ID: 1146482173

View in Genome Browser
Species Human (GRCh38)
Location 17:33213586-33213608
Sequence GACCGCAGGACGATGGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146482173_1146482177 27 Left 1146482173 17:33213586-33213608 CCTGTTACCATCGTCCTGCGGTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1146482177 17:33213636-33213658 AGCTTTCTGATCTGCCAACTGGG 0: 1
1: 0
2: 2
3: 48
4: 591
1146482173_1146482176 26 Left 1146482173 17:33213586-33213608 CCTGTTACCATCGTCCTGCGGTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1146482176 17:33213635-33213657 TAGCTTTCTGATCTGCCAACTGG 0: 1
1: 0
2: 2
3: 17
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146482173 Original CRISPR GACCGCAGGACGATGGTAAC AGG (reversed) Intronic
900132352 1:1092461-1092483 GAAGGCAGGGCCATGGTAACAGG - Intronic
900526746 1:3133128-3133150 GCCCGAAGGACGGTGGTAACCGG + Intronic
902125621 1:14208211-14208233 GTTCGCAGAAGGATGGTAACCGG + Intergenic
904405179 1:30283748-30283770 GACCCCAGGAGGAGGGTCACAGG + Intergenic
904405194 1:30283796-30283818 GACCCCAGGAGGAAGGTCACAGG + Intergenic
1068300990 10:55138778-55138800 GACCGCAGGTTGATGGTATAGGG - Intronic
1079368076 11:19826889-19826911 CACCGCAGGAGGCTGGTAAGTGG - Intronic
1100601266 12:96113447-96113469 AACCGCTGGACCATGGTCACTGG - Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1119136166 14:72222478-72222500 GACTCCAGGAAGATGGGAACTGG - Intronic
1136156705 16:28387915-28387937 GACTGCAGGATGCTGGCAACTGG + Intronic
1136206381 16:28727366-28727388 GACTGCAGGATGCTGGCAACTGG - Intronic
1144576338 17:16432050-16432072 GACAGGAGGACGAGGGCAACGGG + Exonic
1146482173 17:33213586-33213608 GACCGCAGGACGATGGTAACAGG - Intronic
930055712 2:47250605-47250627 GGCTGCAGGAGGATGGGAACGGG + Intergenic
1176861667 21:14014467-14014489 AACCGCATGACGAGGCTAACAGG - Intergenic
1177154584 21:17488422-17488444 GTGCTCAGGAGGATGGTAACAGG - Intergenic
1180191510 21:46166810-46166832 GACCCCAGTACAATAGTAACTGG + Intronic
1184842881 22:47062977-47062999 GAGCGCAGGAACATGGAAACAGG + Intronic
950538747 3:13597390-13597412 GCCATCAGGACGGTGGTAACTGG - Intronic
953069833 3:39508072-39508094 CACAGCAGGACGATAGTAGCTGG + Intronic
955726713 3:61941193-61941215 GACTGCAGGACAATGGTTGCTGG - Intronic
984446511 4:179843547-179843569 GACCACAGGAGGATGGTCAGTGG + Intergenic
985096376 4:186416757-186416779 GACAGCAGGAGGATGGGAAATGG + Intergenic
1002533112 5:179860516-179860538 GACCGCAGGCTGTTGGAAACTGG - Exonic
1004251821 6:14029135-14029157 AACCGCAGGACTATGGCATCAGG - Intergenic
1012132978 6:95519623-95519645 AACCGCATGTTGATGGTAACAGG - Intergenic
1026850046 7:73718671-73718693 GAGCCCAGGAGGATGGTGACCGG - Intronic
1027136457 7:75627829-75627851 GACCTCAGGATGATGGTCAAGGG + Intronic
1035398427 7:158549958-158549980 GACCCCAGGACGAGGGCAAGGGG - Intronic
1036590712 8:10165536-10165558 GACAGCAGCACGTTGGTACCTGG + Intronic
1049826867 8:144674655-144674677 GACGGCAGGTTGATGGTAGCAGG - Intergenic
1192459105 X:71302140-71302162 GACCCCAGGGTGATGGCAACAGG - Exonic