - Intergenic
1164503474 19:28839122-28839144 GTCAGTGCTCAGACTCCAGCAGG - Intergenic
1164776077 19:30854779-30854801 ATAAGGGGTCAGCCTACCCCAGG - Intergenic
1165274235 19:34734240-34734262 GTCAGGCCTGAGGCTACAGCGGG - Intronic
1165921082 19:39298213-39298235 ATCCAGCCTCAGCCCACAGCAGG + Exonic
925006742 2:449155-449177 ATCATTTCACAGCCTACAGCTGG + Intergenic
927450970 2:23209288-23209310 CACAGGGCTCAGCCTAGAGCAGG + Intergenic
927856782 2:26532723-26532745 GTCAGGGCTAAGCCTAGACCAGG - Intronic
931856741 2:66309831-66309853 ATCATGGCTCAGTCTTCTGCAGG - Intergenic
932436417 2:71704833-71704855 CTCAGGGCCCAGCCCACAGCTGG + Intergenic
935411837 2:102772258-102772280 AACAGTGCTCAGTATACAGCAGG - Intronic
939084411 2:137700844-137700866 ATCAGGCCCCACCCTTCAGCAGG + Intergenic
939395103 2:141618844-141618866 GTCAAGGCTCAGCCTCCAGATGG - Intronic
939801503 2:146717136-146717158 ATTAGGACTCAGCCTACTCCAGG - Intergenic
940807887 2:158208389-158208411 ATCAGGCCTCAGCTTACAGTGGG - Intronic
948765810 2:240218115-240218137 AGCAGAGCTCATCCTACAGTAGG + Intergenic
1171148415 20:22805620-22805642 ATCAAGACTCAGCCTATATCGGG - Intergenic
1173596992 20:44264861-44264883 ATCAGGGCTTAGCACACAGTAGG + Intronic
1173642732 20:44615203-44615225 GGCAGGGCCCGGCCTACAGCAGG - Intronic
1174525095 20:51164264-51164286 ACCTGAGCTCAGCCTACAGCCGG + Intergenic
1175402940 20:58710986-58711008 GGCAGGGCCCAGCCTTCAGCGGG + Intronic
1175930637 20:62492263-62492285 CTCAGGCCTCCACCTACAGCAGG - Intergenic
1176000239 20:62828381-62828403 ATCAGGACACAGCCAACTGCTGG - Intronic
1178424568 21:32469093-32469115 AACAGGGCCCAGCATACAGCAGG - Intronic
1179454284 21:41488244-41488266 CCCAGGGCTCAGCCTGGAGCAGG + Intronic
1180184681 21:46133619-46133641 ACCAGGGCTCAGCCTATTCCGGG + Intergenic
1180184699 21:46133713-46133735 ACCAGGGCTCAGCCTATTCCGGG + Intergenic
1180184709 21:46133760-46133782 ACCAGGGCTCAGCCTATTCCGGG + Intergenic
1180184719 21:46133807-46133829 ACCAGGGCTCAGCCTATTCCGGG + Intergenic
1181920432 22:26316320-26316342 TTCAGTGCTAAGCCTACTGCTGG - Intronic
1181980315 22:26761436-26761458 ATCAGGACCCGGCCTACAGGAGG - Intergenic
1183164557 22:36137946-36137968 TTCAGGGCTCTGCCTGCACCTGG - Intergenic
1183170859 22:36187096-36187118 TTCAGGGCTCTGCCTGCACCTGG - Intergenic
1183183108 22:36274809-36274831 ATCACGGCTGAGCATGCAGCAGG + Intergenic
1184865388 22:47199266-47199288 ACCAGGAGTCAGACTACAGCGGG - Intergenic
949996312 3:9619979-9620001 ATCTGTGCTTAGCCTGCAGCTGG - Intergenic
950671917 3:14532385-14532407 AACAGGGCTCAGTCTACGGGAGG + Intronic
953197350 3:40746820-40746842 ATCAGGGCTCACTCTGGAGCTGG + Intergenic
957161070 3:76610387-76610409 CTCCGTGCTCAGCCCACAGCTGG + Intronic
958758216 3:98275245-98275267 ATCCGTGCTTAGCCTGCAGCTGG - Intergenic
959468552 3:106720740-106720762 ATCCGTGCTCAGCCTGCAGCTGG + Intergenic
960435345 3:117619754-117619776 ATCAGATATCATCCTACAGCTGG + Intergenic
961011599 3:123440160-123440182 ATCAGTGCTCAGCACACAGTAGG - Intronic
962529994 3:136270517-136270539 AGCAAGACTCTGCCTACAGCGGG - Intronic
965470686 3:169086936-169086958 ATCAGTGCCCAGCATATAGCTGG + Intronic
969391733 4:6895887-6895909 GTGGGGGCTCAGCCTGCAGCAGG - Intergenic
970634330 4:17990699-17990721 AGCAGGTCTCAGCCTTCTGCTGG + Intronic
971188333 4:24402577-24402599 GCCAGGGCTCAGCCCAGAGCTGG + Intergenic
974227062 4:59060277-59060299 ATCTGCACTCAGCCTGCAGCTGG + Intergenic
974552502 4:63396408-63396430 CTCTGTGCTCAGCCCACAGCTGG - Intergenic
975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG + Intergenic
979472364 4:121114493-121114515 ATCTGGGCTGAGACTAAAGCAGG + Intergenic
980615980 4:135226431-135226453 TTCAGGGCTTAGCCTCCAGTTGG + Intergenic
986667465 5:10115871-10115893 ATCAGCCCTCAGTCTCCAGCAGG + Intergenic
990059369 5:51628583-51628605 AGCAGGGCACAGCACACAGCAGG + Intergenic
991619701 5:68532911-68532933 ATCAGAGCACAACCTAAAGCAGG + Intergenic
992853680 5:80837947-80837969 AGCAGTCCCCAGCCTACAGCTGG - Intronic
995314608 5:110754217-110754239 ATCATGGCTATGGCTACAGCAGG - Intronic
996844412 5:127883695-127883717 ATTAGGCCACAGCCTCCAGCTGG - Intergenic
997397875 5:133579075-133579097 AGCAGGGCTCAGCCTAACACAGG + Intronic
999322104 5:150621887-150621909 ATCAGGCCTCAGCCAACACTAGG + Intronic
1000250339 5:159488691-159488713 ATCAGAGCTCAGCATCAAGCTGG - Intergenic
1003330504 6:5124738-5124760 AGCAGGGCTCAGACTGCAGTGGG + Intronic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1010764710 6:79765550-79765572 ATCTGAGCTCAGCCTTCAGTTGG - Intergenic
1019735855 7:2649451-2649473 ATCAGGGGTCAGCCCACACATGG - Intronic
1019750569 7:2726560-2726582 CCCAGAGCTCAGCCTACAGTCGG + Intronic
1024273832 7:47661367-47661389 TTCAGGGATCAGCTCACAGCAGG + Exonic
1025744506 7:64231060-64231082 AACAGGGCTCAGCACACAGATGG - Intronic
1025751674 7:64299278-64299300 AACAGGGCTCAGCACACAGGTGG - Intergenic
1026805576 7:73427753-73427775 ACCAGGGCTCAAGCTACAGAAGG + Intergenic
1026877425 7:73887522-73887544 GTCAGAGCTCAGCCTATGGCGGG + Intergenic
1028496182 7:91463521-91463543 ATCCGCGCTCAGCCCGCAGCTGG - Intergenic
1032481691 7:132252128-132252150 ATCAGGGCCAAGCCTGCTGCTGG + Intronic
1035065978 7:156105409-156105431 CTCAGGGCTCACCCTGCAGTCGG - Intergenic
1035607813 8:940578-940600 TTCAGGGCTCTGGCAACAGCTGG + Intergenic
1035672417 8:1429673-1429695 AGCAGGGATGAGCCTGCAGCAGG + Intergenic
1036571070 8:9980239-9980261 ACCCAGGCTCAGCCCACAGCTGG + Intergenic
1038709940 8:29934000-29934022 ATGAGGGCTCATCCTGAAGCAGG - Intergenic
1039517781 8:38147795-38147817 ATGTGGGCTCACCCTACAACAGG - Intronic
1043662207 8:82758105-82758127 ATCTGTGCTCAGCCTGCAACTGG + Intergenic
1044285271 8:90404254-90404276 ATCAGGGCTCAGCCCACTATTGG - Intergenic
1044331346 8:90923378-90923400 AACAGGGCTCAGACTCCAGTTGG + Intronic
1044930462 8:97247119-97247141 ATCAGGGCTCACCCTGGACCTGG + Intergenic
1045349011 8:101321345-101321367 CTCAGGACTCAGGCTAAAGCAGG + Intergenic
1048372295 8:133789758-133789780 ATCAGAGCCCAGAATACAGCAGG - Intergenic
1049208828 8:141376038-141376060 ATCAGGGCTCATCCTCTGGCTGG + Intergenic
1049410702 8:142472724-142472746 ATCAGGGCTCAGTATATAACAGG + Intronic
1049531619 8:143158249-143158271 ATCAGGGCCCAGCCCAGAGGAGG + Exonic
1050207772 9:3215291-3215313 ATCATGGCTGAGCCTTTAGCAGG - Intergenic
1052403619 9:28031977-28031999 ATTAGGGCTCAGAGAACAGCTGG + Intronic
1052990345 9:34515391-34515413 ACCAGGGTCCAGCCTAGAGCTGG - Intronic
1057536143 9:95908622-95908644 ACCAAGGCCCAGCCTACTGCTGG - Intronic
1057938619 9:99261152-99261174 GTGAGGGCTCAGCCTGGAGCAGG + Intergenic
1059437159 9:114283851-114283873 TCCAGGGGTCAGCCTTCAGCTGG - Intronic
1062181908 9:135195388-135195410 ATGTTGGCTCAGCCCACAGCTGG + Intergenic
1062208409 9:135349750-135349772 ACCAGGGCTCAGCCTGGAGTGGG + Intergenic
1062453630 9:136625874-136625896 GTCAGGGCTCAGGCTATGGCTGG - Intergenic
1203735916 Un_GL000216v2:139285-139307 GTCAAGGCTCTGCCTACAGGGGG - Intergenic
1200227018 X:154423515-154423537 ATCCTGCCTCAGCCTCCAGCTGG - Intergenic
1200891405 Y:8328271-8328293 AGCAGGGCTCAGCTTACAGGTGG + Intergenic
1201125191 Y:10906783-10906805 GTGTGGGCTCAGCCTACAGGGGG + Intergenic