ID: 1146478434

View in Genome Browser
Species Human (GRCh38)
Location 17:33181883-33181905
Sequence GTGTGCTTGAAGCAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 307}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146478429_1146478434 8 Left 1146478429 17:33181852-33181874 CCAGCCTGCTTGACGAAGGGCAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG 0: 1
1: 0
2: 3
3: 42
4: 307
1146478423_1146478434 16 Left 1146478423 17:33181844-33181866 CCACACCCCCAGCCTGCTTGACG 0: 1
1: 0
2: 0
3: 31
4: 747
Right 1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG 0: 1
1: 0
2: 3
3: 42
4: 307
1146478425_1146478434 11 Left 1146478425 17:33181849-33181871 CCCCCAGCCTGCTTGACGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 343
Right 1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG 0: 1
1: 0
2: 3
3: 42
4: 307
1146478428_1146478434 9 Left 1146478428 17:33181851-33181873 CCCAGCCTGCTTGACGAAGGGCA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG 0: 1
1: 0
2: 3
3: 42
4: 307
1146478427_1146478434 10 Left 1146478427 17:33181850-33181872 CCCCAGCCTGCTTGACGAAGGGC 0: 1
1: 0
2: 1
3: 5
4: 131
Right 1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG 0: 1
1: 0
2: 3
3: 42
4: 307
1146478431_1146478434 4 Left 1146478431 17:33181856-33181878 CCTGCTTGACGAAGGGCAAGGAG 0: 1
1: 0
2: 1
3: 8
4: 116
Right 1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG 0: 1
1: 0
2: 3
3: 42
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146478434 Original CRISPR GTGTGCTTGAAGCAGAGTGA GGG Intronic
901096111 1:6681688-6681710 GTGTGCTTTAACCACAGTGGGGG + Intronic
901690100 1:10967262-10967284 GTGTGTTTGGAGCAGAGGGAGGG - Intronic
902667027 1:17946677-17946699 TTGTGGTTGGAGCAGAGGGAAGG + Intergenic
903290598 1:22311694-22311716 GTGTGGTCGGAGCAGAGTGAGGG + Intergenic
904016797 1:27427925-27427947 GTTTGCTTGAAGCTGAGATATGG - Intronic
904809941 1:33156947-33156969 GTGGGCGTGAAGCAGGGTGGTGG - Intronic
904921894 1:34014421-34014443 GTGCTCCTGGAGCAGAGTGAGGG - Intronic
905163209 1:36055483-36055505 TAGTGATTGAAGCTGAGTGATGG + Intronic
905670503 1:39787898-39787920 GTGTGTTTGGGGCAGGGTGAAGG + Intronic
906307440 1:44728675-44728697 GTGTGTCTGGAGCAGAGTGAAGG - Intergenic
906698903 1:47843345-47843367 GTGTTCTGGATGCAGACTGAAGG + Intronic
906941190 1:50256894-50256916 GTCTGGTTGCAGTAGAGTGAGGG - Intergenic
908534511 1:65066180-65066202 GCGTGCGGGTAGCAGAGTGAGGG + Intergenic
909371601 1:74889122-74889144 GTGTGTTTGAAGTACAGTGATGG - Intergenic
910084575 1:83384385-83384407 TTGTGCTTTCAGCAAAGTGAGGG + Intergenic
912228973 1:107770084-107770106 GTGTGGCTGGAGCAGAATGAGGG - Intronic
912747920 1:112260862-112260884 GTGTGCTTGACTCAGCATGAAGG - Intergenic
912769583 1:112451436-112451458 GTGTGCAGGAATCAGGGTGAAGG + Intronic
912895870 1:113588355-113588377 ATGTGGTTGGAGCAGAGTGATGG + Intronic
914044412 1:144078331-144078353 GTGTGAGTGGAACAGAGTGAAGG + Intergenic
914133698 1:144882356-144882378 GTGTGAGTGGAACAGAGTGAAGG - Intergenic
915498405 1:156297339-156297361 GTGTTCTAAAATCAGAGTGATGG - Intergenic
915745544 1:158154226-158154248 GTGTGTTGGAAGCAGTGTGCAGG + Intergenic
916121228 1:161530026-161530048 GTGTGCTTGACGCACAGAAAGGG + Intergenic
916130999 1:161611630-161611652 GTGTGCTTGACGCACAGAAAGGG + Intronic
916629402 1:166595365-166595387 GTGTGCTTACAGCAGAGAGTTGG - Intergenic
916831141 1:168492632-168492654 GTGTGCCTGATGCAGAGCGCTGG + Intergenic
918237206 1:182592198-182592220 GTGAGGCTGGAGCAGAGTGAGGG + Intergenic
919133034 1:193474619-193474641 GTGTCCTAGAAGCAGAGAGAGGG - Intergenic
919658975 1:200224522-200224544 GTGGGGTTGAATCACAGTGAAGG - Intergenic
923373663 1:233338668-233338690 GTGTGCTGGGAGAAAAGTGAAGG + Intronic
924089707 1:240489493-240489515 GTGTGTGAGAAGCAGGGTGAAGG + Intergenic
1063898772 10:10710218-10710240 GTATGCTTGAAGCAAAATAAAGG + Intergenic
1064693435 10:17941165-17941187 GTGTGGCAGAAGCAGAGGGAAGG + Intergenic
1065691548 10:28339165-28339187 GATTGCTTGAAGCTGAGAGATGG - Intergenic
1065862870 10:29886274-29886296 GTGGTCTTAAAGCAGAGTGGAGG + Intergenic
1067134494 10:43595928-43595950 GTGTGCTCCAAGCAAAGTGTGGG - Intergenic
1067307496 10:45078735-45078757 GTGCGTGTGAAACAGAGTGAAGG + Intergenic
1068369738 10:56096622-56096644 TTGTGCATGAAGCATAGTGCCGG + Intergenic
1069171905 10:65241531-65241553 GTCTGCCTGAGGCAGAGCGAGGG + Intergenic
1070215776 10:74378986-74379008 GAGTGGTTGGAGCAGAGTAATGG + Intronic
1070443494 10:76469611-76469633 CTGTCTTTGAAACAGAGTGAGGG + Intronic
1070656800 10:78277213-78277235 ATGTGTCTGACGCAGAGTGAAGG - Intergenic
1072682501 10:97517195-97517217 GTCTGGCTGAAGCAGAGTGAGGG + Intronic
1072775159 10:98183800-98183822 GTGTAATTTAAGCAGAGGGATGG - Intronic
1073656024 10:105417740-105417762 ATGTGCTTGAAGCAAACTCAGGG + Intergenic
1075346502 10:121685866-121685888 ATGGTCTTGAATCAGAGTGAAGG + Intergenic
1075588659 10:123675953-123675975 GTGTGCAAGATGCTGAGTGATGG - Intronic
1075713915 10:124545021-124545043 GGGTGCTTTGAGCTGAGTGAAGG + Intronic
1076020514 10:127068857-127068879 GTGTGCTTGAAAAATACTGAAGG - Intronic
1078145302 11:8718246-8718268 GGGTGTTTGCAGCAGAGGGAAGG - Intronic
1079183391 11:18214120-18214142 GTGTAGATGAAGTAGAGTGAGGG + Exonic
1079237635 11:18701283-18701305 GAGTTCTTGAACCAGAGTGTGGG + Intronic
1079410168 11:20180087-20180109 GTGTGTCTGGAGCAGAGAGAGGG - Intergenic
1079978334 11:27121248-27121270 GTGTGACTGGAACAGAGTGAAGG + Intronic
1080609108 11:33888477-33888499 GTGTGGATGAAGCAGAGGGAGGG - Intronic
1080903188 11:36514988-36515010 GTGTGGTTGAGGCAGGGAGAAGG + Intronic
1081336194 11:41870101-41870123 TTCTCCTTGGAGCAGAGTGAAGG + Intergenic
1083510893 11:63208740-63208762 GTGTGCTTGGAGGTGAGTGTGGG + Intronic
1083730103 11:64648272-64648294 GTCTGCTTGCAGCAGTGGGATGG - Exonic
1084062626 11:66686120-66686142 GTGTCCTTGAAGCTGATTGAGGG - Intronic
1084063930 11:66692736-66692758 GAGTGCTGCAAGAAGAGTGAGGG + Exonic
1085375259 11:76054551-76054573 GAGTGCCTGGAGCAGAGTAAGGG - Intronic
1085803491 11:79613062-79613084 TGGTGCTTGAAGCAGAATGGAGG - Intergenic
1086492651 11:87370852-87370874 GTGTGGCTAAAGCAGAGTGAGGG - Intergenic
1086533649 11:87816159-87816181 GTGTTCTTGAAGTACAATGATGG + Intergenic
1086980744 11:93195702-93195724 AAGTGGCTGAAGCAGAGTGATGG - Intronic
1087161047 11:94948419-94948441 GTGGTTTTGAAGCAGAGGGAGGG - Intergenic
1087611594 11:100440925-100440947 GTGTGTTTGAGGAAGAATGAAGG + Intergenic
1087875091 11:103345642-103345664 ATGTGGCTGAAGCACAGTGAGGG + Intronic
1088144124 11:106653434-106653456 AAGTACTTGAAGCAGAGTGCTGG - Intergenic
1088965666 11:114718758-114718780 GTATGTTTGAGGCAGAGAGAGGG + Intergenic
1089413835 11:118270108-118270130 GTGTGGCTGGAGCAGAGTGAAGG + Intergenic
1089838565 11:121393605-121393627 GAGTGCTTGAAGCACAGACAGGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1090670734 11:128943395-128943417 GAGTGCGGGAAGCAGAGTGTGGG - Intronic
1091196545 11:133736267-133736289 CTGTACAGGAAGCAGAGTGAGGG + Intergenic
1091825472 12:3509262-3509284 GTGTGGCTGGAGCAGAGGGAAGG - Intronic
1092545952 12:9451099-9451121 GTAAGCTGGAAGCAGTGTGAAGG + Intergenic
1092977546 12:13759871-13759893 GAGTGCATGGAGCAGAGTGAGGG - Intronic
1093251314 12:16807600-16807622 ATCTGCTTAAATCAGAGTGATGG + Intergenic
1093666547 12:21820625-21820647 GTGTGGTTGGAGTACAGTGAAGG - Intronic
1094539350 12:31350278-31350300 GTGTGGCTGAAGCATAGTTAGGG - Intergenic
1095295173 12:40519228-40519250 GTCTCCTTGAAGCAGAGGAAAGG - Intronic
1096604839 12:52757229-52757251 GTGTGGTTGAGGTGGAGTGAAGG - Intergenic
1098092189 12:66915541-66915563 GTGGGAATCAAGCAGAGTGACGG + Intergenic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1100592523 12:96042840-96042862 GTGTTCTTGGACCAAAGTGAGGG - Intronic
1101437106 12:104673087-104673109 GTGTACATGGAGCAGAGAGATGG - Intronic
1102170202 12:110836472-110836494 CTGTGCCTTCAGCAGAGTGATGG - Intergenic
1102257215 12:111423125-111423147 GTGTGGTGGGAGCAGAGAGAGGG + Intronic
1102568909 12:113815461-113815483 GTGTGCTCAAGGGAGAGTGAGGG - Intergenic
1103399784 12:120635939-120635961 GTGGGCTGGAAGGAGACTGAAGG - Intergenic
1103941948 12:124506042-124506064 GGGGGCTTGAAGCAGAATGTGGG - Intronic
1104711502 12:130990068-130990090 GTGTCCACAAAGCAGAGTGAGGG - Intronic
1104791198 12:131483168-131483190 GCCTGCCTGAAGCAGGGTGAAGG + Intergenic
1105336448 13:19474604-19474626 GGGTGCTTCTAGCATAGTGATGG + Intronic
1106230273 13:27816009-27816031 GGCTGAATGAAGCAGAGTGAGGG - Intergenic
1107489863 13:40870918-40870940 GGGTGCTTCTAGCACAGTGATGG + Intergenic
1109307002 13:60651947-60651969 GTGTGAGGGAATCAGAGTGAGGG - Intergenic
1110002378 13:70220423-70220445 GAGTACTTTAAGCAGAGAGATGG + Intergenic
1110753775 13:79147010-79147032 GTGTGGTTGAAACAGAATTAGGG - Intergenic
1111417562 13:87968790-87968812 GTGTGGGTGAAGAAGATTGAAGG + Intergenic
1111700053 13:91675798-91675820 GTGTGATGGAAGCAGAGGGCAGG + Intronic
1114350103 14:21841017-21841039 GTGTGCTTGAGAGAGAGAGAAGG + Intergenic
1115125594 14:29989227-29989249 ATGTCCTTGAATCAGAGGGATGG - Intronic
1115964730 14:38875058-38875080 GAGTTCTGGGAGCAGAGTGAAGG + Intergenic
1116041202 14:39688124-39688146 GGGTGCTTGAATCCGGGTGACGG - Intergenic
1116858052 14:49971124-49971146 GTGTCTTTGGAGAAGAGTGATGG + Intergenic
1116894500 14:50302776-50302798 GTGTTCTAAAAGCAGAGTGTGGG - Intronic
1119580255 14:75772585-75772607 GTGTGTGTGAATCAGAATGATGG + Intronic
1119758353 14:77134307-77134329 TTGGGCTAGAAGCAGGGTGAAGG + Intronic
1120821044 14:88912190-88912212 GTGTGCCTGGAGCAGAGTGATGG + Intergenic
1121604339 14:95229602-95229624 GGATGCCTGATGCAGAGTGAAGG + Intronic
1122598282 14:102908296-102908318 TTGTCCTTGAACCTGAGTGATGG + Exonic
1123806719 15:23881354-23881376 GTGAGCTTGTAACACAGTGAGGG - Intergenic
1124897324 15:33789149-33789171 GTGTAGCTGAAGCAGAGGGAGGG + Intronic
1125034326 15:35106585-35106607 ATCTGCATGAAGCAGAGAGAAGG + Intergenic
1128050906 15:64663661-64663683 GTGTTCTGGAAGCCAAGTGAAGG + Intronic
1128672337 15:69583581-69583603 GTGTGCTCGAGGCAACGTGATGG + Intergenic
1129477275 15:75794606-75794628 GTGCTGTTGCAGCAGAGTGAGGG - Intergenic
1130146761 15:81280326-81280348 GTGTTCTAGGAGCAGAATGAAGG + Intronic
1131753556 15:95536509-95536531 AAGTGCTTGAAGCAGCCTGATGG + Intergenic
1134027615 16:10966367-10966389 ATGTGCTAGAAGCAGAATAAGGG + Intronic
1135586350 16:23674562-23674584 GTGTGCTGGGAGAAAAGTGAGGG - Exonic
1139700841 16:68707211-68707233 GTGTGGCTGGAGCAGAGGGACGG + Intronic
1140206456 16:72937532-72937554 GTGGGCATGATTCAGAGTGAGGG + Intronic
1140323163 16:73973653-73973675 GTGGTGTTGAAGCTGAGTGACGG - Intergenic
1141468401 16:84222159-84222181 GTGTGTTTCAGGCAGGGTGATGG + Exonic
1141928121 16:87182525-87182547 CTGTGCTGGGAGCAGAGTGTGGG - Intronic
1143108283 17:4540278-4540300 GTGTGTGTGCAGCAGCGTGAGGG + Intronic
1143127672 17:4654653-4654675 CTGTGCTTGAGGCAGACTGTAGG - Intergenic
1144608587 17:16689492-16689514 GTGAGATTGAAGAAAAGTGACGG - Intergenic
1145128361 17:20320407-20320429 GTGAGATTGAAGAAAAGTGACGG - Intergenic
1145196252 17:20896807-20896829 GTGAGTTTGAAGAAAAGTGACGG + Intergenic
1145228584 17:21152608-21152630 TTGTGCTTCCAGCAGAGGGAGGG + Intronic
1145880908 17:28352062-28352084 GGTTGCTAGTAGCAGAGTGAGGG - Intronic
1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG + Intronic
1146604830 17:34249298-34249320 GTGTTCTGGAAGCAGAGAGTGGG + Intergenic
1150997704 17:70338153-70338175 AAGTGCTTGAAGCATAGTGATGG + Intergenic
1151173813 17:72270414-72270436 GGGGGCTTGAATCAGAGGGAAGG + Intergenic
1151219714 17:72603371-72603393 GGGGGCTTGAAGGAGAATGAGGG + Intergenic
1152624813 17:81383362-81383384 GTGGCCTTGACGGAGAGTGAGGG + Intergenic
1153478053 18:5518244-5518266 GTGTGGTTGGAGCAGAGAGAGGG - Intronic
1153537197 18:6115198-6115220 AGGTGCTTAAAGCAGAGTGGTGG + Intronic
1153587244 18:6635070-6635092 GTGTGGTTGAAATAGAGTGAGGG - Intergenic
1153788410 18:8555483-8555505 GTGTGCATAAAGCAGGATGAGGG - Intergenic
1154455469 18:14518838-14518860 GTGTGGCTGAAGCAGAGCAAGGG + Intronic
1156552961 18:38037657-38037679 GTGGGGATGAAGCAGAGTTATGG + Intergenic
1157393512 18:47322984-47323006 GTGTCTTTGCAGCAGAGAGAAGG + Intergenic
1158564783 18:58545506-58545528 GTGAACTTGAAGTAGAGTGGGGG + Intronic
1158823347 18:61186657-61186679 TTGTGGCTGAACCAGAGTGATGG - Intergenic
1159371332 18:67530949-67530971 CGGTGCTTGAATCAGATTGATGG + Intergenic
1160305271 18:77727948-77727970 GAGTTCCTGAAGTAGAGTGAGGG - Intergenic
1160474617 18:79171755-79171777 GGCTGCTGGAAGCAGAGGGATGG - Intronic
1161222856 19:3126034-3126056 GTGTGGTTGGAGCGGAGGGAGGG + Intergenic
1161466916 19:4436216-4436238 GTGTGCTGGCAGCAGGGAGATGG - Intronic
1161646214 19:5454983-5455005 GTGTGGCTGGAGCAGAGTGAGGG + Intergenic
1161765032 19:6202796-6202818 CTGTGGCTGGAGCAGAGTGAGGG + Intergenic
1161815692 19:6498546-6498568 CTGCGGCTGAAGCAGAGTGAGGG - Intronic
1163704352 19:18803708-18803730 ATGTGACTGGAGCAGAGTGAGGG + Intergenic
1165104935 19:33463619-33463641 GTGTGTTTGAACCACAGTTAAGG + Intronic
1166668214 19:44694272-44694294 GTGTGACTGGAGCTGAGTGAGGG - Intergenic
1166729377 19:45050123-45050145 GTGTGCCTGGAGCAGAGTAGGGG + Intronic
1167129107 19:47572888-47572910 GCGTGCGTGACGCAGGGTGAGGG + Intergenic
1202683971 1_KI270712v1_random:31746-31768 GTGTGAGTGGAACAGAGTGAAGG + Intergenic
925283750 2:2702751-2702773 GTGCGCTAGCAGCAGAGTCAGGG + Intergenic
926774952 2:16412814-16412836 GTGTGGCTGGAGCAGAGTGAGGG - Intergenic
927007294 2:18864057-18864079 GTGTGCTTGAAGTGGCGTGGGGG - Intergenic
930399359 2:50863482-50863504 GTTTGATTTTAGCAGAGTGAAGG + Intronic
931158548 2:59662979-59663001 GTGTGTGTGTAGCAGAGTGGGGG - Intergenic
931456163 2:62411356-62411378 CTGTGCTTGAAGCAAAGCCAGGG - Intergenic
931625093 2:64250249-64250271 ATGTGCTAGAAGCCCAGTGAGGG + Intergenic
932076110 2:68664405-68664427 GTGTGCTTCCATCACAGTGAGGG + Intergenic
934061549 2:88298767-88298789 TAATGGTTGAAGCAGAGTGATGG + Intergenic
934247745 2:90323111-90323133 GTGTGAGTGGAACAGAGTGAAGG - Intergenic
934467016 2:94272783-94272805 GTGTGAGTGGAACAGAGTGAAGG - Intergenic
935102460 2:100009948-100009970 GGGAGCTGGAAGCAGAATGATGG - Intronic
935500410 2:103831454-103831476 GTGTGCTGGAAGCTGGGGGAGGG + Intergenic
935789236 2:106575976-106575998 GTGTGGAGGAAGCAGAGGGAAGG + Intergenic
937595264 2:123664586-123664608 GTGTGTGTGAAGTGGAGTGAAGG + Intergenic
938284306 2:130096072-130096094 GTGTGGCTGAAGCAGAGCAAGGG + Intronic
938334946 2:130484634-130484656 GTGTGGCTGAAGCAGAGCAAGGG + Intronic
938354879 2:130636034-130636056 GTGTGGCTGAAGCAGAGCAAGGG - Intronic
938431301 2:131242819-131242841 GTGTGGCTGAAGCAGAGCAAGGG - Intronic
939646024 2:144700174-144700196 GTGTGCTTGGAACAGAGAGATGG + Intergenic
939993115 2:148895119-148895141 GAGTGCTTGCTTCAGAGTGAGGG - Intronic
942918306 2:181339483-181339505 ACTTGCTAGAAGCAGAGTGAAGG - Intergenic
943473895 2:188330882-188330904 CTCTGGTTGAAACAGAGTGAAGG - Intronic
944207177 2:197169101-197169123 GTGTGGCTGAAGGAGAGTGAAGG - Intronic
944861032 2:203816251-203816273 GTGTGGTTGAACCAGAGAGAAGG - Intergenic
946666985 2:222060729-222060751 GTTTGCGTGAAGTAGAATGAGGG - Intergenic
947999974 2:234559808-234559830 GAGTGCATGAATCAGAGGGAAGG + Intergenic
948526892 2:238576315-238576337 GTGTCCTTGAAGCAAAGGAAAGG - Intergenic
1168796406 20:612625-612647 GTGTGGCTGGAGCAGAGTGAGGG - Intergenic
1168903896 20:1389105-1389127 GAGAGATTAAAGCAGAGTGAGGG - Intronic
1168949338 20:1785952-1785974 CTGTGGTGGGAGCAGAGTGAGGG + Intergenic
1169033779 20:2433169-2433191 GTGAGCTAGAGGCAGAGTGGAGG + Intergenic
1170770463 20:19328198-19328220 GTGTGGCTGGAGCAGAATGAGGG + Intronic
1172567465 20:35941900-35941922 TTGAGCTTTAAGGAGAGTGATGG + Intronic
1172741307 20:37169801-37169823 GTGTGCTTGAACCTGGGAGACGG + Intronic
1173162605 20:40663785-40663807 GTGTGTTGGAAGAAGAGAGAAGG + Intergenic
1173167434 20:40695354-40695376 GTGTGCCTGGAGCATTGTGATGG - Intergenic
1173243893 20:41320833-41320855 ATGGGCTGGAAGCAGAGTAAGGG + Intergenic
1173662423 20:44743969-44743991 GTGGGCTGGAAGCAGCGTGCTGG - Intergenic
1176737111 21:10560503-10560525 GGGTGCTTCTAGCAGAGTGATGG - Intronic
1176818698 21:13634479-13634501 GTGTGGCTGAAGCAGAGCAAGGG - Intronic
1177785605 21:25668129-25668151 GTGTCCCTGGAGCAGAGGGAGGG + Intronic
1180563109 22:16638025-16638047 GGGTGCTTCTAGCAGAGTGATGG - Intergenic
1181164136 22:20974400-20974422 GTGTCACTGGAGCAGAGTGAGGG + Intronic
1181779504 22:25182524-25182546 ATGTGGGTGAAGCTGAGTGAAGG - Intronic
1182106262 22:27691912-27691934 GTGTAAATGGAGCAGAGTGAGGG - Intergenic
1182906400 22:33941047-33941069 GTGGTCTTGCAGGAGAGTGAAGG + Intergenic
1183306255 22:37084680-37084702 GTGTGCTTGCGGCAGAGGGCAGG + Intronic
1183532017 22:38362101-38362123 GGGTGCTTCGAGCAGAGTGATGG + Intronic
1183792509 22:40084348-40084370 GTGTGAGTGAGGCAGATTGAAGG + Intronic
1185184747 22:49392238-49392260 GTCTGCTTGAACAAGAGTCATGG - Intergenic
950399688 3:12760403-12760425 GTGTTACTGGAGCAGAGTGAGGG - Intronic
950485905 3:13273882-13273904 GTGTGCATGGGGCAGAGTGAGGG - Intergenic
950908919 3:16567055-16567077 GTGTGGTTGAAGTAGAGTGAGGG - Intergenic
951060848 3:18205358-18205380 TAGTGCTTAAAGAAGAGTGAGGG + Intronic
952277572 3:31892244-31892266 GTGTGTTTGGAGCAAAGAGAAGG + Intronic
952699654 3:36312563-36312585 ATGTGGCTGAAGCAGAGAGATGG - Intergenic
953067651 3:39489057-39489079 GAGTGGCTGAAGCACAGTGAGGG - Intronic
954196871 3:49002219-49002241 GTTGGTTGGAAGCAGAGTGAAGG - Intronic
955567409 3:60262385-60262407 CTGTGCTTGCAGAAAAGTGATGG + Intronic
955755708 3:62223108-62223130 GTGTTGTTGGAGCAGAGTGTGGG + Intronic
956464807 3:69508795-69508817 TTGTGCCTGACCCAGAGTGATGG - Intronic
956693217 3:71896784-71896806 GTGTGTTTGAGAAAGAGTGAAGG - Intergenic
959169862 3:102831154-102831176 GTGGGCTTCCACCAGAGTGATGG - Intergenic
959500667 3:107102773-107102795 GTGTGTTTGAGGGTGAGTGAAGG - Intergenic
960050154 3:113231952-113231974 GTTTGCCTGCAGCATAGTGATGG + Intronic
962870789 3:139491311-139491333 GTTTGTTTGAGGGAGAGTGAGGG - Intergenic
962989824 3:140567710-140567732 GTGAGCTTGAGGAGGAGTGAAGG - Exonic
963490757 3:145997327-145997349 GTGAGCTTTCAGCAGAGAGATGG - Intergenic
964384438 3:156132100-156132122 CTGTGCTTGAAACAGGGTTAGGG + Intronic
967123115 3:186401301-186401323 GTGTGGCTGGAGCATAGTGAAGG - Intergenic
967986474 3:195098982-195099004 CTGTGCTTGAAGCAATGAGATGG - Intronic
968289501 3:197527635-197527657 CTGTGGCTGAAGCAGAATGAGGG - Intronic
968403362 4:317375-317397 ATGTGCATGAAGCAAAGAGAGGG - Intergenic
969209404 4:5675033-5675055 GTGCCCTTGAAGCACAGTGGCGG - Intronic
970026517 4:11629836-11629858 GTGTGGCTGGAGAAGAGTGAGGG + Intergenic
970247426 4:14077989-14078011 GTGTGCTAAAGGCACAGTGATGG - Intergenic
973607869 4:52605803-52605825 GTGTGGCTGGAGCAGAGAGAAGG - Intronic
973610994 4:52635906-52635928 GTGTTGTTGAAGTTGAGTGATGG + Intronic
976718764 4:88150413-88150435 GTGAGGCTGAAGCAGAGTGAGGG + Intronic
980045660 4:127985338-127985360 CTTTGCTTGAAGGCGAGTGAGGG - Intronic
980914846 4:139024676-139024698 GAGTGCTTGAACCAGGTTGATGG - Intronic
981422798 4:144570723-144570745 CAGTGCTTGGAGCTGAGTGAGGG + Intergenic
981565744 4:146099541-146099563 CTCTGATTGAAGCAGAGTGAGGG + Intergenic
981776082 4:148369147-148369169 TTTTGCATGAAGCAGAATGAGGG - Intronic
982108582 4:152032696-152032718 CAGTTCTTGAAACAGAGTGAGGG - Intergenic
984314786 4:178114518-178114540 CTGTTTCTGAAGCAGAGTGATGG - Intergenic
985093846 4:186392248-186392270 GTGTGCTTGAAGCAGGCTAGTGG + Intergenic
985303546 4:188514592-188514614 TTGCGTTTGAACCAGAGTGAGGG - Intergenic
985889697 5:2705875-2705897 GTGAGCTGGAATGAGAGTGAGGG + Intergenic
986244790 5:5997588-5997610 GTGTGCCTGTGGCAGGGTGATGG + Intergenic
986861071 5:11927337-11927359 GTGTAATTCAATCAGAGTGATGG + Intergenic
987122283 5:14778474-14778496 GTGCACTTGAAGCAGAGTAGAGG - Intronic
988285784 5:29214377-29214399 GAGTGCTTGAACCAGGGAGATGG - Intergenic
990383703 5:55239087-55239109 GTGTGCCTAGAGCAGAGTAAGGG + Intergenic
990981353 5:61604991-61605013 GTGTCCTTGAACCAAAGCGAAGG + Intergenic
998206691 5:140162361-140162383 CTGTGGCTGGAGCAGAGTGAGGG - Intergenic
998518430 5:142777783-142777805 TTGTGACTGTAGCAGAGTGAAGG + Intronic
999359874 5:150974527-150974549 TAGTTGTTGAAGCAGAGTGATGG - Intergenic
999954031 5:156680953-156680975 GAGTGCAGGAACCAGAGTGAAGG + Intronic
1002056714 5:176602089-176602111 GCGTGGCTGAAGCAGCGTGAGGG - Intronic
1004296148 6:14413145-14413167 ACATGCTAGAAGCAGAGTGAGGG - Intergenic
1004576875 6:16904920-16904942 GTGTGATGGAAGCAAAGCGATGG + Intergenic
1004696351 6:18036990-18037012 GTGTGGCTGCAGCAGACTGACGG + Intergenic
1005902079 6:30225483-30225505 GTGTGTCTGGACCAGAGTGAAGG + Intergenic
1006753316 6:36393291-36393313 GTGTGGCTGAAGCTGAGTGAGGG - Intronic
1007718878 6:43873642-43873664 GTATGTTTGGAGCAGAATGAAGG + Intergenic
1008851915 6:56032739-56032761 TTGTGCTTCCAGCAGAGGGAGGG - Intergenic
1009550406 6:65085456-65085478 GCTGGCTTGAAGCACAGTGATGG - Intronic
1009600611 6:65792586-65792608 GTGTAGATGAAGTAGAGTGAGGG + Intergenic
1011050692 6:83145783-83145805 TTTTGATTGAAGCAGTGTGAGGG - Intronic
1013044305 6:106469101-106469123 ATGTGGCTGAGGCAGAGTGAGGG - Intergenic
1015613753 6:135053645-135053667 GTATGCTTTAACTAGAGTGAGGG - Intronic
1016655803 6:146517149-146517171 GTGTGATTGGAGCAGAGTCAGGG + Intergenic
1018111754 6:160543265-160543287 GTGGGCTTGCTGCAGAGAGAAGG - Intronic
1019508592 7:1405741-1405763 GTGGGCTTGTGGCAGAGGGAGGG - Intergenic
1019649343 7:2148351-2148373 GTGGGCTTGCGGCAGAGGGAAGG - Intronic
1019698246 7:2459944-2459966 GTGTGTTGGAATCAAAGTGAGGG + Intergenic
1019713814 7:2529425-2529447 GTCTCCTTGGAGCAGAGTGGGGG - Intergenic
1020714234 7:11649600-11649622 GGCTGCTTGAAGCAGACTGAAGG + Intronic
1020891034 7:13877942-13877964 GTATGCCTGAAGTAGAATGAGGG - Intergenic
1021941092 7:25679619-25679641 GTGTGCTTGAGTCAAAGAGAAGG - Intergenic
1021961675 7:25879224-25879246 ATGTTCTTGAGGCACAGTGAGGG + Intergenic
1022321649 7:29293559-29293581 GTGTGTCTGGAGCTGAGTGAGGG - Intronic
1023282311 7:38583778-38583800 GTGCCCTGGAGGCAGAGTGAGGG + Intronic
1023310704 7:38883337-38883359 GTGTGGCTGGAGCAGAGTGGTGG - Intronic
1025226892 7:57173334-57173356 GTGTTCTTGAAGTACAGTGATGG - Intergenic
1025229959 7:57196615-57196637 GTGTTCTTGAAGTACAGTGATGG - Intergenic
1025251464 7:57354085-57354107 GTCTGCTTGAAGTCGAGAGAAGG - Intergenic
1026545793 7:71321011-71321033 GAGTGCTTGGAGCATAGTGGAGG + Intronic
1027301393 7:76840501-76840523 TTGTGCTTTCAGCAAAGTGAGGG + Intergenic
1027840996 7:83311672-83311694 GTGTGTTTGAAGTAGAGACAGGG - Intergenic
1028829593 7:95312875-95312897 TTGTGCTGGGAGCAGAGTGAAGG + Intronic
1028957463 7:96709812-96709834 GTTTCCTTGAGGAAGAGTGAGGG - Exonic
1030654898 7:112156208-112156230 GTGTGCTGGACACAGTGTGAGGG - Intronic
1031484216 7:122309031-122309053 GTGTGATGGAGGCAGGGTGACGG + Intronic
1031679925 7:124659140-124659162 GTGTGCTAGAAACACAGTGGTGG - Intergenic
1032876457 7:136043799-136043821 TTGTGATTGCAGAAGAGTGAGGG + Intergenic
1033543913 7:142382385-142382407 GTGTTCTTCAAGCTGAATGAGGG + Intergenic
1033760984 7:144436484-144436506 GTCTGCTTGAAGCATTGTGTGGG + Intergenic
1034766709 7:153730125-153730147 GCGTGCCTGAAGCAGAATCAGGG + Intergenic
1035421999 7:158737446-158737468 CTCTGCTTGTAACAGAGTGACGG + Intronic
1035885269 8:3284701-3284723 ATGTGTTTGAAGCAGATGGAAGG + Intronic
1035920657 8:3672422-3672444 GTGTGCTGGTATCAGAGTGTGGG + Intronic
1036573194 8:9999797-9999819 GTGTGTGTGATGCAGAGTGATGG + Intergenic
1037276629 8:17187204-17187226 GAGGGCTTTAAGTAGAGTGATGG + Intronic
1038040454 8:23719932-23719954 GTGTCCTGGAAGCCAAGTGAAGG + Intergenic
1038479737 8:27893562-27893584 GTGTGTTTGAAGTAGAGGGGAGG - Intronic
1039776728 8:40744553-40744575 GGGTGCTGGAAGTGGAGTGAAGG - Intronic
1040085435 8:43335208-43335230 GTGTGGCTGAAGCAGAGCAAAGG - Intergenic
1040407325 8:47118333-47118355 GTGTGGTTGAAGCAGAGCAAAGG + Intergenic
1041305319 8:56451540-56451562 TTGTGCTTCAAGCAGTGGGAGGG + Intergenic
1042461522 8:69074590-69074612 GTGTGCTTGAAAGAGAGTGAAGG + Intergenic
1042926017 8:73969493-73969515 GTGTGACTGGAGCATAGTGAAGG - Intronic
1042998094 8:74723267-74723289 GTGTATTTGAAGAAGAATGATGG - Intronic
1043081521 8:75771385-75771407 GTGTGTTTGAGACAGAGAGAGGG + Intergenic
1043254925 8:78123135-78123157 GTGTGTCTGAAGCAAAGTGAAGG + Intergenic
1046684174 8:117206071-117206093 GGTAGCTTGGAGCAGAGTGATGG + Intergenic
1048917942 8:139202393-139202415 CTGTGCAAGAAGCATAGTGATGG + Intergenic
1048947682 8:139465065-139465087 GTTTGGCTGAAGCAGATTGATGG - Intergenic
1051783247 9:20713268-20713290 ATGTGCATACAGCAGAGTGAAGG - Intronic
1052779023 9:32761446-32761468 GTGTGCTTAAGGCTGAGTGAAGG - Intergenic
1053943460 9:43279723-43279745 GTGTGAGTGGAACAGAGTGAAGG - Intergenic
1055943969 9:81676281-81676303 GTCTGCTTGAAGCTGAGTTAGGG - Intronic
1057226076 9:93293877-93293899 GTGTGCCAGAAACAGAGTGGTGG - Intronic
1058365712 9:104206144-104206166 TTGTGCTTCCAGCAGAGGGAGGG + Intergenic
1058808445 9:108616159-108616181 GTGGGCTTGAAGAAGACTCAAGG + Intergenic
1059972973 9:119686339-119686361 GTGTTTCTGCAGCAGAGTGACGG - Intergenic
1062563000 9:137150147-137150169 GTGAGCTTAAAGCCGAGTGCAGG - Intronic
1203528659 Un_GL000213v1:115026-115048 GTGTGGCTGAAGCAGAGCAAGGG + Intergenic
1203586580 Un_KI270747v1:9628-9650 GTGTGAGTGGAACAGAGTGAAGG - Intergenic
1186996181 X:15125589-15125611 GTGTAATTGAAGCAGATTAATGG + Intergenic
1187445312 X:19355866-19355888 ATGAGATGGAAGCAGAGTGAAGG + Intronic
1187453087 X:19416242-19416264 GAATGCTTGAAGCTGAGAGACGG + Intronic
1188735319 X:33706125-33706147 GTATGTTTGAAGCACAATGAAGG - Intergenic
1190119213 X:47646854-47646876 GTGTGGCTGGAGCAGAGTGCGGG - Intronic
1190119449 X:47648667-47648689 GTGTGGTTGGAGCACAGTAAGGG + Intronic
1190216090 X:48480399-48480421 CTGTGGTTGGAACAGAGTGAGGG + Intronic
1194261175 X:91698229-91698251 GTGTCCTTGAAAGAGAGTGAGGG - Intergenic
1194592397 X:95815525-95815547 GTGAACTTGAAGCAGAGAGGTGG + Intergenic
1195596744 X:106699752-106699774 GAGTGGTTGAAGCATTGTGAGGG - Intronic
1196830612 X:119772789-119772811 GAGTGGCTGGAGCAGAGTGAGGG - Intergenic
1197850140 X:130849884-130849906 TTATGCTTGAAGCACAGGGAAGG + Intronic
1199979099 X:152911310-152911332 GTCTGCTTGGAGCACAGTGTCGG + Intergenic
1200579825 Y:4937030-4937052 GTGTCCTTGAAAGAGAGTGAGGG - Intergenic
1201898560 Y:19021220-19021242 CTGGGCTGGAAGCAGAGGGATGG + Intergenic
1202595366 Y:26533767-26533789 GGGTGCTTCTAGCAGAGTGATGG - Intergenic