ID: 1146482932

View in Genome Browser
Species Human (GRCh38)
Location 17:33219627-33219649
Sequence ACTGTGTCCTGCGGGACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146482921_1146482932 16 Left 1146482921 17:33219588-33219610 CCTTTAAAGCCCGTAGTCTTAAG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482922_1146482932 7 Left 1146482922 17:33219597-33219619 CCCGTAGTCTTAAGCCCCTGCAT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482920_1146482932 30 Left 1146482920 17:33219574-33219596 CCTGAGTTCTTCTGCCTTTAAAG 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482925_1146482932 -8 Left 1146482925 17:33219612-33219634 CCCTGCATTTCCCAAACTGTGTC 0: 1
1: 0
2: 2
3: 28
4: 284
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482924_1146482932 -7 Left 1146482924 17:33219611-33219633 CCCCTGCATTTCCCAAACTGTGT 0: 1
1: 0
2: 3
3: 34
4: 311
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482923_1146482932 6 Left 1146482923 17:33219598-33219620 CCGTAGTCTTAAGCCCCTGCATT 0: 1
1: 0
2: 1
3: 2
4: 130
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482926_1146482932 -9 Left 1146482926 17:33219613-33219635 CCTGCATTTCCCAAACTGTGTCC 0: 1
1: 2
2: 15
3: 65
4: 323
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146482932 Original CRISPR ACTGTGTCCTGCGGGACTCT GGG Intronic