ID: 1146482561

View in Genome Browser
Species Human (GRCh38)
Location 17:33216735-33216757
Sequence GGTGATGGGGAGCCCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146482555_1146482561 8 Left 1146482555 17:33216704-33216726 CCATGTGGCAGGGTTTTCATTTT 0: 1
1: 0
2: 2
3: 41
4: 310
Right 1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146482561 Original CRISPR GGTGATGGGGAGCCCCAAGA GGG Intronic
900394434 1:2447402-2447424 GGGGAGGGGGAGCCCTGAGAAGG - Intronic
900497580 1:2982975-2982997 GGTGAGGGGCAGCCCCAAGGTGG + Intergenic
902955691 1:19923033-19923055 GCTGGTGGGGAGCCCCTGGAAGG - Intronic
903647763 1:24905139-24905161 GGTGGTGGGGTGTCCCAAGGGGG + Intronic
904207841 1:28866211-28866233 GGTGACAGGGAGCCCCAGGGAGG + Intergenic
904600019 1:31668058-31668080 GGTAATGGGGAGCCCGCCGAGGG + Intronic
905290545 1:36919043-36919065 GATGATGAGGAGCCCATAGAGGG + Intronic
906527399 1:46502943-46502965 TGTGATGGGAAGCCCCTGGAGGG - Intergenic
910232724 1:85003146-85003168 GGTGACTGGGAGCACCTAGAGGG - Intronic
911171653 1:94776494-94776516 GGAGCTGTGGAGCCCCAGGAAGG + Intergenic
912695187 1:111836274-111836296 AAACATGGGGAGCCCCAAGAAGG - Intronic
912793599 1:112675673-112675695 GGTGAAAGGGAGCCTCCAGAAGG - Intronic
915227043 1:154419001-154419023 GGTGGTGGGGAGCCCAGAGAAGG + Intronic
916372781 1:164118165-164118187 AGTGATGGGGAGAACCAAGTTGG + Intergenic
917472465 1:175337383-175337405 GGCAATGAGGAGCCCCAAGATGG + Intronic
919784731 1:201251994-201252016 GCTGATGGGGGGCTCCAAGGTGG + Intergenic
919851466 1:201675835-201675857 GCAGACGGGGAGCCTCAAGAGGG + Intronic
920266230 1:204725442-204725464 GGTGGCTGGGAGCCCCTAGATGG - Intergenic
920702556 1:208228849-208228871 GGAGATGGAGAGGCCCTAGAGGG - Intronic
921161014 1:212472164-212472186 GGTGATGATGAGCCCAATGAGGG - Intergenic
921403534 1:214753480-214753502 GTGGATGGGGAGCCAGAAGAGGG - Intergenic
922155610 1:223038088-223038110 GGTGGTGAGGAATCCCAAGATGG + Intergenic
922695067 1:227727031-227727053 GGTCTTGGGCAGCCACAAGACGG - Intergenic
922753178 1:228080484-228080506 GGTGGTGGGGAGCCCAAACCAGG + Intergenic
923696146 1:236254443-236254465 GGTGATGGGAAGCCACAGGAAGG - Intronic
924687367 1:246308046-246308068 GGTGATGCGGAGACCTAAGATGG - Intronic
1064358303 10:14639722-14639744 GGTCATGGAGGGCTCCAAGATGG - Intronic
1067763826 10:49070509-49070531 GGTGAAGGGGCACCCCAGGAAGG + Intronic
1068849623 10:61721697-61721719 GGTGAAAGGGAGCCACAAGCAGG - Intronic
1070149506 10:73797230-73797252 GGGGATGGGGGTCCCCAGGACGG + Exonic
1070600358 10:77861965-77861987 GGGGATGGGGAGGGCCAAGGAGG + Intronic
1072161136 10:92767646-92767668 GTTGAAGGAGAGCCCCAATATGG + Intergenic
1075282052 10:121147519-121147541 GATGATGAGGAGCCCAAAGCAGG - Intergenic
1076258994 10:129050837-129050859 GGTGATGGGGAGCAGGAAGCTGG + Intergenic
1076668374 10:132105435-132105457 GGGGATGGGGAGGCCCACGATGG + Intronic
1076991545 11:278645-278667 GGTGAGGTGGAGGCCCCAGAGGG - Intronic
1077081086 11:725024-725046 GCCTTTGGGGAGCCCCAAGATGG - Intronic
1077107453 11:848320-848342 GGCCATGGGAAGCCCCAGGATGG + Intronic
1077636636 11:3846256-3846278 GATCAAGAGGAGCCCCAAGAAGG - Intergenic
1077937542 11:6803553-6803575 GGTGATGAGGAGTCCTCAGAAGG + Intergenic
1078758290 11:14232195-14232217 GGTGAGGGGGAGGGCCAGGATGG - Intronic
1081491760 11:43575001-43575023 GGCGGTGGGGAGCGCCCAGAGGG - Intronic
1081589496 11:44411327-44411349 TATAAAGGGGAGCCCCAAGATGG + Intergenic
1083366585 11:62145130-62145152 AGTCATGGGGAGCCCCACCAAGG - Intronic
1083607473 11:63987252-63987274 TGGGATGGCGAGCCCCAAAAGGG + Intronic
1083724506 11:64621247-64621269 TGTGGTGGGGAAGCCCAAGATGG - Intronic
1084437870 11:69154795-69154817 TGTGATGGGGAGACACAGGAGGG + Intergenic
1086412086 11:86553234-86553256 GGTGATGCAGAGCCCCAGGCAGG + Intronic
1090007891 11:123018812-123018834 GGTGATGGGAAGCAGCATGACGG - Intergenic
1090827284 11:130396693-130396715 GGGGATGGAGAGCCCCCTGAAGG + Intergenic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1092893503 12:12991452-12991474 GGTGATGGGGAGATGAAAGAAGG - Intronic
1095049783 12:37545395-37545417 GGTGATGGTGAAACACAAGATGG - Intergenic
1096113937 12:49044199-49044221 GGGGATGGGCAGCCCGACGAGGG - Exonic
1102060022 12:109925029-109925051 GGGGAAGATGAGCCCCAAGAAGG + Intronic
1103716547 12:122948660-122948682 GATGATGGGGAAGCCCATGAAGG + Exonic
1104498839 12:129265660-129265682 GGTGTTGAGGAGCCCCAAGCAGG - Intronic
1104623109 12:130333107-130333129 GGTGGTTGGGATCCCCAAGTCGG + Intergenic
1111195389 13:84869745-84869767 GTTTATGGGGAGCCCCACGTTGG - Intergenic
1113372743 13:109737842-109737864 GGAGGTGGGGTGCCCCAAGCAGG - Intergenic
1113584669 13:111456974-111456996 GGTGAGGGGGACCCACAGGAGGG + Intergenic
1118735828 14:68701310-68701332 GGTGGTGCGGGGCCCAAAGACGG - Intronic
1118768750 14:68927942-68927964 GGTGCTGGGGATGGCCAAGATGG - Intronic
1120869009 14:89320615-89320637 TGTGATGAGGAGACCCATGAGGG - Intronic
1121728151 14:96167839-96167861 GTTGATGGTGAGGCCCATGAGGG - Intergenic
1121744546 14:96278032-96278054 GGGGATGCAGAGCCACAAGATGG + Intergenic
1122233771 14:100320727-100320749 GGTGTTAGGGAGGCCCCAGAAGG - Intergenic
1122269260 14:100561044-100561066 GGGGAGGGGGAGCCCCATGCGGG + Intronic
1125063389 15:35452071-35452093 AGTGATGGGGAGCCACTGGAGGG - Intronic
1126119929 15:45242456-45242478 GATTATGGGGAGCCCCATGTTGG + Intergenic
1127375274 15:58378677-58378699 GGTGATGGGGAGGTCTAAGTAGG - Intronic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1127994110 15:64142569-64142591 GGTGGAGGGGAGGCCGAAGAGGG + Intronic
1129244844 15:74272797-74272819 GGTGATGGGCAGCCCCACAGAGG - Exonic
1129813073 15:78526519-78526541 GGTGAAGGGCATCCCCAAAAAGG + Intronic
1130061395 15:80572580-80572602 GGTGGTGGGGAACCCCATGGAGG - Intronic
1130203561 15:81855046-81855068 GGTCATGGGGAGCCCCTAACTGG + Intergenic
1132689286 16:1175307-1175329 GGTTCTGGGGAGCCCCGGGAGGG + Intronic
1132759637 16:1502422-1502444 GTGGGTGGGGAGGCCCAAGATGG + Intronic
1132814422 16:1818967-1818989 GGTGCTGGGGAGCCTCATGGTGG - Intronic
1133460619 16:5983675-5983697 GGTGTGGGGAAGCCCCAAGCAGG - Intergenic
1134019994 16:10914998-10915020 AAAGCTGGGGAGCCCCAAGATGG + Intronic
1134322256 16:13174618-13174640 GGTGATGGAGAAGCCCAGGAGGG + Intronic
1134569243 16:15277514-15277536 GGAGATGGGGAGCGAGAAGATGG - Intergenic
1134677253 16:16099352-16099374 GGTGGTGGGGACCCTGAAGAGGG + Intronic
1134733134 16:16478531-16478553 GGAGATGGGGAGCGAGAAGATGG + Intergenic
1134934305 16:18233442-18233464 GGAGATGGGGAGCGAGAAGATGG - Intergenic
1135076873 16:19401535-19401557 GATTATGGGGAGCCCCACGTTGG + Intergenic
1135308626 16:21388241-21388263 GGAGATGGGGAGCCCCATCTTGG + Intergenic
1135408910 16:22218445-22218467 GGTGAGGGTGAGCCCCGAGGGGG + Intronic
1135886931 16:26318637-26318659 GGAGATGGGGTGCCCAGAGATGG - Intergenic
1136081361 16:27854380-27854402 GGGGATGGTTGGCCCCAAGAAGG + Intronic
1136148205 16:28328550-28328572 GGAGATGGGGAGCCCCATCTTGG + Intergenic
1136305368 16:29367372-29367394 GGAGATGGGGAGCCCCATCTTGG + Intergenic
1138474657 16:57263696-57263718 GGGGCTGGGGAGGCCCAGGATGG - Intronic
1138629013 16:58278641-58278663 AGCCACGGGGAGCCCCAAGATGG + Intronic
1138971909 16:62155090-62155112 GTGGATGGTTAGCCCCAAGAGGG - Intergenic
1139387181 16:66580075-66580097 GGTGATGATAAGCCTCAAGATGG - Exonic
1139610511 16:68053679-68053701 GGGGATGGTGAGCCTCAGGAGGG - Intronic
1139661099 16:68421374-68421396 GATGAGGGGGAGCCACAAAAGGG + Intronic
1139946776 16:70647277-70647299 GGTGTTGGGGAGCCCCGGGCGGG + Intronic
1140039552 16:71397028-71397050 GGTGAGGGGGAGCCCTGAAAGGG - Intergenic
1140504255 16:75460578-75460600 AGTGATGGGGAGGCCCTGGATGG - Intronic
1140511770 16:75513689-75513711 GGTGATGGGGAGACCCTCGATGG - Intergenic
1140872297 16:79118227-79118249 GGTAATAGGGAGGCCCAAGGAGG + Intronic
1143619199 17:8071576-8071598 GGTGGAGGGGACCCCCTAGATGG - Intergenic
1143992823 17:10981119-10981141 GAGGATGGAGAGCCCCATGAGGG - Intergenic
1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG + Intronic
1147141914 17:38465005-38465027 GGTGAGGGGGAGCCGCAGGGAGG + Intronic
1147163022 17:38578832-38578854 GGGGATGGGCAGCCCCAGGCCGG - Intronic
1147476847 17:40720134-40720156 GGTGATGGGAAGTCCCTTGATGG + Intergenic
1147790758 17:43013199-43013221 GCTCATGGGGAGCCTCAGGAGGG + Intronic
1148156248 17:45426664-45426686 GGAGATGGGGAGGCTAAAGATGG - Intronic
1148205326 17:45776107-45776129 GGTGAAGGGGAGCCCAGGGAGGG - Intergenic
1148464905 17:47859096-47859118 GGAGATGGGAAGTGCCAAGATGG - Intergenic
1148759732 17:49993531-49993553 GGTGAATGGGAAGCCCAAGAAGG - Exonic
1150387918 17:64775282-64775304 GGAGATGGGGAGGCTGAAGATGG - Intergenic
1151341604 17:73474759-73474781 AGTGATGGGGTGACCCTAGAGGG + Intronic
1151646619 17:75436789-75436811 GGTGATGAGTTGCCCCGAGAAGG - Intergenic
1152017463 17:77761102-77761124 GGGACTGGGGAGCCCCAAGTAGG + Intergenic
1152137741 17:78514870-78514892 GGTGTTGTCGAGCCCCACGAAGG + Exonic
1152744903 17:82034083-82034105 GGTGCAGGGAAGCCCCAGGATGG + Exonic
1152908904 17:82985937-82985959 GGTGATGGGAGGACCCAGGAGGG + Intronic
1156491574 18:37499493-37499515 AGGGACGGGGAGCCCCAAGAGGG + Intronic
1157322091 18:46642440-46642462 AGTGATGGGGAGTGGCAAGAAGG - Intronic
1157553098 18:48594807-48594829 GGTGAGGAGGAGGCCCAAGCGGG - Intronic
1158922284 18:62206487-62206509 GGTGATGGGGGAGCCCAAGGTGG + Intronic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1160706378 19:532062-532084 GGTGTTGGGGGGCCCGAAGATGG - Exonic
1161065672 19:2236161-2236183 GGGCATGAGGGGCCCCAAGAAGG - Exonic
1162013322 19:7830698-7830720 GGGGATGGGGAGCCCTGAGGGGG - Intronic
1163585373 19:18160969-18160991 GGTGAAGGGGAGCCTCAATGGGG + Exonic
1165806371 19:38583555-38583577 TGGGCTGGGGAGCCACAAGAAGG - Intronic
1166165605 19:40986281-40986303 GGTGATGGGCCGCTCCCAGATGG + Intergenic
1166217364 19:41344397-41344419 TGGGATGGGGAGCCCAAAGGAGG - Intronic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
1168694228 19:58395894-58395916 GGAGATGGGGAGGCCCGAGGCGG - Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
926088715 2:10036378-10036400 GGAGGTGGGGAGGCCCAAGCCGG - Intergenic
926119629 2:10235041-10235063 GCTGATGGGGAGCAGCCAGAAGG - Intergenic
926571888 2:14538037-14538059 AGTGATGGGGATCCCTAAAATGG - Intergenic
927168992 2:20352375-20352397 GGTGATGGGGAGCAATGAGATGG - Intergenic
927450365 2:23204465-23204487 GTGGATGGGGTGCCCCATGATGG - Intergenic
929714685 2:44298232-44298254 GGTGATGGGAAACCCCTGGAGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930211798 2:48646910-48646932 GCTGGTGGAGAGCCCCATGAGGG - Exonic
931213917 2:60224039-60224061 GAGGGTGGGGAGCCCCCAGAGGG - Intergenic
932000576 2:67880733-67880755 TGTGATGAGGATCCCCAAGCAGG - Intergenic
932740262 2:74285751-74285773 GGTGAGGCGGGGCCCCACGAGGG - Exonic
934729552 2:96647971-96647993 TGTGATGGGGCCCCCCAAGCAGG - Intergenic
935672833 2:105570472-105570494 GGGGATGGGAAGCCCCTGGAGGG - Intergenic
936820120 2:116510395-116510417 GCTCATGGTCAGCCCCAAGAGGG + Intergenic
937262173 2:120593667-120593689 GGTGGTGGGGAGAGCCGAGAAGG + Intergenic
937277199 2:120692655-120692677 GGTGAGGGGGTGCCCCACTATGG - Intergenic
940612375 2:156007097-156007119 GGTGAGGGTGAGCCCCAGGATGG - Intergenic
942312381 2:174667633-174667655 GGTGATGCAGAGCACCAGGAGGG + Intronic
942362545 2:175187597-175187619 GGTGATGGGGAGACACTAGGAGG - Intergenic
946401092 2:219468786-219468808 GGCGATGGGGTGCACCCAGAGGG + Intronic
946409109 2:219507666-219507688 GGGGAAGGGGGGCACCAAGAGGG - Intergenic
946655141 2:221938207-221938229 GGTGATGGTGAGACTCATGATGG - Intergenic
949022350 2:241748710-241748732 GGTGGTGAGGAGCCCCACCAGGG - Intronic
1169811440 20:9612796-9612818 GGTAATGGGGTGGTCCAAGAAGG - Intronic
1170584218 20:17722146-17722168 GTTGCTGGAGAGCCCCAGGAGGG + Intronic
1171544299 20:25988909-25988931 GGTGATGGTGAAACACAAGATGG - Intergenic
1172030804 20:31980741-31980763 AGTGATGGAGAGCCACAGGAAGG - Intronic
1172033287 20:31996002-31996024 GGGGATGGGGAGACCCAAGGTGG - Intronic
1172625623 20:36344951-36344973 GGTGATGGCAAGGCCCAGGAGGG - Intronic
1173706826 20:45116062-45116084 GGTGATGGGGAGGCCACAGTGGG - Intergenic
1173825131 20:46043323-46043345 GGTGAAGGGGAGCTCAGAGAGGG + Exonic
1174197341 20:48782821-48782843 TGTGATGAGGAGTCCCAGGAGGG + Intronic
1174295108 20:49540172-49540194 GGTGCTGGGGAGCAGCAAGGAGG + Intronic
1174522038 20:51139101-51139123 GGTGATAGGGAGCCCCTGGAAGG - Intergenic
1174569390 20:51490924-51490946 GGGTTTGGGGAGCCCCAAGATGG + Intronic
1175859565 20:62143140-62143162 GGGGCTGGGGAGCCCAGAGAGGG - Intronic
1175979096 20:62728071-62728093 GGTCATAAGGAGCCCCAGGAGGG - Intronic
1178230744 21:30781381-30781403 TGTGATAGGGAGCACCAGGAAGG - Intergenic
1179250177 21:39665429-39665451 GGTGATGGGAAACCTCAGGAGGG - Exonic
1179921841 21:44511830-44511852 GGTGATGGGGGACCCCGAGCTGG + Intronic
1180037774 21:45258559-45258581 GGTGATGAGGAGCCGCTGGAGGG + Intergenic
1180056775 21:45362963-45362985 GGTGACGCTGAGCCCCAAGGAGG - Intergenic
1180918945 22:19508620-19508642 TTTGATGGAGAGCCCCGAGAAGG + Exonic
1182119022 22:27774961-27774983 GGTGATGGGGAGCCGGTAGGTGG + Intronic
1182516914 22:30864318-30864340 AGTGCTGGGGAGCCCAAAGGAGG + Intronic
1182996385 22:34816721-34816743 TGAGATGGGGAGCCCCTGGAGGG + Intergenic
1183568055 22:38630808-38630830 GGGGATGTGGAGCCCAGAGAGGG + Intronic
1184345769 22:43911736-43911758 GCAGATGGGGAGACCAAAGAGGG - Intergenic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
950077706 3:10199039-10199061 GGCAATGGGGAGCCCCATAAAGG + Intronic
950090458 3:10290961-10290983 GGTGGCGGGGTGCCCCAAGTGGG + Exonic
950128733 3:10527509-10527531 ATTGATGAGGAGCCCCAGGAGGG - Intronic
950775558 3:15346930-15346952 TGTGATGGGAAGCCACCAGAGGG + Intergenic
951748244 3:26003661-26003683 GGTGATGGGGACTCCCAGAAGGG + Intergenic
953080187 3:39609263-39609285 GGTGATGGGGGGTGGCAAGATGG - Intergenic
953576359 3:44115997-44116019 GGTTGTGGGGAGACCCAAAAAGG - Intergenic
958001955 3:87761833-87761855 GGAGATGGGGAGCCAGAAGGGGG + Intergenic
960935008 3:122893817-122893839 GGAGATGGGGAGGCCCTATAAGG + Intergenic
961521912 3:127472001-127472023 GGTGATTGGGAGACCCAACGGGG - Intergenic
961536375 3:127573353-127573375 GGGGATTGGGAGCCCCAGGGAGG + Exonic
961550591 3:127668611-127668633 GGTGATGGGAGGGCCCAGGAGGG + Intronic
961715347 3:128853800-128853822 GGGGCTCGGGTGCCCCAAGATGG - Intergenic
964424218 3:156534471-156534493 GGTGATGGGAAGCCTCAGAAGGG - Intronic
967267369 3:187702330-187702352 GGAGAAGGGAAGCCCCAAGGGGG + Exonic
967849829 3:194073336-194073358 AGTGATTGGGAGCCCCAAGTGGG - Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
968869065 4:3232172-3232194 GGTGAGGTGGGGGCCCAAGAAGG + Intronic
969659741 4:8519583-8519605 GCAGATGGGGTACCCCAAGAAGG - Intergenic
972715807 4:41644718-41644740 GGGGAAAGGGAGCCCCTAGAGGG + Intronic
977747646 4:100569454-100569476 GGAGATGGGCAGCACCAAGAAGG - Intronic
978312224 4:107397043-107397065 GGTGAGGGTGAGTCCCGAGAAGG - Intergenic
986619147 5:9652503-9652525 AGGGAGGGGGAGCCACAAGACGG + Intronic
986794386 5:11194435-11194457 TGTGATGGGGAGAACCAAAAAGG + Intronic
989219824 5:38944951-38944973 AGTGATGGGGTGTCTCAAGAAGG - Exonic
995259398 5:110084125-110084147 GGTCATGGGGAGTCCCCATAGGG + Intergenic
997391436 5:133520372-133520394 GGCTGTGGGGAGCACCAAGATGG + Intronic
997605166 5:135170097-135170119 TGGGATTTGGAGCCCCAAGATGG - Intronic
997620621 5:135290190-135290212 AGAGAGGGTGAGCCCCAAGATGG - Intronic
998949247 5:147375244-147375266 GGTCATGGGTATCCCCATGATGG + Intronic
999506808 5:152206990-152207012 TGTGATGGGGAGCCACAGGCAGG + Intergenic
1002098941 5:176847946-176847968 GGTGAGGCGGAGGCCCAGGATGG + Intronic
1004204050 6:13574851-13574873 TGTGCTGGGGAGCCCCGCGAGGG + Intronic
1004978595 6:20996502-20996524 GAGGATAGGGAGGCCCAAGATGG + Intronic
1006114810 6:31769922-31769944 GGTGGTGGGGAGCCCCAGGAGGG + Intronic
1006160666 6:32039013-32039035 GGGGTTGGGGAGGCCGAAGAAGG + Intronic
1006395442 6:33784060-33784082 GGTAGTGGGCATCCCCAAGAAGG + Intronic
1006669095 6:35718553-35718575 GGAGATGAGGGGCCCAAAGAGGG - Intronic
1007833455 6:44656146-44656168 GGGGATGGGGATCCCCAACGCGG - Intergenic
1009841291 6:69078328-69078350 GTGGATGTGGAGGCCCAAGATGG - Intronic
1011536485 6:88381441-88381463 GGTGATGGGGAGGCACACCAGGG + Intergenic
1012979048 6:105810811-105810833 GGTGGTGGGGAGCAGAAAGAGGG + Intergenic
1016004526 6:139075747-139075769 GCTCTTGGGGAGCCCCAAAAGGG - Intergenic
1017722233 6:157251742-157251764 GGAGCTGGGGAGCGACAAGAGGG - Intergenic
1018359661 6:163054735-163054757 GCTGGTGGGAAGCCCCAAAATGG - Intronic
1018961038 6:168448585-168448607 GGTGATGGGGAGGACGATGATGG + Intronic
1019430553 7:997085-997107 GGTCATGGGGAGCCCCTGGTGGG - Exonic
1021083000 7:16385848-16385870 TGGGATGGGGAGCACCCAGATGG + Intronic
1021948957 7:25755321-25755343 GGTGACACGGAGCCCCAGGATGG - Intergenic
1022412251 7:30148411-30148433 AGTGATGGGGAGCCCCCCAAGGG + Intronic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1025295690 7:57773976-57773998 GGTGATGGCGAAACACAAGATGG - Intergenic
1029611600 7:101629563-101629585 GATGATGGGGAGCCAGAAGGGGG + Intergenic
1030553519 7:110994568-110994590 TGGGATGGGGAGCACCAAAAAGG + Intronic
1031619006 7:123913510-123913532 GGTGAATGGTAGGCCCAAGAAGG + Intergenic
1032382942 7:131503239-131503261 GCTGATGGGGGGCCCCGGGAAGG + Intronic
1032531535 7:132624764-132624786 GGTGGTGGGGAGCCTAAATAGGG - Intronic
1032845701 7:135749641-135749663 GGTGAATGGGCTCCCCAAGAGGG + Intergenic
1034224416 7:149471690-149471712 GGTGAAGAGGTGCCCCAAGCTGG + Intergenic
1034546679 7:151794101-151794123 GGGGAAGGGGAGCCCCGAGGCGG - Intronic
1035327245 7:158073103-158073125 GGTGATGGAGAGTGCAAAGATGG - Intronic
1038465292 8:27756920-27756942 GGTGATGGGGAGCCCTTTGGAGG - Intronic
1038691538 8:29768160-29768182 GGTCAAGGGGAGCCTCATGAGGG - Intergenic
1042886584 8:73559330-73559352 GGTGATGGGGACACCAAAGTGGG + Intronic
1042926319 8:73971922-73971944 GGGGCTGGGGAGGCCCAAGGAGG + Intronic
1044620735 8:94188463-94188485 GGTCACGGGCACCCCCAAGAAGG + Intronic
1044728648 8:95213217-95213239 GGGGATGTGGAGGGCCAAGAGGG - Intergenic
1045650796 8:104340137-104340159 GGTTATGGGGAGCCCTAGGCTGG + Intronic
1047234251 8:123025413-123025435 GGTCATGGCGAGAGCCAAGAAGG - Intronic
1049248918 8:141577805-141577827 GGGGCTGGAGAGCCCCAGGAGGG + Intergenic
1049275335 8:141717450-141717472 TGTGATGAGGAGCCCCAGAAAGG - Intergenic
1049347274 8:142145713-142145735 AGTGATGGGGAGCCACCAGCAGG + Intergenic
1049655265 8:143794398-143794420 GGCCATGGGCAGCGCCAAGAGGG - Intronic
1052821616 9:33141877-33141899 GGGGATGGAGAGCCACCAGAAGG + Intronic
1052904023 9:33817888-33817910 GGTGTTGGGGGGTCCGAAGATGG - Exonic
1057823996 9:98358489-98358511 GGTGCTGTGGAGCCCGAGGAGGG - Intronic
1058430411 9:104913678-104913700 AGTGGTGAGGACCCCCAAGAGGG - Intronic
1058671998 9:107367686-107367708 GCTGGCTGGGAGCCCCAAGAAGG - Intergenic
1059995413 9:119904068-119904090 GGTGATGTGGAGTCCTAATAAGG - Intergenic
1060382725 9:123191830-123191852 TGAGATGGGGAGCCCTTAGAAGG + Intronic
1060897403 9:127226167-127226189 GGTGATGGGGAGCTCCTCAAGGG - Intronic
1061087233 9:128406140-128406162 GGTCTTGGGGAGCCCCGACATGG - Intergenic
1061168857 9:128940520-128940542 GGGGGTGGGGAGTCCCAAGTGGG - Intronic
1061419701 9:130466564-130466586 GGTGAGAGGGAGCCCCATGAAGG - Intronic
1061500356 9:130998202-130998224 GTTTATGGGGAGCCCAAAGGGGG - Intergenic
1187972686 X:24674489-24674511 GATGAGGGGAAGCCACAAGAGGG - Intergenic
1190911432 X:54775450-54775472 GGTGATGTGGACCCTCTAGAAGG - Intronic
1190919789 X:54840769-54840791 GGTGATGTGGAGCCTCTATATGG + Intergenic
1198379871 X:136073919-136073941 GGTGGAGGGGAGCCCCAACTGGG + Intergenic
1199827921 X:151517479-151517501 GGAGAGGGGGAGAGCCAAGATGG - Intergenic
1199984753 X:152942253-152942275 TGTGATGGAGCGGCCCAAGATGG - Intronic
1200111132 X:153741496-153741518 CGTGAAGGGGAGCCCCAGCAAGG - Intronic
1200916175 Y:8573193-8573215 GGTGATTGGAAGCCTCAAAAAGG - Intergenic
1201868173 Y:18677237-18677259 GGTGATGGAGAGCTACAGGAGGG - Intergenic