ID: 1146477107

View in Genome Browser
Species Human (GRCh38)
Location 17:33171868-33171890
Sequence CTTTCCAGGCAGACGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 7, 3: 22, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146477107 Original CRISPR CTTTCCAGGCAGACGGAACA AGG (reversed) Intronic
900751204 1:4398949-4398971 CTTTCCCTGCAGAAAGAACATGG + Intergenic
900902514 1:5526696-5526718 CTTTCCTGGGAGAGGGAGCATGG + Intergenic
903798563 1:25949103-25949125 CATTCCAGGCAGAAGAAATAAGG - Intergenic
904677411 1:32206864-32206886 CTATCCCGGCAGAGGGAAGACGG - Intronic
904948117 1:34214202-34214224 CATTCCAGGCAGGAGGAGCAAGG + Intronic
904976495 1:34460905-34460927 CTTCCTAGGCAGAAGGAACAAGG + Intergenic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
907987883 1:59550824-59550846 CTTTGGAGTCAGACAGAACAAGG + Intronic
910457794 1:87416185-87416207 CTTTCAGGGCAGAGGAAACAAGG - Intergenic
912063250 1:105700812-105700834 CTTACCACCCAGACGGATCACGG - Intergenic
912905723 1:113704749-113704771 CTTTCCTGGCAGAAGTAATATGG + Exonic
915315205 1:155024639-155024661 CATTCCAGGCAGACAAAACAGGG - Intronic
915318619 1:155043693-155043715 CTTTTAAGGCAGTGGGAACATGG - Intronic
915976666 1:160395492-160395514 CTTTCCAGGCAGAAAGAAGGAGG + Intergenic
916346394 1:163796694-163796716 CTATCCAGGCAGAGGCAACTTGG - Intergenic
917710781 1:177681845-177681867 GTTTCCAGGCAGATGGAGAAGGG + Intergenic
918293025 1:183127721-183127743 TGTTCCAGGCAGAAGGAACCTGG + Intronic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
920869830 1:209784694-209784716 CTTTCCGGCCAGACTGAACGCGG + Intergenic
923057501 1:230438105-230438127 ATTCCCAGGCAGAGGGAGCATGG - Intergenic
1063232935 10:4083703-4083725 TTTTCCTGGCAAACGGAAGATGG + Intergenic
1064532196 10:16321975-16321997 CTTTCCAGCCAGGTGGAACTGGG + Intergenic
1065552911 10:26887320-26887342 GTATCCAGGCAGACAGGACATGG + Intergenic
1066681361 10:37939084-37939106 TATTCCAGGCAGACTGAATATGG - Intergenic
1067751797 10:48976548-48976570 CTTTCCTGGCAGAAGGCACCTGG - Intronic
1070931609 10:80264905-80264927 CCTTCCAGGCAGAGAGAACAGGG - Intergenic
1071439719 10:85679588-85679610 TTTTCCAGGCAGAAGGAACAAGG + Intronic
1071728934 10:88228502-88228524 CGTTCCAGGCACACGGAAAATGG - Intergenic
1071851821 10:89580555-89580577 CTTTCCAAGCAGAGGGAGCTGGG - Exonic
1073316109 10:102582044-102582066 CTTTCCAGGGACAGAGAACAAGG - Intronic
1073323208 10:102628074-102628096 ATTTCCTGGCAGACAGGACAAGG - Intronic
1074181562 10:111069461-111069483 CTTTTCTGGCAGTAGGAACAGGG - Intergenic
1076469278 10:130707445-130707467 CTTTCCAGACAGTCTGAAAAGGG + Intergenic
1076991431 11:278148-278170 ACTTCCAGGTAGAGGGAACAGGG - Intergenic
1082782952 11:57301310-57301332 CATTGCAGGCAGAGGGAACAGGG - Intronic
1084213357 11:67633996-67634018 CTGTCCAGGCAGGTGGAAAAGGG - Intronic
1085157903 11:74312673-74312695 CTTTCCTGGCAGAAGGTACATGG + Intergenic
1085559606 11:77459047-77459069 AATTCCAGGCTGAGGGAACAGGG + Intronic
1086536487 11:87853178-87853200 CATTCAAGGCAGAAAGAACATGG + Intergenic
1086595134 11:88561486-88561508 ATTTCCAGGCACATGGAACTGGG - Intronic
1088216871 11:107520223-107520245 ATTTCCAGGCATACGGTACTTGG - Intronic
1089740605 11:120579365-120579387 CCTTCCAGGCAAGGGGAACAAGG + Intronic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091515188 12:1172832-1172854 ATTTACAGACAGACGGACCAAGG - Intronic
1091768610 12:3137582-3137604 CTTTCCAGCCAGATGGAGGAGGG + Intronic
1096115141 12:49051085-49051107 CTTTTCAGGCCGAGGGGACAGGG + Exonic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1098498081 12:71160085-71160107 TATTCCAGGCAGAAGGAACAAGG - Intronic
1099585520 12:84508139-84508161 GTTGCCAGGCAGACACAACAAGG + Intergenic
1100308870 12:93376660-93376682 CTTTCAAGGCAAAGGGAACTGGG - Intergenic
1101328316 12:103736290-103736312 CTTTCCAGGCAGTGGGAAGGAGG + Intronic
1107047203 13:36006265-36006287 TTTTCCAGGCAGCCGTACCAAGG + Intronic
1108215457 13:48179391-48179413 CTTTCCAGGCAGACATAATCTGG - Intergenic
1108731664 13:53241834-53241856 GTTTCCAGCCAGACTGAGCAAGG - Intergenic
1110208593 13:72946903-72946925 CTTTTCAGGCAGACAGTGCAAGG + Intronic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1112841181 13:103580150-103580172 CTTTCCAGGAAAACAAAACAAGG + Intergenic
1112915885 13:104549972-104549994 CTATCCAGGCACATGGAGCATGG - Intergenic
1113607312 13:111618883-111618905 CTCTCCAAGCAAACGGAAAAGGG - Intronic
1114187534 14:20414065-20414087 CTTTCCAGGAAGATGGAACCAGG + Intergenic
1115982324 14:39067286-39067308 CTTTCCATGCAGAGGATACATGG - Exonic
1118294881 14:64559587-64559609 CATTCTAGGGAGAAGGAACATGG + Intronic
1118483873 14:66195789-66195811 CTTTCCATGGAGAGGGGACATGG + Intergenic
1118735819 14:68701285-68701307 CCTTCCAGGCAGAGGTGACAGGG - Intronic
1119686986 14:76640805-76640827 CTTTCCAGGCAGACAGAACAGGG - Intergenic
1120705303 14:87739500-87739522 CTTTCCAGCCACATGGAACTCGG + Intergenic
1125989164 15:44088863-44088885 CTTTGTAGTCAGACTGAACAGGG - Intronic
1128620843 15:69148532-69148554 CTGTCCAGGCAGAGGGAGCGAGG + Intergenic
1128646064 15:69379783-69379805 CGTTCCAGGCACACAGAGCACGG + Intronic
1131424582 15:92335122-92335144 CTTTTCAGGTATATGGAACAGGG + Intergenic
1132582010 16:689084-689106 CTGTCCATGCAGGCGGAAAAGGG - Intronic
1134387007 16:13782593-13782615 GCTTCCAGGCAGAAGGAACAAGG - Intergenic
1134790982 16:16989093-16989115 CATTCCAGGTAGAAGAAACATGG + Intergenic
1136552749 16:30990227-30990249 CTGTCCAGGCGGCCGGAAGAGGG + Exonic
1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG + Intergenic
1139690852 16:68641166-68641188 CATTCCAGGCAGAGAAAACAGGG - Intronic
1139917572 16:70438137-70438159 CTCTACAGGCAGAGGGAACCCGG + Intronic
1140729819 16:77845739-77845761 CTTGCCAGGCAGAGGAAAAAGGG - Intronic
1140897872 16:79341021-79341043 CCTTCCAGGCAGAGGGACAAAGG + Intergenic
1141342634 16:83217373-83217395 CTTTCCAGTGAGCCGGAACTTGG - Exonic
1143992489 17:10978114-10978136 CATTCCAGGCAGAAGTAATAGGG - Intergenic
1144711334 17:17403563-17403585 CTGTCCATGCAGACGGCAGATGG - Intergenic
1145285576 17:21503791-21503813 ATTTCCAGGCAGACAGAGGATGG + Intergenic
1146477107 17:33171868-33171890 CTTTCCAGGCAGACGGAACAAGG - Intronic
1148110173 17:45139924-45139946 CTTTGCAGGGAGACAGAATAGGG - Intronic
1148197902 17:45727985-45728007 CATTCCAGGAGGAGGGAACACGG - Intergenic
1148550825 17:48550128-48550150 GTTGGCAGGCAGATGGAACAAGG + Exonic
1150443606 17:65211244-65211266 CTTTCCAGGCAGGCATAGCAGGG - Intronic
1152930141 17:83105126-83105148 CTGTGCAGGCAGACGGCACACGG - Intergenic
1155151449 18:23126419-23126441 CTTTGGAGGCAGACTGAACCAGG - Intergenic
1156483957 18:37453100-37453122 CATTCCAGGTAGAGGGAACCCGG - Intronic
1159557051 18:69956392-69956414 CTCTCCAGCAAGACTGAACAAGG - Intronic
1160011080 18:75107491-75107513 CTCTCCTGGCAGATGGGACACGG + Intergenic
1165067821 19:33239313-33239335 CATTCCAAGCAGCTGGAACAGGG - Intergenic
1167640141 19:50676949-50676971 CATTCCAGGTAGCAGGAACAAGG - Intronic
925210084 2:2038050-2038072 CATTCCATGCAGACGTAGCATGG + Intronic
926590474 2:14735047-14735069 CATTCCAGGCAGGAGGAAGAGGG - Intergenic
926829902 2:16950313-16950335 TTTTACAGGCAGAGGGACCAAGG - Intergenic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
930148729 2:48035625-48035647 ATTTTCAGGCAGATGGAAAATGG - Intergenic
930748016 2:54904553-54904575 CATTCCAGGCAAAAGGAATATGG + Intronic
932372488 2:71202846-71202868 CTTTCTAGGCAGGTGGGACAGGG + Intronic
933181345 2:79230684-79230706 TTTTCCAGGCACATGGTACAAGG - Intronic
933779018 2:85788615-85788637 CTGTCAAGGCAGAAGGGACAGGG + Intergenic
936630622 2:114199018-114199040 CTTTCCAGGCTGAGGGAGAAAGG - Intergenic
939835612 2:147125824-147125846 TTTTCCAGGCTCACGGTACAAGG - Intergenic
945034483 2:205692724-205692746 CTTACCAAGCAGATAGAACAGGG + Intronic
946595634 2:221302957-221302979 CATTCTAGGCAGAGGGGACATGG - Intergenic
946799299 2:223393090-223393112 CTTTCTAAGCAGACAGAAAAAGG + Intergenic
947643574 2:231721626-231721648 CTTTCCAAGCAGAGGAAAGACGG + Intergenic
948122964 2:235544476-235544498 CCTTCCAGCCACACGGACCACGG - Intronic
948244918 2:236472835-236472857 CTTCCCAGGCAGACAGAGCTAGG - Intronic
948443236 2:238011319-238011341 CACTCCAGGCAGATGAAACAGGG - Intronic
1168880555 20:1202922-1202944 CATTCAAGGCAGAAGGAAAAGGG + Intergenic
1169001640 20:2172228-2172250 GGTTCCAGGCAGAGGGAGCAGGG - Intronic
1169046996 20:2541033-2541055 GATTCCAGGCAGAGGAAACAGGG - Intronic
1170882221 20:20306729-20306751 CTTTCCAGGCAGGCAGAGGAAGG + Intronic
1172514125 20:35521423-35521445 CATTCCAGGCAGAGGGAGCAAGG + Intergenic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1173315782 20:41941851-41941873 ACTTCCAGGTAGACGGAACTAGG - Intergenic
1175373525 20:58509122-58509144 TGTTCCAGGCAGAGGGAAGAGGG + Intronic
1177459222 21:21388393-21388415 CATTCCAGGCAGAGGGAACAAGG + Intronic
1177473874 21:21593813-21593835 TTTTCCAGGCACAAGGTACAAGG + Intergenic
1178724895 21:35042641-35042663 CTGTCCAGGCAGAAAGGACATGG - Intronic
1182092016 22:27602431-27602453 CTTTCCAGGCAGAAAGGGCAAGG + Intergenic
1182619534 22:31611327-31611349 CTTGCCAGGCAGGCAGAACTTGG - Intronic
1183239639 22:36647712-36647734 CATTCCAGCCAGAGGCAACAGGG - Intronic
1183724417 22:39580585-39580607 TTTTCCAGGCAGAGGGAACACGG + Intronic
1184408702 22:44314221-44314243 TGTTCCTGGCAGAGGGAACAAGG + Intergenic
1184550326 22:45200977-45200999 CGTTCCAGCCAGAGGGAACTTGG + Intronic
1185128870 22:49026121-49026143 CTTTCCAGTCAGGAGGAAGAGGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950786697 3:15442948-15442970 CATTCCAGGCAGAAGGAATCTGG - Intronic
950945841 3:16945099-16945121 TGTTCCAGGCAGAGGGAACTGGG - Intronic
951816257 3:26758455-26758477 CTTTGGAGAGAGACGGAACATGG + Intergenic
953715167 3:45311401-45311423 CGTTCCAGGCAGGGGGAACAGGG + Intergenic
953896588 3:46807887-46807909 CATTCCCCGCAGATGGAACATGG + Intronic
954624535 3:52015418-52015440 TGTCCCAGGCAGAAGGAACAGGG - Intergenic
956502058 3:69897369-69897391 CTTGCCAGACAGAAGGAAGAAGG + Intronic
956937246 3:74117085-74117107 CATTCTAGGCAGAAGGAGCAGGG - Intergenic
957073379 3:75582384-75582406 TTTACCAGGCTGACTGAACAGGG + Intergenic
960253501 3:115484930-115484952 CTTTCCTGGAAGACTGAAGATGG + Intergenic
961432014 3:126890124-126890146 CTTTCCAGGCGGCTGGCACATGG - Intronic
966945341 3:184773733-184773755 CTCTTCAGGCATATGGAACAGGG + Intergenic
967962494 3:194937309-194937331 CCTTCCAGGCAAAGGTAACATGG + Intergenic
969095403 4:4729046-4729068 CTTCCCAGGCAGGGGGATCAGGG - Intergenic
969338882 4:6528149-6528171 CTTCCCAGGCCGAGGGTACAGGG - Intronic
971358450 4:25914996-25915018 CTTTCCACTCAGAAGGATCAGGG - Intronic
971483322 4:27133886-27133908 CTTTCCAGGGAGAGGGAACATGG + Intergenic
975993447 4:80285364-80285386 ATTTTCAGGGAGAAGGAACAGGG - Intronic
976484268 4:85583280-85583302 CTTTCCAGGAAGATGAAAAAGGG + Intronic
979497389 4:121398479-121398501 CTTTCCAGCTAGACTTAACAGGG + Intergenic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
980014472 4:127632947-127632969 CTTCCCAAGCAGAGGCAACATGG + Exonic
984390578 4:179126396-179126418 CTTTCCAGGGAGTGGGCACACGG - Intergenic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
986059375 5:4173635-4173657 CTGTGCAGGCAGAAGGGACAGGG + Intergenic
986780236 5:11058529-11058551 ATGTCCAGGCAGAAGGGACAGGG + Intronic
989376312 5:40765817-40765839 CTTTCCAGTCACACAGAACTGGG - Intronic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
991007055 5:61839396-61839418 GTTTTCAGGCAGAAGGAATATGG - Intergenic
991533010 5:67636513-67636535 TTTTCCAGTCAGGCTGAACATGG + Intergenic
992195315 5:74333454-74333476 CATTCCAGGCAGAAGGAACAGGG - Intergenic
992485431 5:77189969-77189991 ATTTGCAGGCAGATGGAATATGG + Intergenic
997803285 5:136888500-136888522 CTTGCCAGGCAGAGGGATGAGGG - Intergenic
997880180 5:137582325-137582347 CATGCCAGGCAGAGAGAACAGGG - Intronic
997984008 5:138489483-138489505 ATTTCCTGGCAAATGGAACAGGG - Intergenic
998444220 5:142186234-142186256 CTTTCCAGGGAGAGGGTCCATGG + Intergenic
1000359472 5:160433864-160433886 CTTTCCAGCCAGAGTGAACTTGG + Intergenic
1001617418 5:173054315-173054337 CTTTCCAAGACGACGGAAGAGGG + Intergenic
1003432924 6:6056521-6056543 CATTCCTGGCAGAAGAAACATGG - Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1006467904 6:34206963-34206985 GTCTCCAGGCACAGGGAACAAGG + Intergenic
1006986634 6:38179900-38179922 CTTTCCAGGCAAAGGGAACGAGG + Intronic
1007291138 6:40787753-40787775 CTTTGGAGTCAGACAGAACAGGG + Intergenic
1007582016 6:42965441-42965463 CTTTACAGGCAGTCTCAACAGGG + Intronic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1007791855 6:44313738-44313760 TTTTCCAGGCTGAGGGAAGAAGG + Intronic
1014259072 6:119195385-119195407 CATTTCAGGCAGAGAGAACAAGG - Intronic
1014269393 6:119319868-119319890 TTTTCAAGGCAGAAGGAAGAGGG - Intronic
1014690992 6:124563589-124563611 CTTTCCAGGCAAACGAACCCTGG - Intronic
1018230795 6:161673394-161673416 GGTTCCAGGCAGAAGGAACAAGG + Intronic
1018993379 6:168691921-168691943 CATTCCAGGCAGAAGGAAACTGG - Intergenic
1021899503 7:25269527-25269549 CTTTACAGGGATACGTAACAGGG + Intergenic
1022198635 7:28094648-28094670 ATTTTCTGGCAGAAGGAACATGG + Intronic
1022778939 7:33558436-33558458 CATTCCAGAGAGAGGGAACAGGG + Intronic
1023227318 7:37984231-37984253 TTTTCCAGGCAAACAGAATAAGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026332926 7:69368716-69368738 CTTTCAAGGCAGAAGAAAGAAGG + Intergenic
1031168826 7:118265072-118265094 CTTCCCAGGCTGACACAACAGGG - Intergenic
1032600847 7:133292578-133292600 CTTTCCAGGCAGACAGTATTGGG - Intronic
1035107237 7:156452102-156452124 CATTCCAGGCAGAGGGAACAAGG - Intergenic
1036119507 8:6000490-6000512 CTTGTCAGGCAGACTGGACAAGG + Intergenic
1037552971 8:19992920-19992942 GTTTCCAGGTAGAAGCAACAGGG - Intergenic
1040079963 8:43275694-43275716 CTTTCCAGGGAGGACGAACAGGG - Intergenic
1042745354 8:72100764-72100786 CTTCCCAGTCAGAAGGATCATGG + Intronic
1042861842 8:73322225-73322247 CTTTCCAGGATGCCGGAAGAGGG - Intronic
1045187622 8:99854999-99855021 TTTTCCAGCCAGACTGAAAAGGG - Intronic
1047832908 8:128655763-128655785 CTTTCAAGGAAGAAAGAACAGGG - Intergenic
1048375324 8:133818064-133818086 CTTTCCAGGAAGAGGAAACAGGG - Intergenic
1049102106 8:140587381-140587403 TTTTCCAGGCAGAGGGGCCAGGG + Intronic
1050733928 9:8741516-8741538 CTTTCCACTCAAACAGAACATGG + Intronic
1054748139 9:68876401-68876423 CTTCCCAGGAAGAAGGCACAAGG + Intronic
1055197623 9:73615570-73615592 CCTTCCAGGGAGAAGGTACAAGG + Intergenic
1058822751 9:108747740-108747762 CATCCCAGGCAGGTGGAACACGG - Intergenic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1060948909 9:127588178-127588200 TGTTCCAGGCAGAGGGAACAGGG - Intergenic
1061488159 9:130930696-130930718 CTCTGCAGCCAGACGGGACAGGG + Intronic
1185787686 X:2904575-2904597 CATTCCAGGCAGCAGGAAAAAGG - Exonic
1186135497 X:6515998-6516020 CTTTTCAGCCAGACGGAACAGGG - Intergenic
1186770592 X:12814301-12814323 TTTTCCTGGCAGAGGGAGCAGGG - Intronic
1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG + Intergenic
1187900219 X:24021293-24021315 TGATCCAGGCAGAGGGAACAGGG - Intronic
1188612368 X:32116185-32116207 CATTCCAGGCAGAGGAAACAAGG - Intronic
1188639968 X:32488920-32488942 GATTCCAGGCAGAAGGAACATGG - Intronic
1189052083 X:37656437-37656459 CATTCTAGGCAAAAGGAACATGG - Intronic
1189751562 X:44227875-44227897 CATTTCAGGCAGAGGGAACTTGG + Intronic
1190154163 X:47974048-47974070 CTTTCCAGGGAGAGGAAACGTGG - Intronic
1190394022 X:49961496-49961518 CTTTCCAGCCAGGCTGACCAGGG - Intronic
1190446127 X:50526211-50526233 CATTCCAGGCTGAGGGAGCAGGG + Intergenic
1192005585 X:67208528-67208550 CTTGAGAGGCAGACAGAACAGGG + Intergenic
1196540346 X:116900217-116900239 CTTTCCAGGCACATGGTGCAAGG + Intergenic
1196647577 X:118134314-118134336 CATTTCAGGCAGGCAGAACAAGG - Intergenic
1197778916 X:130140258-130140280 CTTTCAAGGCACAGGGCACAGGG + Intronic
1197940361 X:131782418-131782440 CTTTCCAGGAACAAGGATCATGG + Intergenic