ID: 1146482932

View in Genome Browser
Species Human (GRCh38)
Location 17:33219627-33219649
Sequence ACTGTGTCCTGCGGGACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146482921_1146482932 16 Left 1146482921 17:33219588-33219610 CCTTTAAAGCCCGTAGTCTTAAG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482925_1146482932 -8 Left 1146482925 17:33219612-33219634 CCCTGCATTTCCCAAACTGTGTC 0: 1
1: 0
2: 2
3: 28
4: 284
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482923_1146482932 6 Left 1146482923 17:33219598-33219620 CCGTAGTCTTAAGCCCCTGCATT 0: 1
1: 0
2: 1
3: 2
4: 130
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482926_1146482932 -9 Left 1146482926 17:33219613-33219635 CCTGCATTTCCCAAACTGTGTCC 0: 1
1: 2
2: 15
3: 65
4: 323
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482920_1146482932 30 Left 1146482920 17:33219574-33219596 CCTGAGTTCTTCTGCCTTTAAAG 0: 1
1: 0
2: 1
3: 23
4: 233
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482924_1146482932 -7 Left 1146482924 17:33219611-33219633 CCCCTGCATTTCCCAAACTGTGT 0: 1
1: 0
2: 3
3: 34
4: 311
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164
1146482922_1146482932 7 Left 1146482922 17:33219597-33219619 CCCGTAGTCTTAAGCCCCTGCAT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146482932 Original CRISPR ACTGTGTCCTGCGGGACTCT GGG Intronic
900495244 1:2973180-2973202 ACAGTGTCCTGGGGGACTGATGG + Intergenic
906831586 1:49037434-49037456 ACTGTATCCTGAGGGAAGCTAGG - Intronic
909987166 1:82175187-82175209 ACTGTGTCCTTGAGGAATCTAGG - Intergenic
913710089 1:121474029-121474051 TCTGTGTCCTGCAAGTCTCTAGG + Intergenic
914943549 1:152043766-152043788 AGTGTGGCCTCAGGGACTCTGGG - Intronic
915315064 1:155023840-155023862 ACTGTGTCCTGCAGTACCCCCGG - Exonic
916562101 1:165941863-165941885 ACTTTGTTCTGCGGGATTATCGG - Intergenic
917619277 1:176779386-176779408 ACTGTCTCCTGAGGGATTCTGGG + Intronic
918121547 1:181545453-181545475 CCTGTGTCCTGCAGGGCTGTGGG + Intronic
921390042 1:214607292-214607314 ACTTTGTCCTGCAGGAACCTAGG - Intronic
924260749 1:242228381-242228403 TCTGTGTCCTGCGGGTGCCTCGG - Intronic
924454382 1:244207157-244207179 ACTGTGAGCAGAGGGACTCTTGG + Intergenic
924953639 1:248907394-248907416 ACTGTGTCCTGCCTGCCCCTGGG - Intronic
1064028770 10:11869890-11869912 ACAGGGTCCTGCGGGGCTCCCGG - Exonic
1065453381 10:25881590-25881612 ACTGTCTCCTGCCTGCCTCTGGG - Intergenic
1071587103 10:86834395-86834417 ACTGTGTCATGCTGGATTCTAGG + Intronic
1073483657 10:103802859-103802881 ACTGTGTCCTGTAGGTCTGTAGG + Intronic
1074534508 10:114319295-114319317 ACTGTGTCCTGTGGAACTGAGGG + Intronic
1077500483 11:2907815-2907837 ACTGTGTCCTGCTGGGCAATGGG + Intronic
1082001333 11:47395097-47395119 CCTGAGGCCTGGGGGACTCTGGG - Intergenic
1083779113 11:64909110-64909132 ACTGTGTGCTGCTGGACTGGGGG + Exonic
1084182280 11:67452733-67452755 TCCGTGTCCAGCAGGACTCTGGG - Intronic
1085463923 11:76711601-76711623 ACTGTCTCCTGCCTGCCTCTGGG + Intergenic
1085610674 11:77945831-77945853 ACTGTGTGCTGTGGGACTGTGGG - Intronic
1085688484 11:78647103-78647125 AATGTGTCCTGCGGGTGGCTTGG - Intergenic
1085713686 11:78853318-78853340 ACTGTGTCCTGCAGCACATTAGG + Intronic
1085798363 11:79564498-79564520 ACTGGTTCCTGGAGGACTCTTGG - Intergenic
1090404107 11:126466996-126467018 GCTGGGTCCTCGGGGACTCTTGG - Intronic
1090453047 11:126823452-126823474 TCTGTGTCCTGGGAGACCCTGGG + Intronic
1092081859 12:5723209-5723231 ACTGTGAGCAGCTGGACTCTGGG - Intronic
1096487715 12:51994891-51994913 ACTGTGGCATGAGGGGCTCTGGG - Intronic
1102006477 12:109592300-109592322 ACTGTGTCCAGGGGGAGCCTGGG - Intronic
1102563356 12:113778641-113778663 ACTGTGTCCTGTGTGACTTCGGG - Intergenic
1103415634 12:120740191-120740213 ACTGGGTCCTGCAGGCCTCAGGG + Intergenic
1103503450 12:121423458-121423480 ACTGTGTCCTACTGGAGTGTGGG + Exonic
1105250611 13:18696215-18696237 ACTGTGTCCTGTGAAACTTTGGG + Intergenic
1105345920 13:19572629-19572651 ACTGTGCCCTAAGGCACTCTGGG + Intergenic
1106377164 13:29200858-29200880 ACTGTGGCCTGAGAGACTGTTGG + Intronic
1106402361 13:29442715-29442737 ACTGTGTGCTGAGGCACCCTGGG - Intronic
1107478468 13:40764057-40764079 ACTGTGTCCTAAGGTACTCTGGG + Intronic
1107706643 13:43114367-43114389 ACTGTGTCCTGAGGGACAACTGG - Intergenic
1107793103 13:44022546-44022568 CCTGTGCCCTGCTGGGCTCTGGG - Intergenic
1113719812 13:112546691-112546713 TCTGTGTCCAGCGGGCCCCTGGG - Intronic
1115770554 14:36661429-36661451 AATCTGTCATGCGGGCCTCTGGG - Intronic
1116560261 14:46369701-46369723 ACAGTGTCCTGCATTACTCTGGG + Intergenic
1122421882 14:101582972-101582994 ACTGTTTCCTACGGTTCTCTGGG - Intergenic
1122819832 14:104335815-104335837 ACTGTCTTCTGCGGGACCCTGGG + Intergenic
1122839008 14:104445574-104445596 TCTGTGTCCTGGGGGACGGTGGG + Intergenic
1122935907 14:104956103-104956125 CCTGTGTCCTGCAGAGCTCTTGG + Intronic
1129269113 15:74410215-74410237 CCTGAGTCCTTCTGGACTCTTGG - Exonic
1131542706 15:93288384-93288406 GCTGTCTCCTTCGGGACCCTGGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132791526 16:1692144-1692166 ACTGTTTCCTGGGTGACTCAGGG - Intronic
1132923315 16:2411760-2411782 TCTGTCTCCTAAGGGACTCTTGG + Intergenic
1134225297 16:12385437-12385459 ATTGTGTCCCGCAGGGCTCTAGG + Intronic
1138205318 16:55120270-55120292 AATGTGTCCTGGGAGCCTCTGGG + Intergenic
1138528226 16:57620883-57620905 ACTGCCTCCTGTGGGACCCTGGG + Intronic
1142615958 17:1135256-1135278 ACTGAGTCCTGCACGGCTCTCGG - Intronic
1142629621 17:1216344-1216366 ACTCACTCCTGCGTGACTCTAGG - Intronic
1143119374 17:4597510-4597532 ACTGAGTGCTGTGTGACTCTGGG - Intronic
1143203021 17:5124842-5124864 AAAGTGTGCTGCGGGACCCTTGG + Exonic
1144462352 17:15468278-15468300 ACTGTGTCCTCCTGGCATCTTGG - Intronic
1145057905 17:19715153-19715175 ACTGTGTTCTGCGGGCACCTGGG - Exonic
1145191079 17:20842527-20842549 ACTTTGTCCTGCAGGAACCTAGG + Intronic
1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG + Intronic
1146973200 17:37089336-37089358 ACTCTGTCCTGTCAGACTCTAGG + Intronic
1150336662 17:64335233-64335255 ACTGTGGCCTGGGTGACCCTGGG - Intronic
1150951496 17:69807120-69807142 ACTGTGTACTGAGACACTCTTGG + Intergenic
1152208542 17:78990431-78990453 GCTGTGACATGCGGGACTCGTGG - Intergenic
1152723500 17:81934193-81934215 CCTGTGTCCTGCGCAACACTGGG + Intronic
1154438237 18:14362711-14362733 ACTGTGTCCTGTGAAACTCTGGG - Intergenic
1158721858 18:59932096-59932118 CCTGTGTCCTGAGGGCCCCTGGG - Intergenic
1160914216 19:1489090-1489112 ACTGCGTCCTGAGGGCCACTGGG + Intronic
1160995123 19:1878896-1878918 ACTTTGTCCTGCAGGAACCTAGG - Intronic
1161285459 19:3466115-3466137 CCTGTGCCCTGCCGGACCCTCGG - Intronic
1162512512 19:11128104-11128126 GCTGTGACCTGGGGGACGCTGGG - Intronic
1162966608 19:14159200-14159222 ACTGTGACCTCCAGGACTGTGGG + Exonic
1163399717 19:17084939-17084961 ACTCTGTCCTCAGGGACACTTGG - Intronic
1165468019 19:35986527-35986549 ACTGTGGCTTGCAGGGCTCTGGG + Intergenic
1166122295 19:40692984-40693006 ACTGTGTCCTGCAGAAGTCCAGG - Exonic
1166491137 19:43261645-43261667 GCTGTGTCATGGGAGACTCTGGG - Intronic
1168235450 19:55060189-55060211 ACTGTCTCCTGCCTGACCCTGGG + Intronic
1168466086 19:56602256-56602278 ACAGTGTCATGAGGGACACTGGG + Intronic
927651861 2:24918193-24918215 AATGTGTCCTGGGGGCCTCCGGG - Intronic
931721764 2:65072073-65072095 ACCCTGTCCTGCAGGACTCCGGG + Exonic
933779938 2:85794597-85794619 ACTTGGTCCTGCTGGACTGTGGG + Intergenic
938421193 2:131148147-131148169 CCTGTGTCCTGAGGGTCCCTGGG - Intronic
939104648 2:137935242-137935264 ACTGTGTCCTGTGAAACTTTGGG + Intergenic
940315264 2:152321124-152321146 ACTGTGTGCTAAGGTACTCTGGG - Intergenic
946734956 2:222744792-222744814 ACTCTGTCATGCAGGACTATGGG + Intergenic
948461249 2:238130992-238131014 ACAGTGGCCTGCAGGACCCTAGG + Exonic
948565854 2:238885630-238885652 AATGTGGCTTGCAGGACTCTTGG - Intronic
1168869900 20:1119079-1119101 GCTGTGCCGTGAGGGACTCTGGG - Intronic
1169218337 20:3806121-3806143 ATTGTGTCCTGTGGGGCCCTGGG + Intronic
1172329461 20:34064952-34064974 ACTCAGTCCTGTCGGACTCTAGG + Intronic
1173472225 20:43332870-43332892 ACTGTGTCCCACTGGTCTCTTGG + Intergenic
1175445843 20:59018883-59018905 GCAGTGTCCTGCAGGTCTCTTGG - Intergenic
1175862702 20:62158821-62158843 TCTCTGTGCTGGGGGACTCTTGG - Intronic
1176457440 21:6926761-6926783 ACTGTGTCCTGTGAAACTTTGGG + Intergenic
1176835613 21:13791845-13791867 ACTGTGTCCTGTGAAACTTTGGG + Intergenic
1179442968 21:41408459-41408481 ACTGTGTGCTACGGGACCCAAGG - Exonic
1179539704 21:42076236-42076258 ACTGTGTCTTGCGTGAGTCCAGG + Exonic
1181121187 22:20669434-20669456 ACTTTGTCCTGCAGGAACCTAGG - Intergenic
1181334147 22:22116460-22116482 ACTTTGTCCTGCAGGAACCTAGG - Intergenic
1181635227 22:24171364-24171386 ATTATGTCCTGCAGGACCCTAGG - Intronic
1183619938 22:38966390-38966412 CCTGTGCCCTGCAGGACCCTCGG - Intronic
1185193803 22:49455492-49455514 TCTGTGTCCTCCTGGAATCTAGG + Intronic
1185237088 22:49720445-49720467 GCTGGGACCTGCGGGACCCTGGG - Intergenic
949892193 3:8741724-8741746 ACTGAGTCATGCAGGACTCTGGG + Intronic
949897596 3:8779759-8779781 ACTGTTTCCTGAGGGAGCCTAGG - Intronic
950515284 3:13460918-13460940 ACTGTGCCCTGCTGGAGGCTTGG - Intergenic
950702543 3:14760163-14760185 TCTGTGTGCTGGGTGACTCTTGG - Intronic
950724619 3:14908457-14908479 ACTGTGTCTTTCAGGATTCTGGG - Intronic
952919268 3:38274143-38274165 ACTGTGTACTGAGGCACTCCAGG - Intronic
953139071 3:40210751-40210773 ACTGTGTCCTTTGGAACTCAGGG - Intronic
953556003 3:43947554-43947576 GCTGTGTCCTCCAGGAGTCTGGG + Intergenic
953922087 3:46959294-46959316 ACTGTGTACTGTGGTACTCTGGG + Intronic
957067567 3:75538237-75538259 ACTGTCTCCTGCCTGTCTCTGGG + Intergenic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
962118449 3:132536444-132536466 ACTGTGTGCTGAGGCACCCTGGG - Intronic
962652347 3:137509451-137509473 ATTCAGTCCTGCGGTACTCTGGG + Intergenic
962954319 3:140250187-140250209 AATGTGTCCTGAGGGATTATGGG + Intronic
963085390 3:141430962-141430984 ACCCTGTCCTGGGGAACTCTGGG + Intronic
965469417 3:169072426-169072448 ACTGTTTCCTGCCTGACTGTGGG - Intergenic
966023333 3:175243432-175243454 ACTGTTTCCTGAGGAACTGTGGG - Intronic
967219154 3:187234732-187234754 ACTGTGTCCTGCTGTGCTTTTGG - Exonic
968990212 4:3905811-3905833 ACTGTCTCCTGCCTGACCCTGGG - Intergenic
969790251 4:9489452-9489474 TCTGTGTCCTGGGGGGCTCAAGG - Intergenic
971720046 4:30233374-30233396 ACTGTCTCCTGCGTGCCCCTGGG - Intergenic
976521527 4:86033318-86033340 ACTGTGTCCTGCAGGGGTCCTGG - Intronic
983094447 4:163544841-163544863 ACTGTTTCCTGCGGGAGTGTGGG + Intronic
984373255 4:178894148-178894170 ACTCGGTACTGCTGGACTCTTGG + Intergenic
985024841 4:185730733-185730755 TCTGTGACCTCTGGGACTCTAGG - Intronic
985494320 5:196130-196152 ACTGTGTCCTGCGGGGCTTGAGG + Intergenic
985719361 5:1481241-1481263 TCTGAGTCCTCAGGGACTCTGGG - Intronic
986020144 5:3794273-3794295 ACAGAGTCCTGGGGGGCTCTAGG - Intergenic
987292143 5:16519412-16519434 ACTGTATCCTGAGCAACTCTGGG - Intronic
989966777 5:50474427-50474449 TCTGTGTCCTGCAAGTCTCTAGG - Intergenic
990820799 5:59838260-59838282 ACTGTGTTCTGCATGACTGTAGG - Intronic
992648748 5:78836707-78836729 ACTGTGTGCTGCAGGGTTCTTGG - Intronic
992956863 5:81918838-81918860 GCTGTGTACTGCGTAACTCTAGG - Intergenic
997915140 5:137917124-137917146 ATGGTGTCCTGCAGGTCTCTTGG + Intronic
998499712 5:142621703-142621725 GCTGTGGCCTGCAGGACTCTGGG + Intronic
1001407518 5:171486338-171486360 ACTGTGGCCTTGGGGACTCTTGG - Intergenic
1002055106 5:176594270-176594292 AGTGAGTCTTGCGGGTCTCTGGG + Intronic
1004349333 6:14877484-14877506 ATTGTGTCATGCTGGACACTGGG + Intergenic
1005618390 6:27597212-27597234 ACTGTCTCCTGCCTGCCTCTGGG - Intergenic
1006580915 6:35077492-35077514 TCTGTGCCCAGCGGGGCTCTGGG + Intronic
1007331094 6:41109778-41109800 ACGCTGTCCTGTGGAACTCTAGG - Intergenic
1009193740 6:60660466-60660488 ACTGTCTCCTGCCTGCCTCTGGG + Intergenic
1013352444 6:109317861-109317883 CCTCTGTCCTGAGAGACTCTAGG - Intergenic
1014015572 6:116526390-116526412 ACTTTGTTCTGTGGAACTCTAGG - Intronic
1018528426 6:164737672-164737694 ACTGTGACCTGCTTGACTCTGGG - Intergenic
1019216188 6:170445277-170445299 ACTGCGCTCTGCGGGACCCTTGG + Intergenic
1019324484 7:431599-431621 CCTGGGTCCTGGGGGCCTCTGGG + Intergenic
1019510064 7:1413334-1413356 ACTTTCTCCTGCGTGACTCTGGG - Intergenic
1024537418 7:50449941-50449963 ACTGGGCCCAGCGGGGCTCTGGG - Intronic
1025842432 7:65163223-65163245 ACTGTGTGCTGTGGGACTGTGGG + Intergenic
1025880613 7:65532746-65532768 ACTGTGTGCTGTGGGACTGTGGG - Intergenic
1025892824 7:65669858-65669880 ACTGTGTGCTGTGGGACTGTGGG + Intergenic
1028416064 7:90581854-90581876 TCTGTGTCCTGTGGGAATCAGGG - Intronic
1029420791 7:100470937-100470959 ACTTAGCCCTGCAGGACTCTTGG + Intronic
1029658618 7:101944230-101944252 ACTCCATCCTGCAGGACTCTTGG - Intronic
1032504799 7:132426939-132426961 GCTCTGGCCTGTGGGACTCTAGG - Intronic
1034157647 7:148968681-148968703 GCTGTGCCCTGCATGACTCTCGG - Intergenic
1037415520 8:18645629-18645651 ACTGTGTCACGCTGGACTCTTGG - Intronic
1045483891 8:102614929-102614951 ACTGTGTTATTCAGGACTCTAGG + Intergenic
1046170431 8:110498218-110498240 ACTGTATCCTGCAGGACCATGGG + Intergenic
1048952368 8:139506943-139506965 ACTGAGTTCTTTGGGACTCTGGG - Intergenic
1049729813 8:144170657-144170679 ACAGTGTCCTGGGGTACTCCTGG + Intronic
1057706948 9:97401490-97401512 ACAGTGTGGTGTGGGACTCTGGG - Intergenic
1058873483 9:109222422-109222444 ATTGTGCCCTGCGGAACTCCTGG + Intronic
1060570976 9:124640106-124640128 AGTGTGTTCTGCAGGACCCTAGG - Intronic
1060736094 9:126067390-126067412 ACTGAATCCTGTGGGACTCTGGG - Intergenic
1061791388 9:133061015-133061037 AGTGTCTCCTGGGGGACTGTTGG + Intergenic
1061795066 9:133081582-133081604 AGTGTCTCCTGGGGGACTGTTGG + Intronic
1062566677 9:137166796-137166818 CCTGTTCCCTGCGGGACTCCTGG - Intronic
1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG + Intronic
1189310541 X:40014617-40014639 CTTGTGTCCTGCGGGTCACTGGG + Intergenic
1191852612 X:65596799-65596821 GCTGTCTCCTCTGGGACTCTGGG - Intronic
1192289402 X:69776939-69776961 ACTGTATTCTCCAGGACTCTAGG - Intronic
1193921726 X:87436165-87436187 AATGTGTCTTTTGGGACTCTTGG + Intergenic
1194219233 X:91170783-91170805 ACTGTCTCCTGCCTGACCCTGGG + Intergenic
1195341775 X:103913605-103913627 GCTGTGTCCTGGGGGACTTCAGG + Intergenic