ID: 1146479852

View in Genome Browser
Species Human (GRCh38)
Location 17:33196508-33196530
Sequence GAGCATACATAGAATTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146479846_1146479852 16 Left 1146479846 17:33196469-33196491 CCTCCCAAAAGTCCAGACAGGAA 0: 1
1: 0
2: 2
3: 16
4: 171
Right 1146479852 17:33196508-33196530 GAGCATACATAGAATTACAATGG 0: 1
1: 0
2: 0
3: 13
4: 200
1146479848_1146479852 13 Left 1146479848 17:33196472-33196494 CCCAAAAGTCCAGACAGGAAGGT 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1146479852 17:33196508-33196530 GAGCATACATAGAATTACAATGG 0: 1
1: 0
2: 0
3: 13
4: 200
1146479849_1146479852 12 Left 1146479849 17:33196473-33196495 CCAAAAGTCCAGACAGGAAGGTG 0: 1
1: 0
2: 2
3: 18
4: 183
Right 1146479852 17:33196508-33196530 GAGCATACATAGAATTACAATGG 0: 1
1: 0
2: 0
3: 13
4: 200
1146479850_1146479852 4 Left 1146479850 17:33196481-33196503 CCAGACAGGAAGGTGTAGCCAGC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1146479852 17:33196508-33196530 GAGCATACATAGAATTACAATGG 0: 1
1: 0
2: 0
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146479852 Original CRISPR GAGCATACATAGAATTACAA TGG Intronic
900826606 1:4932036-4932058 GAGAATACTTAGAATTTCATGGG + Intergenic
904676966 1:32204606-32204628 AAGGATACATAGAATTACTGAGG - Exonic
904933042 1:34105634-34105656 CAAAATACATAGAATTGCAAAGG + Intronic
905456362 1:38090885-38090907 GAGTTTAGAAAGAATTACAAAGG + Intergenic
906674719 1:47685046-47685068 GAGCATTCATAAAATTCCTAGGG + Intergenic
907744790 1:57202276-57202298 TTGCATACATAAAAATACAAGGG + Intronic
910903863 1:92152407-92152429 GTGTATACATAGAATCACACAGG + Intergenic
913127421 1:115805671-115805693 GAGCATCCATAGAGATAGAAGGG - Intergenic
913295152 1:117312097-117312119 GAGGAAACAGAGAATTAGAAAGG + Intergenic
916320051 1:163494282-163494304 GCCAATACAGAGAATTACAAAGG + Intergenic
916877625 1:168986815-168986837 TAAAATACATAGAATTGCAAAGG - Intergenic
917018912 1:170564812-170564834 GAGCATTCATGCAATTACATAGG + Intergenic
917896609 1:179495490-179495512 GCTAATATATAGAATTACAATGG + Intronic
918359454 1:183740979-183741001 TAGAGTACATAGAATAACAAAGG + Intronic
919941745 1:202291873-202291895 CTGCATGCATAGCATTACAATGG - Intronic
920572710 1:207029961-207029983 AAGCATACTTAGAAGCACAAGGG - Intronic
920855749 1:209659895-209659917 GAGCACACAGAGAAATAGAAAGG - Intergenic
923014728 1:230117981-230118003 GAGCACACAGACAATTCCAAGGG - Intronic
923901776 1:238333851-238333873 GAGAATACATAGTGTTACAAAGG + Intergenic
1064303610 10:14145089-14145111 GAGCTTACATAGAAACAGAATGG + Intronic
1066588825 10:36969677-36969699 GAGCATACATAGTAGTAGAATGG - Intergenic
1066994061 10:42546716-42546738 AAGTTTACATAGAATTTCAAGGG + Intergenic
1069038414 10:63669673-63669695 GAGAATGCATAGAATTACCTAGG + Intergenic
1069966156 10:72119039-72119061 GTGGATACAGAGAATCACAAGGG + Intronic
1075277223 10:121105042-121105064 GAGCACAAAGAAAATTACAAAGG - Intergenic
1081204399 11:40258407-40258429 CAATATACATAGAATTAGAATGG - Intronic
1083363441 11:62127465-62127487 GAGCATAAATAGAACAAGAAGGG - Intronic
1084969571 11:72763532-72763554 TAACATAAATAGAATCACAAGGG + Intronic
1085899247 11:80678266-80678288 GAGCATACATAGTAGTAGAATGG + Intergenic
1086829401 11:91541219-91541241 GAGAACACAAAGAATTAAAAAGG + Intergenic
1088770017 11:113025210-113025232 AAGTATACATAGAATTATACTGG + Intronic
1089451159 11:118598049-118598071 GATCATACAATGAATTAGAAAGG - Intronic
1090566916 11:128004746-128004768 GAGGATACAGAGATATACAAAGG + Intergenic
1091554876 12:1565207-1565229 GACCTTATATTGAATTACAAAGG - Intronic
1091951163 12:4594175-4594197 GCGCATACATAAAATTATAGGGG + Intronic
1092157389 12:6292688-6292710 GAGCATTCATCTAATTGCAAAGG + Intergenic
1092232653 12:6785062-6785084 GAGCAAACAGAGCATTCCAAGGG - Intergenic
1095208682 12:39467947-39467969 CAGCCTTCATAGAATTAAAAAGG - Intergenic
1097215648 12:57410364-57410386 AAACATACATGGAATTACTAAGG + Intronic
1097788304 12:63786056-63786078 GAGCTTAAATAGACTTACAATGG + Intronic
1099566977 12:84263768-84263790 GAGCAATCTTAGAATTATAAGGG + Intergenic
1101172924 12:102118594-102118616 GAGCACAGGTACAATTACAATGG + Intronic
1102801227 12:115736172-115736194 GCATATACATAGAATTACAAAGG - Intergenic
1106998599 13:35518212-35518234 TATCATACATATAACTACAAAGG - Intronic
1107472043 13:40699752-40699774 TAAAATACATAGGATTACAAAGG + Intergenic
1107532458 13:41297125-41297147 AAGCAGAAAAAGAATTACAAGGG + Intergenic
1107766263 13:43738407-43738429 GGCCATGTATAGAATTACAAAGG + Intronic
1107803124 13:44129090-44129112 TAAAATACATGGAATTACAAAGG + Intergenic
1108136852 13:47373757-47373779 GAGAATAAATAGAAATACACAGG + Intergenic
1108923213 13:55702298-55702320 GAATATAAATTGAATTACAAGGG + Intergenic
1108976413 13:56448970-56448992 GTGCATACATCAAATTACTATGG - Intergenic
1109895427 13:68681276-68681298 AGGCATATATAGAATTAGAAGGG + Intergenic
1110438306 13:75499334-75499356 GAACAAACAGAGAATTACTAAGG + Intergenic
1111815477 13:93147642-93147664 AAGCCTACATAAAATTACCAAGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1114145105 14:19966145-19966167 GACCAAAGAAAGAATTACAAGGG + Intergenic
1115050054 14:29048380-29048402 AAGCATACATAGAACTAGAAGGG - Intergenic
1118996679 14:70842754-70842776 ATGCATACATAGAAGTGCAAAGG + Intergenic
1120110323 14:80546802-80546824 GAGCCTAAAGAGAATAACAATGG + Intronic
1120452867 14:84692439-84692461 GAGAATACAGAGATTTAGAATGG + Intergenic
1121301595 14:92875900-92875922 GAGCTTACATATAAACACAAAGG + Intergenic
1122596398 14:102895948-102895970 GAGAATACAAAAAATTACATGGG - Intronic
1124454737 15:29831464-29831486 GTGCATAAACAGAAATACAAGGG + Intronic
1126639079 15:50806616-50806638 GAGAATCCAAAGTATTACAAGGG + Intergenic
1127592524 15:60439921-60439943 GAACATAAATGGAATTACAGAGG - Intronic
1127822709 15:62674116-62674138 GTGCATACATTTAATTTCAAAGG + Intronic
1127912981 15:63433619-63433641 TAACATACAGAGAATTATAAAGG + Intergenic
1132108318 15:99082354-99082376 GCTCATATATAGAAATACAATGG - Intergenic
1133187615 16:4111163-4111185 GGGCATCCATAGAATGAGAAGGG - Intronic
1135465662 16:22682621-22682643 GAGCATAGATAGTAGTAAAATGG - Intergenic
1138233148 16:55354806-55354828 TAACATACACAGAATTAGAAAGG + Intergenic
1140079651 16:71733116-71733138 AAGCTTACATATAATCACAAGGG - Exonic
1144255844 17:13466323-13466345 GTGCTCACATAAAATTACAAAGG - Intergenic
1144514039 17:15902745-15902767 GAGCTGACATACCATTACAAAGG + Intergenic
1146479852 17:33196508-33196530 GAGCATACATAGAATTACAATGG + Intronic
1147305258 17:39559385-39559407 GTGGATACATAAAATTACACAGG - Intronic
1151117382 17:71752532-71752554 GAACATACAAATAATTACTAGGG - Intergenic
1153153749 18:2125931-2125953 GAGGATGCACAGAATTACAGTGG - Intergenic
1153422725 18:4926380-4926402 GAGAATACATAGAATGTGAATGG + Intergenic
1154035396 18:10796599-10796621 GAGGATAAATAGAATTGAAAAGG + Intronic
1155980595 18:32175692-32175714 AAATATACATAGGATTACAAAGG + Intronic
1156661997 18:39357267-39357289 GAGCATAAACAGAATGGCAAAGG - Intergenic
1158630335 18:59108366-59108388 GAGAATACCTAGAAACACAATGG + Intergenic
1166881133 19:45930794-45930816 GAGTATAGAGAGAATTGCAAAGG - Intergenic
924989247 2:297507-297529 GAACAAACCTACAATTACAAAGG - Intergenic
925475064 2:4204187-4204209 GAAAATACATAAAATTGCAAGGG - Intergenic
925683805 2:6450580-6450602 AAGAGTACATAGCATTACAAAGG + Intergenic
926531244 2:14048851-14048873 GTACATACATATAAATACAAAGG + Intergenic
927429825 2:23018168-23018190 TAAAATACATAGAATTGCAAAGG - Intergenic
928018959 2:27685922-27685944 GATCATACATAAAAGTCCAAAGG + Intronic
928247934 2:29647514-29647536 GAGTCTACCTATAATTACAAAGG - Intronic
928330412 2:30353578-30353600 GACCACACATCGAATTGCAAAGG - Intergenic
929954981 2:46450842-46450864 CAGAATACATGGAATTTCAAAGG + Intronic
930407531 2:50978990-50979012 TAAAATACATAGAATTACATAGG + Intronic
931856688 2:66309080-66309102 GAGCATTCACAGAATTTTAAAGG + Intergenic
933422633 2:82070137-82070159 GAGTATATAAAGAATTACTATGG + Intergenic
934931406 2:98428673-98428695 GACCTTACATAGAATAACAACGG - Intergenic
935143722 2:100379248-100379270 GAGCATGTACAGCATTACAATGG + Intergenic
937554433 2:123135465-123135487 GAGAATACATAGATATAAAAAGG - Intergenic
940514342 2:154661746-154661768 GAGCATAGATAGACTTCCCATGG + Intergenic
940831753 2:158474450-158474472 GAGAATTCACAGAATTACATCGG + Intronic
941758809 2:169218337-169218359 AAGCATACCTAGAATTTCACTGG - Intronic
942108912 2:172660641-172660663 CAGCATAAATAAAATTTCAAGGG - Intergenic
942304192 2:174589875-174589897 TAAAATACAGAGAATTACAAAGG - Intronic
942539095 2:176996425-176996447 CAGAATACATAAAATTGCAAGGG + Intergenic
942659720 2:178251481-178251503 GAGCAGAAATAAAATGACAAGGG + Intronic
943083360 2:183283016-183283038 CAGCATACATTAAATCACAAAGG - Intergenic
943161620 2:184261050-184261072 GAGTATACATAAAAACACAAAGG - Intergenic
943497535 2:188641607-188641629 CAGAATACATAGAAATAAAATGG + Intergenic
945049943 2:205814188-205814210 GAACATACATAGAATGAGTAAGG - Intergenic
945463986 2:210145632-210145654 GGGCACACAGGGAATTACAAAGG + Intronic
946262208 2:218503413-218503435 TAACATACATAGAAGTAAAATGG + Intronic
946683087 2:222238543-222238565 GGGCAAACATAGAATTTAAATGG - Intronic
1169134545 20:3189387-3189409 GTGGAAACATAAAATTACAAAGG - Intergenic
1169138471 20:3212182-3212204 TAAAATACATAGGATTACAAAGG + Intronic
1169535640 20:6537003-6537025 GAACATACACAGAAAAACAAAGG - Intergenic
1169802459 20:9524217-9524239 TAAAATACATACAATTACAAGGG - Intronic
1171080961 20:22184125-22184147 GAGGATACAAAGAATAAAAAAGG - Intergenic
1173324101 20:42016980-42017002 GTGGCTACATGGAATTACAAGGG + Intergenic
1174043841 20:47719290-47719312 GAAAATACAGAGAATTACAAAGG - Intronic
1177127938 21:17219184-17219206 GAGCACACATAGACTATCAAAGG + Intergenic
1178165344 21:29968436-29968458 GAACAGACAAAGAATTACCAGGG + Intergenic
1178195045 21:30335072-30335094 GTTGATACATAGAATTACCATGG + Intergenic
1178634877 21:34293442-34293464 GAGCTTAAATAGAAGTACACAGG - Intergenic
1179242865 21:39607459-39607481 GAGCATCCACATAATAACAATGG - Intronic
1184033535 22:41908247-41908269 GAGCCTACACAGACTCACAAAGG - Intergenic
949116159 3:326970-326992 AAGTATGGATAGAATTACAATGG + Intronic
950777535 3:15363529-15363551 GAAAACACATAGGATTACAAAGG + Intergenic
951211526 3:19980764-19980786 TAGCATAAATAGCATTATAATGG - Intronic
955084025 3:55685131-55685153 TAAAATACATAGAAATACAAAGG - Intronic
955932377 3:64070404-64070426 GAGCAGACATAGAAAGAGAAAGG - Intergenic
956918852 3:73904657-73904679 GAGATTACATAAAATTACAGAGG + Intergenic
956964746 3:74445614-74445636 AAGCAAACATAGCATTACTAAGG + Intronic
957964247 3:87302159-87302181 AAGCATACATAGAATAGGAATGG - Intergenic
959195291 3:103172776-103172798 ATGCATACAGAGAATTACAGAGG - Intergenic
959650597 3:108746784-108746806 GGGGAGACATAGAATTAGAATGG + Intronic
959953055 3:112202941-112202963 GAACATAGATAGAAAAACAAAGG - Intronic
964336524 3:155660501-155660523 GAGAATACAGAGATTGACAAAGG + Intronic
964557521 3:157956074-157956096 TAGCATAAATAAAATTAAAATGG + Intergenic
970719530 4:18970424-18970446 GAGAATACATAGAATTATTGGGG + Intergenic
972149317 4:36068803-36068825 GAACATACATAAAATAAAAAAGG - Intronic
972209149 4:36815699-36815721 CAGCATACATTAAATGACAAAGG + Intergenic
973188223 4:47355915-47355937 GAGCAAACACAGACTTAGAAGGG - Intronic
973783892 4:54317410-54317432 TAACATAGCTAGAATTACAAAGG + Intergenic
973952667 4:56032981-56033003 TGGGATACATAAAATTACAAAGG - Exonic
974616296 4:64287347-64287369 TAAAATACATATAATTACAAGGG - Intronic
974830892 4:67188146-67188168 AATCATACTTAGAATTAAAAAGG - Intergenic
975525342 4:75342695-75342717 GAGTATACATAGAGTTTCTATGG + Intergenic
976137942 4:81959430-81959452 TAGAACACAGAGAATTACAAAGG - Intronic
976350148 4:84051670-84051692 GAGCATCCATAAAATGACAAAGG - Intergenic
980703360 4:136459653-136459675 GACCACACACAGAATTACACAGG + Intergenic
981781761 4:148439007-148439029 GAAAATAAATAAAATTACAAAGG + Intronic
981803193 4:148681877-148681899 GAGCAAATACAGTATTACAAGGG + Intergenic
982403547 4:154995575-154995597 GAGCATACCTAGAGTATCAAAGG - Intergenic
984293441 4:177824228-177824250 TAGCATACATATAAAAACAATGG - Intronic
984986125 4:185331308-185331330 GAGAATAATTAGAATAACAATGG - Intronic
986927082 5:12767843-12767865 TACCATACATAGAATTTCATTGG - Intergenic
989244359 5:39237315-39237337 GTGCATACATGGAAGTAAAAGGG + Intronic
990330282 5:54719146-54719168 ATACATACATAGAATTATAAAGG - Intergenic
990672487 5:58148664-58148686 AAGGATACATAGAATTCCAATGG - Intergenic
993761746 5:91803676-91803698 GAGCATGCATATATTGACAAAGG + Intergenic
993995175 5:94713859-94713881 GGGCATACATAGAATTTGAAAGG - Intronic
994932526 5:106207072-106207094 AAGAAAAAATAGAATTACAAAGG + Intergenic
996442286 5:123505613-123505635 GAGCATAGATAGTATTGTAAAGG + Intergenic
997594608 5:135098172-135098194 GACTATACATAAAAGTACAAAGG + Intronic
1000819178 5:165962063-165962085 GCGCATACTTTGAAATACAAAGG + Intergenic
1000946485 5:167428502-167428524 GAGCATATATAAAATAAAAAAGG - Intronic
1003675163 6:8197116-8197138 GAGCATACAGAGCAGTACAGTGG - Intergenic
1006989413 6:38200441-38200463 GAGACTACATAAAAATACAAAGG + Intronic
1008096426 6:47344010-47344032 GAGAATACATAGAAGCACAGAGG - Intergenic
1008582842 6:52922068-52922090 CAGCAGACATAGAGTTAAAAAGG + Intergenic
1011073953 6:83417896-83417918 CAGTATACATAATATTACAAAGG - Intronic
1011964968 6:93144300-93144322 TAACATACAAAGACTTACAAAGG + Intergenic
1012185918 6:96216928-96216950 GAGCATACATTGAATAAATATGG + Intergenic
1013985825 6:116192198-116192220 GAGCAAACAGAGACTTACAGAGG - Intronic
1015540313 6:134306892-134306914 GAGAATACAAAGAAATAAAAGGG + Intronic
1016361128 6:143268514-143268536 GACCATATATAAAATTACAGGGG + Intronic
1016656792 6:146527688-146527710 AAATAAACATAGAATTACAATGG + Intergenic
1016733585 6:147452269-147452291 GAGCAAACATAAGATTCCAATGG + Intergenic
1018288288 6:162264339-162264361 GAGCATTCCTAAAATGACAATGG - Intronic
1018511938 6:164533706-164533728 TAGCATTCATAGGAATACAAAGG + Intergenic
1018660738 6:166084807-166084829 TAGCATACGTACAATTACACTGG - Intergenic
1024197969 7:47078567-47078589 GAGCATACATACAAACACGAAGG + Intergenic
1026106616 7:67426115-67426137 AAGTATACATGGAAATACAAAGG - Intergenic
1031843618 7:126777248-126777270 GAGGATACAAATAATTAAAATGG + Intronic
1031951786 7:127900266-127900288 GAGCTTACAAAGAAATTCAAAGG - Intronic
1033810793 7:145008531-145008553 GATCATGCATAGAATCATAATGG + Intergenic
1040945108 8:52875960-52875982 GGAAATACATAGAATTATAAAGG + Intergenic
1042658612 8:71129425-71129447 GAGAATACCAAGAATTACAAAGG - Intergenic
1045667585 8:104506189-104506211 AAAAATACATAGCATTACAAAGG - Intronic
1046110004 8:109711465-109711487 GATCATACATATGTTTACAAAGG - Intergenic
1046196389 8:110868393-110868415 GAGAATACCTAAAATTAAAATGG - Intergenic
1047578980 8:126191484-126191506 AAGTATACACAGAATTTCAAAGG + Intergenic
1048176382 8:132156342-132156364 GAGCACACAGCTAATTACAAGGG + Intronic
1048904028 8:139069609-139069631 TAGCATACGGAGAATGACAATGG + Intergenic
1050477508 9:6055241-6055263 TACAATACATGGAATTACAAAGG - Intergenic
1051350534 9:16194291-16194313 TAGCATACAAACAATTGCAATGG + Intergenic
1056419736 9:86412296-86412318 GAGCCTGCAGAGAGTTACAATGG + Intergenic
1187238305 X:17488586-17488608 GAAAATATGTAGAATTACAAAGG + Intronic
1187878927 X:23828371-23828393 GAGAACACATAGAAGAACAAGGG - Intergenic
1188528253 X:31109023-31109045 GAAAATACATGGACTTACAAAGG - Intronic
1189165273 X:38854920-38854942 TAAAATACATAGAATTTCAAAGG + Intergenic
1192557795 X:72104343-72104365 TAAAATACATAGGATTACAAAGG - Intergenic
1192560028 X:72122099-72122121 TAAAATACATAGAATCACAAAGG - Intergenic
1194045631 X:88998461-88998483 GAGCAAACTTAGAGCTACAATGG - Intergenic
1194573441 X:95581546-95581568 GAGCATATATATATATACAATGG + Intergenic
1195345772 X:103949829-103949851 GAGTATACATAGAAATGCAAAGG + Intronic
1195778503 X:108434489-108434511 TAAAATACATAGGATTACAATGG + Intronic
1196158628 X:112457987-112458009 TAGCATAAAGAGAGTTACAAGGG + Intergenic
1196590949 X:117484764-117484786 GAGAATTCTTTGAATTACAAGGG + Intergenic
1197260128 X:124308569-124308591 CAAAATACATAGGATTACAAAGG - Intronic
1198546412 X:137697220-137697242 TAACATACATAGAATTATGAAGG - Intergenic
1199039021 X:143088513-143088535 GTGGATATCTAGAATTACAATGG + Intergenic
1199511867 X:148631398-148631420 GCACATACGTAGAAGTACAAGGG + Intronic