ID: 1146484474

View in Genome Browser
Species Human (GRCh38)
Location 17:33231853-33231875
Sequence ATTGAGATGAGCAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146484469_1146484474 1 Left 1146484469 17:33231829-33231851 CCAGCAAAACAATGTTTGCTCAA 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146484474 Original CRISPR ATTGAGATGAGCAATGGGGA GGG Intronic
900846282 1:5104567-5104589 GTTGAGATTCACAATGGGGATGG + Intergenic
901354316 1:8630306-8630328 ATAGAGTTGAGGAATGGTGATGG - Intronic
903261896 1:22136079-22136101 AGTGAGATGGGAAATGGGGTTGG - Intronic
904189421 1:28732166-28732188 TTTGAGATGAGCATTTGGGCAGG - Intergenic
905632574 1:39526870-39526892 ACTGACATGAGCCATGGGCAAGG - Intergenic
907424473 1:54370837-54370859 ATTGAGCTGAGCCATGCTGAGGG - Intronic
907594404 1:55706084-55706106 ATTGAGATAAGCAATATGCATGG + Intergenic
908423786 1:63985157-63985179 ATTGAGATCAGGAAAGGAGATGG - Intronic
908986086 1:70023532-70023554 ATTGACATTGGCAATGGGGTGGG + Intronic
910509856 1:87991608-87991630 ATTGATTTGAGCAGAGGGGATGG + Intergenic
910667617 1:89741741-89741763 GTTGAGGTGGGGAATGGGGAAGG + Intronic
911308108 1:96256851-96256873 ATTGAGAGGAGTGATGGGAAAGG - Intergenic
914242900 1:145864015-145864037 ACTGAGAGAAGGAATGGGGAGGG + Intergenic
914997585 1:152558511-152558533 ATTGAGATGAGCAATTTTAAAGG - Intronic
917036956 1:170758585-170758607 CTTGAGAACAGCAAGGGGGAAGG + Intergenic
917493449 1:175518395-175518417 CATGAGAGGAGGAATGGGGATGG - Intronic
917683437 1:177391658-177391680 GGTCAGAGGAGCAATGGGGATGG + Intergenic
917698506 1:177555471-177555493 ATTCAAAGGTGCAATGGGGAGGG + Intergenic
917841930 1:178987263-178987285 ATTAAGATCAGTAATGGGAATGG - Intergenic
918103437 1:181396402-181396424 ATTGGGTTTAGCAATGTGGAGGG + Intergenic
918874414 1:190021023-190021045 ATGGAGATGAGCATTTTGGATGG - Intergenic
920566253 1:206975897-206975919 ATTACAATGAGCAATGGGGTTGG - Intergenic
920600062 1:207316073-207316095 ATTTATAGGAGCAATTGGGAAGG - Intergenic
921561138 1:216659649-216659671 ATAGAGAGGAGCAATAGGAAAGG - Intronic
922141876 1:222895145-222895167 ATTGTGATGGGCAAAGGGCAGGG + Intronic
923607389 1:235456830-235456852 GCTGAGATGAGGAATGGGCATGG - Intronic
923760956 1:236843614-236843636 ATTCAGATGAGATATGGTGATGG + Intronic
923963594 1:239110251-239110273 AAGGAGATGAACAATGGGGAGGG + Intergenic
924794609 1:247284346-247284368 ATTGAGATGAGATTTGGGTAGGG + Intergenic
1063109882 10:3026364-3026386 AGTGGGAGGAGGAATGGGGAGGG - Intergenic
1063999796 10:11654064-11654086 TTTGAAATGTGCAATGAGGAAGG + Intergenic
1064149335 10:12849635-12849657 ATGGTGGTGAGCAAGGGGGAGGG + Intergenic
1066187840 10:33027896-33027918 AGTGAAATGAGAAAAGGGGAAGG - Intergenic
1068776159 10:60870556-60870578 ATTGAGATGGGCAAGGGAAAAGG - Exonic
1071242443 10:83722788-83722810 AATGAGCAGAGCAATGGGCATGG - Intergenic
1071574409 10:86715227-86715249 ACTGAGCTCAGGAATGGGGAGGG + Intronic
1073251938 10:102125632-102125654 ATTAAGATTAGGAAAGGGGAAGG + Intergenic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1074387714 10:113030081-113030103 ATTGCCAGGAGCTATGGGGAAGG - Intronic
1074712868 10:116192197-116192219 ATAGAGACAAGGAATGGGGATGG - Intronic
1074762066 10:116674672-116674694 ATTCACATGGGCAATGGTGAGGG + Exonic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075216749 10:120543090-120543112 GTAGAGATGAGCAGTAGGGAAGG + Intronic
1075970449 10:126647647-126647669 GCTGAGTTGAGCCATGGGGAGGG - Intronic
1076519888 10:131074941-131074963 ATTGGGATGAACCAGGGGGAGGG + Intergenic
1077215624 11:1394145-1394167 ATGGAGATGGGCCATGGAGATGG + Intronic
1077215700 11:1394370-1394392 ATGGAGATGGGCCATGGAGATGG + Intronic
1078179551 11:8999648-8999670 ATCAAAATGAGCAAGGGGGAGGG - Intronic
1078341809 11:10502525-10502547 AATGAGATGAACAGTGGGGAAGG + Intronic
1078844579 11:15109678-15109700 TTAGAGATGAGCAATGGGCATGG - Intergenic
1079290509 11:19184166-19184188 AGTGAGAGGAGCAATGGAAAGGG - Intronic
1079440267 11:20507217-20507239 CTGGAGGTGAGCACTGGGGATGG - Intronic
1080018464 11:27532872-27532894 CTAGAAAGGAGCAATGGGGAGGG - Intergenic
1080160081 11:29163265-29163287 CTTGAGATGAGCGCAGGGGATGG - Intergenic
1080708255 11:34720019-34720041 ATGGAGAAGAGCAAGAGGGAAGG + Intergenic
1081862996 11:46344947-46344969 AGAGAAATGAGCAATGAGGATGG - Intronic
1083120138 11:60504045-60504067 AATCACATGAACAATGGGGAAGG + Intronic
1083316572 11:61818242-61818264 ATTGAGGTTCGAAATGGGGAAGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1085460343 11:76689585-76689607 GTGGAGATGAGCAGTGGGGTGGG + Intergenic
1086500315 11:87446226-87446248 AGTGAGATAAGAAATTGGGAAGG - Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1089771850 11:120808875-120808897 ACAGAGATGTGCACTGGGGAGGG - Intronic
1090079896 11:123605147-123605169 TTTCAGAAGAGCAATGGGGTAGG + Intronic
1090802303 11:130180497-130180519 TTAGAGAAAAGCAATGGGGAAGG - Intronic
1091130568 11:133143619-133143641 GCTGAGATGAGATATGGGGAAGG - Intronic
1091253747 11:134165876-134165898 AGTGAGATGAGCTTGGGGGAGGG + Intronic
1091253783 11:134166112-134166134 AGTGAGATGAGCTTGGGGGAGGG + Intronic
1091253824 11:134166405-134166427 AGTGAGATGAGCTTGGGGGAGGG + Intronic
1091253981 11:134167571-134167593 AGTGAGATGAGCTTGGGGGAGGG + Intronic
1091253988 11:134167605-134167627 AGTGAGATGAGCTTGGGGGAGGG + Intronic
1091774042 12:3172652-3172674 ACTGAGATGGGCGATGGGGTGGG + Intronic
1091964106 12:4723464-4723486 AGTGTGATGAGCCTTGGGGATGG - Intronic
1092165703 12:6341240-6341262 AGTGAGTTGAGGAGTGGGGATGG - Intronic
1092254719 12:6920280-6920302 ATTTGGATTAGCAATGAGGAAGG + Intronic
1092339444 12:7662875-7662897 AGGGAGATGAGCAATGGAGGGGG + Intronic
1092352313 12:7765646-7765668 ATTGAGTTGAGCTATGAGAAAGG + Intronic
1092768828 12:11878135-11878157 AATAAGATGAGCACTGGGGAGGG + Intronic
1093530355 12:20154569-20154591 ATTGAAATCAGCAGTGAGGAAGG + Intergenic
1096215714 12:49796572-49796594 CCTGAGATGAGGAATGGGGGTGG + Exonic
1096824310 12:54263062-54263084 ATTGAGATGAGAAAAGAGGCTGG + Intronic
1097227912 12:57489570-57489592 CTTGAGATGAGGACTGGGGAAGG + Intronic
1100171994 12:91985773-91985795 ATTGGCATGAGGAATGGGGATGG - Exonic
1100407368 12:94283349-94283371 CTTGAGAGGGGCAATGGAGAGGG + Intronic
1100708647 12:97229357-97229379 AATGAGATGAGCAATGAGGGGGG - Intergenic
1101231307 12:102744389-102744411 ATTTAGATAAGAAATGGGGAAGG - Intergenic
1101712257 12:107279068-107279090 ATTGACATGAGAAATGGTCATGG + Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1103215160 12:119195968-119195990 CTTGAAATGATCAATGGGTAGGG - Intronic
1103848817 12:123917940-123917962 ATTGGGATGTGCTGTGGGGAGGG + Intronic
1105660700 13:22491268-22491290 ATTGTGATGAGCAATAGTGCAGG - Intergenic
1106335437 13:28778671-28778693 ATCGAGAGGAGCGGTGGGGAGGG + Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107948753 13:45443502-45443524 AGTGAGATGAGCATTAGGTAGGG + Intergenic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108767246 13:53647156-53647178 ATGGGGATGAACAATGGGAATGG - Intergenic
1109953981 13:69541340-69541362 ATGGAGGTGAGGAATAGGGATGG - Intergenic
1110553169 13:76829681-76829703 TTTGAGATGATAAATGGGTAAGG - Intergenic
1110742300 13:79011981-79012003 ACAAAAATGAGCAATGGGGAAGG - Intergenic
1110972916 13:81788938-81788960 GCTGAGATGGGCAATGGAGAGGG + Intergenic
1113184012 13:107665567-107665589 ATTGAGAGCAGAAATGGAGAGGG - Intronic
1113460086 13:110476172-110476194 ATTGACAAGAACAATGGGGTGGG - Intronic
1113534091 13:111050387-111050409 ATTGGGGTGCGCAGTGGGGAAGG + Intergenic
1115738982 14:36367168-36367190 ATAGAGATGAGCAATGCCAAGGG - Intergenic
1115961732 14:38841699-38841721 TTTGAAATGAGCCATGGGAATGG - Intergenic
1117243947 14:53864719-53864741 ATTCAGATGAGAAATGATGATGG + Intergenic
1117848467 14:59939538-59939560 ACTTAGATGAGCCATGTGGATGG + Intronic
1118002368 14:61535546-61535568 AGTGTGATGAGCAAAGGGGTGGG + Intronic
1118981209 14:70718495-70718517 ATTGTGATGGGCATTTGGGAAGG + Intergenic
1120591389 14:86377840-86377862 ATAAAAATAAGCAATGGGGAAGG + Intergenic
1120977412 14:90261274-90261296 ATTTAGATGAGCATTTGGGGAGG - Intronic
1121037041 14:90714882-90714904 ATAGAGATGAAAATTGGGGAGGG - Intronic
1121206419 14:92172333-92172355 ATTGAGAGGAGAAATGGGTACGG + Intergenic
1122621399 14:103059507-103059529 CCTGAGATGAGCAAGGGGAAAGG + Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125078855 15:35653205-35653227 AATGAAATGAGCACTGGGTAAGG + Intergenic
1125702454 15:41699454-41699476 ATTAAGATGAGAAACGGGAAGGG - Intronic
1128744640 15:70104734-70104756 GTTGGGATGGGGAATGGGGAGGG + Intergenic
1128778828 15:70344655-70344677 CTGGGGATGGGCAATGGGGAAGG - Intergenic
1129088563 15:73123760-73123782 TTTGAGATGAGAAATATGGAGGG - Intronic
1129435179 15:75533835-75533857 TTTGAGATGAGCTTTGGGCAAGG + Intronic
1129682704 15:77666996-77667018 ACTGAGATGAGCAATGTGGTTGG + Intronic
1129767980 15:78182289-78182311 ACTGAGCTCAGCAAGGGGGAGGG - Intronic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1136287136 16:29251131-29251153 ATTGAGATGAGTGCTGTGGAAGG - Intergenic
1138457443 16:57129456-57129478 ACTGAGATGAGGAACGGGGTGGG + Intronic
1138659862 16:58510538-58510560 ATTGAGATGAGCCAGAGAGATGG - Intronic
1141963419 16:87424782-87424804 ATTGAGATGGACAGAGGGGATGG + Intronic
1142092742 16:88223763-88223785 ATTGAGATGAGTGCTGTGGAAGG - Intergenic
1142933845 17:3310882-3310904 ATTGAGATGAACACTGGAGCAGG - Intergenic
1144593087 17:16541286-16541308 ATAGAGTTGAGCTAGGGGGAAGG + Intergenic
1146316495 17:31811423-31811445 ATGGAGATGAACAGTGGTGACGG + Intergenic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1146555949 17:33824110-33824132 AGGGAGAGGAGCAATGGGGATGG + Intronic
1146666755 17:34710254-34710276 ATTGAGAGGAGCATAGAGGAGGG + Intergenic
1147479806 17:40749476-40749498 CTTGATATCAGCAATGGAGAAGG - Intronic
1150162634 17:62911866-62911888 ATAGAGATTACCAATAGGGAGGG + Intergenic
1151481698 17:74373448-74373470 ATTGAGCTGAGCAATGGGAGGGG + Intergenic
1152093544 17:78259445-78259467 ATTGTGTTGGGCACTGGGGATGG - Intergenic
1152124651 17:78439028-78439050 ACTGAGGTGGCCAATGGGGATGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152611393 17:81316505-81316527 ATTGGGCTGAGCAGTGGGGTTGG - Intronic
1153330417 18:3867666-3867688 GTTGGGAGGAGAAATGGGGATGG + Intronic
1153601596 18:6786064-6786086 ATTGGGAGGAACAATTGGGAGGG + Intronic
1157818916 18:50751258-50751280 ATTGAGCTGATCCATTGGGATGG + Intergenic
1159787626 18:72733099-72733121 ATTCAGATGAGGAATCTGGAGGG + Intergenic
1161241646 19:3226404-3226426 AAAGAGATGGGGAATGGGGAGGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163186162 19:15640989-15641011 ATGGAGATGGGCACTGGGCAAGG + Intronic
1165725082 19:38107080-38107102 GTGGAGGTGAGAAATGGGGAAGG - Intronic
1166072253 19:40394309-40394331 AGTGAGATGGTCACTGGGGAAGG - Exonic
1166416602 19:42599849-42599871 CTTGAGCTGAGCACTGGGCAGGG + Intronic
926494721 2:13571921-13571943 ATTCAGATGAGAAATGATGATGG - Intergenic
926550167 2:14291828-14291850 ATTGAGATGGGCAGTGGGGGAGG + Intergenic
926867505 2:17375895-17375917 CTTGGGATGCGCATTGGGGAAGG - Intergenic
927529669 2:23783764-23783786 TTTGAGATTTGCATTGGGGAAGG - Intronic
930650293 2:53957564-53957586 AGTAATGTGAGCAATGGGGAGGG + Intronic
930725334 2:54676146-54676168 ATGGAGATGAGGCAGGGGGAAGG - Intergenic
933821476 2:86116011-86116033 ATTAAAATCAGCCATGGGGAGGG + Intronic
934901784 2:98165581-98165603 AGTTAGAGGAGAAATGGGGATGG + Intronic
936242339 2:110798557-110798579 GTTGAAATGAGCCATGGGAAGGG + Intronic
936868071 2:117099798-117099820 ATTGGGATGATCATTGTGGAGGG - Intergenic
937677621 2:124609194-124609216 ATAGAGATAAGCAAAGAGGAGGG + Intronic
938989816 2:136616318-136616340 CTTGAGAGTATCAATGGGGAGGG - Intergenic
939868094 2:147497491-147497513 AGGGAAATGAGCATTGGGGATGG - Intergenic
940001964 2:148975520-148975542 AATGAGATGAGCACTGGGGTGGG - Intronic
942921857 2:181383818-181383840 ATTGAGATCAGCAGTGGGGATGG - Intergenic
942927890 2:181456050-181456072 AATGGGATGAGCAATAAGGAGGG - Intergenic
943562431 2:189479815-189479837 AATGAAATGAACAATGAGGAAGG - Intergenic
945454650 2:210036105-210036127 AGGGAGATGAGAAATGGGCAAGG - Intronic
946612447 2:221473766-221473788 GCTGAGATGAGAAATGGGCAGGG - Intronic
947176561 2:227373105-227373127 AATGAGATGGGCAAGGGTGAAGG - Intronic
948313775 2:237010992-237011014 TTACAGATGAGGAATGGGGAGGG - Intergenic
1170441661 20:16385675-16385697 GATGAGAAGAGCAGTGGGGAAGG + Intronic
1171089072 20:22267212-22267234 ATTGAGATGAGTAATCCCGAAGG - Intergenic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1174287141 20:49481795-49481817 ATGAAGATTAGTAATGGGGAGGG - Intronic
1174586148 20:51609791-51609813 ATTGAGGAGAGCAAGGTGGAAGG - Intronic
1174698872 20:52587767-52587789 ATTCAGAGGAGCTATGGGAAAGG - Intergenic
1178638618 21:34327656-34327678 ATGGAGATGTACAAAGGGGAGGG - Intergenic
1179113095 21:38464048-38464070 ACTAGGATGAGCACTGGGGATGG + Intronic
1179269917 21:39842827-39842849 ATGAGGATGAGCGATGGGGAAGG - Intergenic
1179308555 21:40176682-40176704 ATTCAGAGGAGCTAAGGGGAAGG - Intronic
1182927055 22:34134798-34134820 ATTGGGGTCAGCAGTGGGGATGG + Intergenic
1183226219 22:36551684-36551706 AGTGAGATGAGCTAGTGGGACGG + Intergenic
949279857 3:2333152-2333174 ATTGAGAACAGCAGTGGGAATGG - Intronic
949600111 3:5588928-5588950 TTTCTGATGAGAAATGGGGATGG - Intergenic
951179401 3:19641476-19641498 ATTGAGATGAGCTATTTGGAGGG - Intergenic
951870096 3:27352072-27352094 ATTGGGAAGAGTAAGGGGGAAGG + Intronic
952207304 3:31192696-31192718 TTTGAGAAGAGCAATGGTGGTGG - Intergenic
954657384 3:52203560-52203582 ATTGAGATTAGGATTGGGGTGGG + Intronic
954979875 3:54735536-54735558 GTTGAGATGAACTGTGGGGATGG + Intronic
955502214 3:59596795-59596817 ATTGAGACTGGCAATGTGGAAGG + Intergenic
956507070 3:69953107-69953129 CTTGACATGAGAACTGGGGAGGG - Intronic
958823216 3:99000366-99000388 ACAAAGATAAGCAATGGGGAAGG - Intergenic
960279539 3:115765941-115765963 ATTGTTATGAGAAAAGGGGAGGG - Intergenic
960553269 3:119000644-119000666 ATTCAGATGAGAAATGATGATGG - Intronic
960719160 3:120608630-120608652 AATGACATGTGCAATGAGGAAGG + Intergenic
960747481 3:120906551-120906573 TTTGAGGTGAGCAATGGGCCAGG + Intergenic
960789166 3:121408355-121408377 ATTGAGATGAGCACTGTGCTAGG + Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961801461 3:129453322-129453344 ACTGAGAGTGGCAATGGGGAAGG + Intronic
963493698 3:146033555-146033577 ATTGAGATGAAAACTGGGGGAGG + Intergenic
964236841 3:154541227-154541249 ATAGTGATGGACAATGGGGAAGG + Intergenic
965140761 3:164831615-164831637 ATTGAGATGAGATTTGGGTAGGG - Intergenic
965505364 3:169509427-169509449 CTGGAGATGAGTAATGGTGATGG - Intronic
965551693 3:169972405-169972427 AGTGAGATTATCAATGTGGATGG - Intronic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
967542152 3:190680289-190680311 ATAGAGTTGAGCTAGGGGGAAGG + Intergenic
970499937 4:16666904-16666926 CTTGAGCTGACCAATGTGGAGGG - Intronic
971163860 4:24161915-24161937 ATTGAGATGGGCATTTGGGCTGG - Intergenic
971167047 4:24194394-24194416 ATTGAGAGGAGCAGTGGAGTTGG - Intergenic
971476854 4:27080635-27080657 ATTGGGATGAGCAAGGAGTAGGG - Intergenic
974248145 4:59349328-59349350 ATTAAAATTAGCAAAGGGGAAGG + Intergenic
974559584 4:63499511-63499533 ACTGAGAAGAGCATTGGGGAGGG + Intergenic
974837059 4:67263965-67263987 ATTTCAATGAGAAATGGGGATGG + Intergenic
975766682 4:77675945-77675967 ATTGAGATGGGGAATAGGGTGGG + Intergenic
978419652 4:108517123-108517145 ACAAAAATGAGCAATGGGGAAGG + Intergenic
978680635 4:111377349-111377371 AATGAGGTGGGCAAGGGGGAAGG + Intergenic
978780925 4:112553185-112553207 ATGGGGAAAAGCAATGGGGATGG - Intronic
979632496 4:122919656-122919678 ATAGATATTAGCAATGGGAATGG - Intronic
979773933 4:124563642-124563664 ATTCCTATGAGCAATTGGGAAGG - Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980394784 4:132197602-132197624 ATGGAAATGAGGAATGGGGCTGG + Intergenic
980734809 4:136870761-136870783 ATTGAGATGCGGAAAGGGGAGGG + Intergenic
980757878 4:137190052-137190074 TTTGAGATGAGAATTGGGTAGGG + Intergenic
981126066 4:141108025-141108047 TTGGAGATTACCAATGGGGAGGG - Intronic
981798743 4:148631023-148631045 ATTGAGATGCCCAAAGGAGAAGG + Intergenic
982595403 4:157377230-157377252 ACTGAGATTAGAAATGGGGGGGG + Intergenic
984502753 4:180577076-180577098 CTTGACCTGAGCAAAGGGGATGG + Intergenic
985844977 5:2337134-2337156 TTTGAGATGAGGAGAGGGGAAGG + Intergenic
987050067 5:14141982-14142004 ATTGACATCAGCAATGGTGGGGG - Intergenic
988832350 5:35000098-35000120 ATTGAGATGTGAATGGGGGAAGG - Intronic
988897736 5:35696408-35696430 AACAAGATGAGCAATGGGAAGGG + Intronic
989158373 5:38366568-38366590 ATTGAGATTGGCAATGGGCAAGG + Intronic
990491533 5:56307863-56307885 ATTGAAATCAGCAAAGGGCAAGG + Intergenic
991060603 5:62370922-62370944 ATTTAGATAAGAAATGGGGTGGG + Intronic
991544636 5:67767810-67767832 ATAGAGATGATAAATGGGGATGG + Intergenic
993462430 5:88200173-88200195 ATGGAGGTAAGAAATGGGGATGG + Intronic
993504058 5:88690566-88690588 CTTTTGATGAGAAATGGGGAAGG - Intergenic
993913376 5:93711238-93711260 ATTGAGATGTGAAATGGGGTGGG - Intronic
995002625 5:107153125-107153147 ATTGAGATAATCGCTGGGGAAGG + Intergenic
995022943 5:107386238-107386260 TTTGAGATGATCAAGGGAGATGG + Intronic
997806356 5:136922086-136922108 TTTGAGATGAGCCCTTGGGATGG - Intergenic
998394686 5:141811298-141811320 GTGGAGATGAGAAATTGGGATGG - Intergenic
999684811 5:154092813-154092835 TTTGAGACTAGTAATGGGGAAGG - Intronic
999720301 5:154394536-154394558 AATGAGATGAGCACTGGGCTTGG - Intronic
1000055526 5:157602752-157602774 AGTGTTATGAGCAATGGGGAAGG + Intergenic
1000437938 5:161236279-161236301 CTTGAGATCAGCAATTAGGAGGG - Intergenic
1000460585 5:161512447-161512469 ATGAAAATAAGCAATGGGGAAGG + Intronic
1001246821 5:170111228-170111250 AGTGAGCTGATCAATGGAGAGGG - Intergenic
1001591240 5:172866796-172866818 AATGAGATAAGCATCGGGGAAGG - Intronic
1001697450 5:173682330-173682352 CTGGAGATGAACAACGGGGATGG + Intergenic
1002909531 6:1478724-1478746 ATGGTGATGGGCAATGGTGACGG + Intergenic
1003083977 6:3046344-3046366 TTTAAGATGTGCAATTGGGACGG + Intergenic
1003243996 6:4369064-4369086 CTTGAAATAAGCCATGGGGATGG - Intergenic
1007317451 6:41000568-41000590 CTTGAGCTGAGGGATGGGGAGGG + Intergenic
1007504291 6:42323042-42323064 ATTCAGATAGGCAATGGAGAGGG - Intronic
1008851519 6:56028052-56028074 ATTGAAATGAGGGGTGGGGATGG + Intergenic
1009975406 6:70666508-70666530 ATTTAGATGGGGACTGGGGAGGG - Intergenic
1011134111 6:84081375-84081397 CTTGAGATGAGATATGGGTAGGG - Intronic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011749504 6:90440687-90440709 TTTGAAATGAGCCATGGTGAGGG + Intergenic
1011957602 6:93042420-93042442 ATTTAAATAAGGAATGGGGAAGG - Intergenic
1012171152 6:96017447-96017469 ATGAATATGAGCAAGGGGGATGG + Intronic
1013657597 6:112261566-112261588 GTTCAGATTTGCAATGGGGAAGG - Intergenic
1014721087 6:124919591-124919613 ATTAAGATGACCAAGTGGGAGGG - Intergenic
1015433642 6:133159891-133159913 ATACACAGGAGCAATGGGGAAGG + Intergenic
1015568027 6:134594097-134594119 CTTGGGATGAGCCATGGGGCTGG - Intergenic
1015774148 6:136796455-136796477 ATAAAAATAAGCAATGGGGAAGG - Intergenic
1016137919 6:140569030-140569052 ATTGAGATGAGATTTGGGTAGGG + Intergenic
1016689651 6:146922294-146922316 AATGAGATGAGAGATGAGGAGGG + Intergenic
1017585017 6:155910734-155910756 ATAGAGGTAAGCAATGGGGTAGG + Intergenic
1018719425 6:166561498-166561520 AGTGGGCTCAGCAATGGGGAGGG - Intronic
1019474897 7:1239676-1239698 TTGGAGATGAGAAATGGAGATGG - Intergenic
1022009006 7:26292497-26292519 CTTGAGTTGAGGAATTGGGAGGG + Intronic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024712939 7:52038189-52038211 GTTGAGACCACCAATGGGGAGGG + Intergenic
1025819016 7:64946096-64946118 ATGGAGCAGAGCAATGGTGAAGG + Intergenic
1028291709 7:89074051-89074073 GTAAAGATGAGAAATGGGGAAGG + Intronic
1028345281 7:89772946-89772968 AGGGGGATCAGCAATGGGGAAGG + Intergenic
1029274467 7:99396075-99396097 CTTGAAATGATCAATGGGTAGGG + Exonic
1031736160 7:125364708-125364730 ACAGAAATAAGCAATGGGGAAGG - Intergenic
1033423182 7:141220505-141220527 TTTGAGATGACCTAGGGGGAGGG + Intronic
1033522514 7:142175518-142175540 AATGAGATGAGGAATGAAGAGGG + Intronic
1034532418 7:151704657-151704679 AGAGAGATGAGGAAAGGGGAGGG + Intronic
1034963528 7:155377462-155377484 TTTGTGATGAGAAATGGAGAAGG - Intergenic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1038042784 8:23740057-23740079 ATTAAGATGAGCTGTGGGTAGGG - Intergenic
1038069274 8:23995440-23995462 ATTGAGAAGTGCAGTGGGGAAGG + Intergenic
1038254400 8:25937547-25937569 ATTGACATGGGCGATGGGGCGGG + Intronic
1039275521 8:35931250-35931272 AGTGAGGTCAGCAATAGGGATGG - Intergenic
1039414093 8:37378970-37378992 CTTGAGCTCAGCAGTGGGGAAGG - Intergenic
1040803484 8:51369061-51369083 AGTGAGATTAGCAAAGGAGAGGG + Intronic
1042622133 8:70718000-70718022 ATGGAGATGAGGAATTTGGAGGG - Intronic
1044496669 8:92895397-92895419 TTGGAAATGTGCAATGGGGAGGG + Intronic
1046635354 8:116669425-116669447 ACTGAGAAGAGCAGTGGGGATGG + Intronic
1048441401 8:134462164-134462186 ATTCAGATGAGCAGTGGGGGTGG - Intergenic
1049701129 8:144013248-144013270 ATTAAGATGAGCCAGAGGGATGG - Intronic
1051144691 9:14014330-14014352 GATGATATGAGCCATGGGGATGG - Intergenic
1051340309 9:16104281-16104303 GTTGAGATGAGCCGTGGGGAGGG - Intergenic
1051779240 9:20670662-20670684 TTTGAGATGAGCTTTGGGGTGGG + Intronic
1052820382 9:33133835-33133857 ATTGAGATGCCCACTGGGGTAGG - Intronic
1057223469 9:93270711-93270733 AGGGGGGTGAGCAATGGGGAGGG - Intronic
1058113422 9:101056827-101056849 AGTGAGTTTAGAAATGGGGATGG + Intronic
1058167717 9:101638990-101639012 AATGAGATGACGAATGTGGAGGG - Intronic
1058215746 9:102231538-102231560 ATTGGGATGATCAGTGGTGAAGG - Intergenic
1058271909 9:102983623-102983645 ATTGGAAAGAGTAATGGGGATGG - Intergenic
1058577549 9:106420079-106420101 TATGGGATGAGAAATGGGGAGGG + Intergenic
1058886067 9:109321866-109321888 ATTGAGATGATGAATGGAAAGGG - Intergenic
1059092266 9:111372272-111372294 AATGGGATGAGCAATTTGGATGG + Intronic
1059647132 9:116278944-116278966 ATTGAGATAGGCAATGAGGAAGG - Intronic
1059840734 9:118212686-118212708 ATAGAGATGAGGGTTGGGGAAGG + Intergenic
1060920352 9:127416418-127416440 ATGGAGATGAGTGATGGAGATGG + Intergenic
1185666620 X:1770308-1770330 ATTGATATGAGCAGGGGGGCTGG + Intergenic
1186608348 X:11114093-11114115 AATGAGATGAGCAATAGCAAGGG - Intronic
1186868685 X:13747764-13747786 ATGGAAATGAGCAAGGGTGAAGG + Intronic
1186979273 X:14941481-14941503 ATTGATAGGAACAATGGGGCTGG + Intergenic
1187269666 X:17768446-17768468 TTTAAGATGTGCAATTGGGAGGG - Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188319461 X:28717709-28717731 ATTGAGATTCGAAGTGGGGAGGG + Intronic
1188909603 X:35830300-35830322 ATGGAGATGAACAATCTGGATGG - Intergenic
1189011465 X:37049508-37049530 TTTGAGATGAGATTTGGGGAAGG - Intergenic
1191176560 X:57508382-57508404 ATTGAGAATAGCAAGAGGGAGGG - Intergenic
1193790970 X:85814647-85814669 TTAGAGTTGAGCTATGGGGAAGG + Intergenic
1196338045 X:114562174-114562196 ATGGAGATGAATATTGGGGATGG + Intergenic
1196704898 X:118708572-118708594 TTTGAGATATGCAATGGGAAAGG - Intergenic
1197021876 X:121700329-121700351 GTTGGGAAGAGTAATGGGGATGG - Intergenic
1197937849 X:131758554-131758576 ATTGAGATGATCAGTAGTGAGGG - Intergenic
1199634176 X:149799942-149799964 CTTCAGATGAGCCATGGTGATGG - Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic
1201708671 Y:16965608-16965630 AGTGATGTGAGCAATGAGGAGGG + Intergenic