ID: 1146481996

View in Genome Browser
Species Human (GRCh38)
Location 17:33212270-33212292
Sequence TGATCTCAATGTAGTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146481994_1146481996 -8 Left 1146481994 17:33212255-33212277 CCTGGATTATCTGGGTGATCTCA 0: 1
1: 3
2: 25
3: 213
4: 658
Right 1146481996 17:33212270-33212292 TGATCTCAATGTAGTCCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 109
1146481990_1146481996 12 Left 1146481990 17:33212235-33212257 CCTTGAGATAAGAAGATTATCCT 0: 1
1: 5
2: 33
3: 177
4: 594
Right 1146481996 17:33212270-33212292 TGATCTCAATGTAGTCCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146481996 Original CRISPR TGATCTCAATGTAGTCCTGA GGG Intronic
900982954 1:6056970-6056992 TGATCTCAAAGCAGTGCAGATGG - Intronic
902803105 1:18843141-18843163 CGATCTCAATGTAGTCCACATGG + Intronic
904224923 1:29008903-29008925 GGATCTAAATGGAGTCTTGAAGG - Intronic
908050177 1:60220954-60220976 TGGTTTAATTGTAGTCCTGAAGG + Intergenic
913301486 1:117374561-117374583 TGAATTTAATGTAGTCCAGAAGG + Intronic
915016783 1:152741724-152741746 TGAAATAAATGTATTCCTGAGGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
920808354 1:209256633-209256655 TGCTTTCAATGTAGTACTCAAGG - Intergenic
922528882 1:226327791-226327813 TGTTCTCAATTTCTTCCTGAGGG - Intergenic
1063449489 10:6142021-6142043 TGAACTCAGGGCAGTCCTGAGGG - Intergenic
1063887435 10:10593994-10594016 TGATCACGATGAAGTCATGATGG - Intergenic
1063967696 10:11359637-11359659 TGTTCTCAATCAAGTCCTCATGG - Intergenic
1065293411 10:24253200-24253222 TAATCTTAATATAGTGCTGAGGG + Intronic
1067126692 10:43523121-43523143 TGGTCTGAAAGTAATCCTGAAGG - Intergenic
1072212411 10:93258632-93258654 TGATCTCAGTCTTGTCCTTAAGG + Intergenic
1073113736 10:101079116-101079138 TGATCTGAATGAAGCCCAGAAGG + Intergenic
1076663100 10:132068526-132068548 TTATCTCAATATAGCCCTGTTGG + Intergenic
1090804820 11:130196416-130196438 TGATCTCCACGTAGTCCTTGGGG - Exonic
1092953675 12:13530320-13530342 TGAACGCAATGAAGTCCTGAAGG - Intergenic
1101239646 12:102825061-102825083 TGATCTCTAGGCAGTCCTGCTGG + Intergenic
1103448795 12:121013278-121013300 TCATCACACTGTAGTCATGATGG - Intronic
1104742933 12:131192133-131192155 TGATCCCAATGTACTCATAATGG - Intergenic
1108364765 13:49698732-49698754 TGTTCTAAATGTCTTCCTGAGGG + Intergenic
1112287615 13:98118082-98118104 TGTTCTAAATTTATTCCTGAGGG - Intergenic
1112777204 13:102857383-102857405 TGATATCAATGCCTTCCTGATGG + Intronic
1112942849 13:104886779-104886801 TGATATCAAAGCAGTCATGATGG - Intergenic
1116597117 14:46864700-46864722 TGCTCTCAGTGAAGTCCTGTTGG - Intronic
1117605385 14:57423371-57423393 TGTTCTCAGTGTAGCCCTTATGG + Intergenic
1119235301 14:73014734-73014756 TGACCAGAATGAAGTCCTGAAGG + Intronic
1120090234 14:80323179-80323201 TGATATCTTTGCAGTCCTGAAGG + Intronic
1122535460 14:102458736-102458758 CGATCTCAACTGAGTCCTGAAGG - Intronic
1132197284 15:99925064-99925086 TGAGCTGAATTTTGTCCTGAAGG - Intergenic
1137365054 16:47853185-47853207 TGTTCTCAATTTCTTCCTGAGGG - Intergenic
1139064400 16:63294200-63294222 TGATTTCAATATTGCCCTGAGGG - Intergenic
1139509650 16:67419852-67419874 TGAGCTCAATGTAGTCACAAAGG + Intergenic
1142467876 17:146413-146435 TGATCTCTTTCTACTCCTGAGGG - Intergenic
1146481996 17:33212270-33212292 TGATCTCAATGTAGTCCTGAGGG + Intronic
1148427534 17:47612461-47612483 TCATCTCGATGCACTCCTGAGGG + Exonic
1149266524 17:54933318-54933340 TGAACCCAATGTAGTCATAAAGG - Intronic
1151475891 17:74344216-74344238 TCATCTCATTGTAGATCTGACGG - Exonic
1151842439 17:76627749-76627771 TGGGCTCATTGTGGTCCTGAGGG + Intronic
1152788615 17:82265713-82265735 TGCTCTCAATGTGGAGCTGAGGG + Exonic
1153204532 18:2682750-2682772 TGATGTAAATTTATTCCTGAAGG + Intronic
1155685420 18:28542507-28542529 TCATCTTGATATAGTCCTGAAGG + Intergenic
1157448758 18:47769323-47769345 TGATGACACTGTAGTCCTGCCGG - Intergenic
1163265944 19:16222015-16222037 TCATGTCACTGGAGTCCTGAAGG - Intronic
1168368431 19:55810153-55810175 CAATCTCAATGTGTTCCTGATGG - Exonic
933105786 2:78323453-78323475 TGATCTAATTGTTGTCCTTATGG - Intergenic
938705757 2:133924102-133924124 TGAGCTCAATGTAATCACGAAGG + Intergenic
944036929 2:195305757-195305779 TAATCTCTATGTAGAACTGATGG - Intergenic
945604012 2:211905335-211905357 TGGTCCCAGTGTAATCCTGAGGG - Intronic
1169024037 20:2352217-2352239 TGCTCTCAATGTACTCTGGAGGG - Intergenic
1170065832 20:12309448-12309470 CAACCTCAATCTAGTCCTGAAGG - Intergenic
1170253000 20:14306469-14306491 GGATCTCCATCTAGTCCTGGAGG + Intronic
1175577117 20:60068529-60068551 TAATCTCCACGGAGTCCTGAAGG + Intronic
950748628 3:15110733-15110755 TGATCTCAGTGATGTCCTGAGGG - Intergenic
951472162 3:23068209-23068231 TGTTCTCAATTTCTTCCTGAGGG - Intergenic
953039151 3:39239310-39239332 AGATCTTAATGTATTTCTGATGG + Intergenic
953473500 3:43186118-43186140 TGAACTCAATTTAGTGCTGAAGG - Intergenic
954600419 3:51863337-51863359 TGATCTCAATGTGGAACTGCAGG - Exonic
956381824 3:68672428-68672450 TGATCTTAATGTTGTTCTGTTGG + Intergenic
959446768 3:106450050-106450072 TGATCTCCAGGGAGTGCTGAAGG + Intergenic
961057339 3:123800137-123800159 GGCTCTCAATGGAGTCCTGGGGG + Intronic
961771522 3:129253658-129253680 TGATCTAAGTGGAGTCCTGAAGG + Intronic
963705796 3:148686831-148686853 TGATATAATTGCAGTCCTGATGG - Intergenic
964382373 3:156110346-156110368 TTATGGCAATGTAGGCCTGAGGG - Intronic
966007751 3:175037204-175037226 TCATGTCAATGTTGTCCTGGAGG - Intronic
966742381 3:183245611-183245633 CGGTCTCAATACAGTCCTGAGGG + Intronic
968807929 4:2787328-2787350 AGATCTCAGTGTGTTCCTGAAGG + Intergenic
969782287 4:9416316-9416338 TAAGCTCAATGTACTCCAGATGG - Intergenic
970493796 4:16605036-16605058 TAATCCCAATGGATTCCTGAAGG + Intronic
974846911 4:67362734-67362756 TGATCTAAATGTTGCCATGAAGG - Intergenic
974905554 4:68051013-68051035 TAATCTCTGTGCAGTCCTGATGG - Intergenic
976234800 4:82885134-82885156 TGATGACAAAGTAGTTCTGAAGG - Intronic
976955103 4:90886850-90886872 TGAACTCATTGTAATCCTCATGG + Intronic
978878621 4:113673318-113673340 TGATCACAATGGAGTCCTCTAGG - Intronic
978936679 4:114386148-114386170 TGATCTTCATGTGGTCCTAAGGG + Intergenic
979238372 4:118426394-118426416 TGTTCTCAATTTCTTCCTGAGGG + Intergenic
987486013 5:18527253-18527275 TGCTCTGAATGTAGTGCTGCTGG - Intergenic
993449808 5:88059706-88059728 TCATCTCAATTCAGGCCTGAGGG - Intergenic
994246285 5:97481477-97481499 TTAGCTCAATGAAGACCTGATGG + Intergenic
997649134 5:135502597-135502619 TGCTGTCAATGTAGGCCTTAGGG + Intergenic
1000168438 5:158677969-158677991 TGGTCTCAAAGTATTCCTCATGG - Intergenic
1000791322 5:165611180-165611202 TGATTTCAATACAGTCCTAAAGG + Intergenic
1002315085 5:178338288-178338310 TGATCTCCAGGAAGTCCAGAGGG + Intronic
1008821531 6:55637773-55637795 TGATATCAATTTAATGCTGATGG - Intergenic
1009912745 6:69952671-69952693 TCATCTCACTGCAGTGCTGAGGG - Intronic
1010375619 6:75166031-75166053 GGATGTCAATCTTGTCCTGAAGG - Intronic
1011112774 6:83855793-83855815 TGTTCTCAATGAAAACCTGAGGG + Intronic
1011737059 6:90321457-90321479 TGATCTCAGAGTGTTCCTGAAGG + Intergenic
1013847472 6:114471490-114471512 TGATTTCAATACATTCCTGATGG + Intergenic
1014020801 6:116586858-116586880 TGATCTCACTGTAGTCATTGTGG + Intronic
1014168067 6:118248430-118248452 TGACCTCAATGTAATCATAAAGG + Intronic
1014287752 6:119520537-119520559 TGAACTTCATGTAGTCCTGTGGG + Intergenic
1016150574 6:140736444-140736466 TGTTTTCAATGTAATCCTCAGGG - Intergenic
1018656328 6:166040665-166040687 TGTTCTAAATTTCGTCCTGAGGG + Intergenic
1023726227 7:43145206-43145228 TGAACTCAATGTAGTCTGCATGG + Intronic
1024577875 7:50779731-50779753 TGTTGTCAAGGTAGTCCTGGTGG - Intronic
1026223960 7:68424591-68424613 TGATCTAAATTTCTTCCTGAGGG - Intergenic
1033040495 7:137913288-137913310 TGGTCTCAAGGAAGTTCTGAAGG - Intronic
1041751376 8:61264713-61264735 TGTTCTAAATGTCTTCCTGAGGG - Intronic
1041946321 8:63447384-63447406 TGATTTTAATGAAGTCTTGAAGG + Intergenic
1044802848 8:95974953-95974975 TGAGCTCAGTGTAATCATGAGGG + Intergenic
1046401360 8:113708507-113708529 TGATCTCACTTTAATCCTCATGG + Intergenic
1049929927 9:446363-446385 TGATCTGTATGTAGGCCTAAGGG - Exonic
1053020652 9:34691695-34691717 GGATCTCATGGTTGTCCTGAGGG - Intergenic
1186250083 X:7656352-7656374 TGCTCTAAATTTATTCCTGAGGG - Intergenic
1186579242 X:10799673-10799695 TGATCTCAATGTAGCCTTAAGGG + Intronic
1186674313 X:11799864-11799886 TCTTCTCCATGTAGTCCTCATGG - Intergenic
1188706030 X:33331656-33331678 TGCTGTCAATGTACACCTGAAGG - Intronic
1192544319 X:72000765-72000787 TGGGCTCAATGTAATCATGAGGG - Intergenic
1193692429 X:84662595-84662617 TATTCTAAATGTAATCCTGAAGG - Intergenic
1195037760 X:100985746-100985768 TGACCTGAATGGAGACCTGAAGG + Exonic
1195462872 X:105147041-105147063 TGTTCTAAATGTCTTCCTGAGGG - Intronic
1199164243 X:144651163-144651185 TTATCTTAGTGTAGACCTGAAGG - Intergenic
1200271948 X:154693995-154694017 TGATCTGAATGTAGTGATTAAGG - Intronic
1201465785 Y:14279012-14279034 TGCTCTAAATTTATTCCTGAGGG - Intergenic