ID: 1146481996

View in Genome Browser
Species Human (GRCh38)
Location 17:33212270-33212292
Sequence TGATCTCAATGTAGTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146481994_1146481996 -8 Left 1146481994 17:33212255-33212277 CCTGGATTATCTGGGTGATCTCA 0: 1
1: 3
2: 25
3: 213
4: 658
Right 1146481996 17:33212270-33212292 TGATCTCAATGTAGTCCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 109
1146481990_1146481996 12 Left 1146481990 17:33212235-33212257 CCTTGAGATAAGAAGATTATCCT 0: 1
1: 5
2: 33
3: 177
4: 594
Right 1146481996 17:33212270-33212292 TGATCTCAATGTAGTCCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146481996 Original CRISPR TGATCTCAATGTAGTCCTGA GGG Intronic