ID: 1146479441

View in Genome Browser
Species Human (GRCh38)
Location 17:33193214-33193236
Sequence GAAGTGATACAACTTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146479437_1146479441 27 Left 1146479437 17:33193164-33193186 CCCTACTTAACTCAACTTAGAAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1146479441 17:33193214-33193236 GAAGTGATACAACTTTCCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 190
1146479438_1146479441 26 Left 1146479438 17:33193165-33193187 CCTACTTAACTCAACTTAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1146479441 17:33193214-33193236 GAAGTGATACAACTTTCCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 190
1146479439_1146479441 4 Left 1146479439 17:33193187-33193209 CCTTTGTTAACACATGATAAGTG 0: 1
1: 0
2: 0
3: 14
4: 126
Right 1146479441 17:33193214-33193236 GAAGTGATACAACTTTCCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146479441 Original CRISPR GAAGTGATACAACTTTCCCC AGG Intronic