ID: 1146486613

View in Genome Browser
Species Human (GRCh38)
Location 17:33248256-33248278
Sequence CTTCTCACTGTTCCTTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 2, 2: 4, 3: 31, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146486613_1146486616 -9 Left 1146486613 17:33248256-33248278 CCTGTTCAAGGAACAGTGAGAAG 0: 1
1: 2
2: 4
3: 31
4: 257
Right 1146486616 17:33248270-33248292 AGTGAGAAGGCCAGTGTAGGTGG 0: 1
1: 0
2: 5
3: 58
4: 384
1146486613_1146486619 25 Left 1146486613 17:33248256-33248278 CCTGTTCAAGGAACAGTGAGAAG 0: 1
1: 2
2: 4
3: 31
4: 257
Right 1146486619 17:33248304-33248326 ACGTGATAGTGAAATAGATCAGG 0: 1
1: 0
2: 0
3: 4
4: 70
1146486613_1146486620 26 Left 1146486613 17:33248256-33248278 CCTGTTCAAGGAACAGTGAGAAG 0: 1
1: 2
2: 4
3: 31
4: 257
Right 1146486620 17:33248305-33248327 CGTGATAGTGAAATAGATCAGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1146486613_1146486617 -4 Left 1146486613 17:33248256-33248278 CCTGTTCAAGGAACAGTGAGAAG 0: 1
1: 2
2: 4
3: 31
4: 257
Right 1146486617 17:33248275-33248297 GAAGGCCAGTGTAGGTGGAGTGG 0: 1
1: 1
2: 9
3: 72
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146486613 Original CRISPR CTTCTCACTGTTCCTTGAAC AGG (reversed) Intronic
901898566 1:12337515-12337537 TTTCTCACTGTTTCTTTATCAGG + Intronic
902117677 1:14135297-14135319 TTACTCACTGTCCCTTGAAGAGG - Intergenic
902681689 1:18048186-18048208 CCTCTCACAGTTCCTAGATCAGG + Intergenic
902927465 1:19705697-19705719 CACCTGACTGTTCCTAGAACGGG + Intronic
904284934 1:29448004-29448026 ATACTCATTGTTCCGTGAACGGG - Intergenic
905193376 1:36254407-36254429 CTTCACACTGTGCCTTAAAAGGG + Intronic
906085596 1:43130975-43130997 CTTCTTTCTGTTCCTTGCACAGG + Intergenic
911318199 1:96380131-96380153 CTTCTCTCTTTTCTTTGAATGGG + Intergenic
912933687 1:113985061-113985083 CTTCTCATCTCTCCTTGAACAGG + Intergenic
913225794 1:116696989-116697011 CTTCTGACTTTTCCTTCAAGTGG + Intronic
913228586 1:116721927-116721949 CTTCTCACTGAGCCTCAAACTGG - Intergenic
913693660 1:121303813-121303835 TTTCTCACTGTTCAGAGAACAGG - Intronic
914143898 1:144976267-144976289 TTTCTCACTGTTCAGAGAACAGG + Intronic
914279311 1:146156217-146156239 CTTCTCACTGTTTCTACAAAAGG + Intronic
914540355 1:148607147-148607169 CTTCTCACTGTTTCTACAAAAGG + Intronic
914626290 1:149464067-149464089 CTTCTCACTGTTTCTACAAAAGG - Intergenic
914958638 1:152187133-152187155 CTGCTCACTCTTCCTGGAAAAGG - Intergenic
914977149 1:152377147-152377169 GTTCTGACTGTTCCTCCAACTGG + Intergenic
915153951 1:153859021-153859043 CTTTTTACTGTTGCTTGCACAGG - Intronic
915284411 1:154843654-154843676 TTTCTCACTGTTGCTTTAAAAGG - Intronic
915473197 1:156137892-156137914 CTCCTCCCTATACCTTGAACAGG + Intronic
916162760 1:161935399-161935421 CTTCTCACTGTGTCTTCAAATGG - Intronic
916902427 1:169243641-169243663 CTTCTCACTGTGCCTTTACATGG - Intronic
916950001 1:169770277-169770299 CTTCTTTTTGGTCCTTGAACAGG - Intronic
919658042 1:200216188-200216210 ATTCTCATTTTTCCTTGAGCTGG + Intergenic
919658865 1:200223678-200223700 CTTCTTTCTGCTCCTTGAACAGG - Intergenic
920480984 1:206322182-206322204 TTTCTCACTGTTCAGAGAACAGG - Intronic
920919695 1:210288285-210288307 CTCCTTGCTCTTCCTTGAACAGG - Intergenic
922463859 1:225833229-225833251 ATCTTCACTGTTCCTTGAAAAGG - Intronic
924226876 1:241929119-241929141 CTTCTCACTGTACCTGCAAATGG - Intergenic
1063254363 10:4309749-4309771 CTTCTCACTGTGTCTAGCACAGG + Intergenic
1063755470 10:9002184-9002206 CTTCTAAGTGCACCTTGAACTGG - Intergenic
1064133000 10:12726830-12726852 GTTCTCACTTTTGCTTCAACGGG + Intronic
1064815734 10:19259714-19259736 CTTTCCCCTGTTCCTGGAACAGG + Intronic
1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG + Intronic
1068658998 10:59604027-59604049 CTTCTTTCAGTTCCTTGAACAGG - Intergenic
1069596124 10:69672026-69672048 CTTCTCACTGTGCCTTCACAAGG + Intergenic
1070417748 10:76206216-76206238 CCTCTCACTGTTCTCAGAACAGG + Intronic
1073343300 10:102762508-102762530 ATTCTCAGTCTTACTTGAACAGG + Intronic
1073846351 10:107559978-107560000 CTGCTTAATGATCCTTGAACTGG - Intergenic
1073951049 10:108809867-108809889 CTTCTGACTCTTACTTGAAGTGG + Intergenic
1074127506 10:110540969-110540991 CCCCTCACTGGTCCTTGAAGTGG - Intergenic
1075138152 10:119805756-119805778 TTTCTCACTGTTCCTAACACAGG + Intronic
1075220648 10:120581606-120581628 CTTCTTGCTACTCCTTGAACAGG + Intronic
1083293636 11:61703510-61703532 CTTCTCTCTGTTCTTGCAACAGG - Intronic
1083409840 11:62484577-62484599 CTCCTTGCTGTTCCTTGATCTGG - Intronic
1084983008 11:72842384-72842406 ATTCTCTCTCTTCCTTGAATTGG - Intronic
1087577507 11:100008035-100008057 GTTCTGACTGTTCCATCAACTGG - Intronic
1088340714 11:108763058-108763080 GTTCTCATTGATCCTTGAGCAGG + Intronic
1088976874 11:114823518-114823540 CTTCTCTTTGTTCCTTCACCTGG + Intergenic
1090117990 11:123994971-123994993 CTCCTCACTGTTTCTGGAAATGG - Exonic
1090368083 11:126224746-126224768 CTCTTCACTGTTCCTCAAACAGG - Intronic
1091200595 11:133777412-133777434 CCTCCCACTGTGCCTTTAACTGG - Intergenic
1092768076 12:11871046-11871068 TTTCTCACCCTTCCCTGAACAGG - Intronic
1093494779 12:19743700-19743722 CTTATCACAGTTCCTGGCACAGG - Intergenic
1093748545 12:22771905-22771927 CTTCTCTCTGTTCCACGAAAAGG + Intergenic
1097811707 12:64025901-64025923 CTTCTCAGAGATCCTTGAATTGG - Intronic
1098859119 12:75687976-75687998 CTTCTTTCAGTTCTTTGAACAGG - Intergenic
1099605949 12:84801163-84801185 CCTCTCACTGTTTCTGGAATTGG + Intergenic
1102091264 12:110190286-110190308 CTCCTTACTGTTTCTTGAACTGG + Intronic
1102840928 12:116120602-116120624 CTTCTCAGTCTACCTTGAAAGGG - Intronic
1103162061 12:118737466-118737488 CTTCTCACTGTACCTTCACATGG - Intergenic
1103745615 12:123121166-123121188 GTTCTCATTTCTCCTTGAACCGG - Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106561143 13:30847362-30847384 GTTCTCCCTGTTCCATGGACTGG - Intergenic
1107484222 13:40810926-40810948 GCTCTCACTGTTCCTTGGAAGGG - Intergenic
1109396913 13:61771292-61771314 TTTCTCAGTGTTCCCTGACCTGG + Intergenic
1110678986 13:78285381-78285403 CTTCTCAGTTCTCCTTGAAGAGG - Intergenic
1111463247 13:88574408-88574430 CTTCTGACTGTAATTTGAACTGG + Intergenic
1112198994 13:97257240-97257262 CTGCTCCTTGTTCCTTAAACTGG - Intronic
1112802872 13:103131937-103131959 CTCCTCACTGTTTCTCAAACAGG + Intergenic
1113291342 13:108910305-108910327 GTTCCCACTGTTTCTTGAATGGG + Intronic
1113761404 13:112849897-112849919 CTTCTCACTTATTCTTGACCAGG + Intronic
1115616836 14:35103281-35103303 CTTCCTTCTGTTCCTAGAACAGG + Intronic
1116956119 14:50925566-50925588 CTTCACACTGTTCCTGAGACAGG - Intronic
1118171499 14:63393819-63393841 CTTATCACTCTTCCATGCACAGG - Exonic
1118455585 14:65943308-65943330 CTTAGCACAGTTCCTGGAACAGG + Intergenic
1123807505 15:23889565-23889587 CTTCTCCCTGTTCCTTGGTGGGG - Intergenic
1124570226 15:30856251-30856273 CTTCTCACAGTTCCAGGGACTGG + Intergenic
1128680900 15:69650619-69650641 CTTCTTTCTGTTCCCTGAATGGG + Intergenic
1130073052 15:80665301-80665323 CTTCTCTCAGTCCCTTAAACAGG - Intergenic
1130410293 15:83642002-83642024 TTTCTTTTTGTTCCTTGAACTGG + Intergenic
1130704172 15:86216883-86216905 CATCTCACTGTTCCTTGAACAGG + Intronic
1130809207 15:87358884-87358906 CTTCTCACTGTCACTGAAACTGG + Intergenic
1131030004 15:89178574-89178596 CTTCTCTCTGAGCCTTCAACCGG - Intronic
1131428463 15:92366877-92366899 CTTCTCACTGTCTCTTCACCTGG + Intergenic
1131473915 15:92719943-92719965 CTGTTCTCTGTTCCTGGAACAGG - Intronic
1131998215 15:98153876-98153898 CTTCTGCCTGTGCCTGGAACTGG - Intergenic
1132251770 15:100340546-100340568 CTTCTCTCTGTACCTGGAACAGG - Intronic
1132332637 15:101023412-101023434 CTTTTCTCTGTTACATGAACAGG - Intronic
1133551626 16:6861523-6861545 ACTCTCAATGTTCCTTTAACTGG + Intronic
1135188559 16:20335777-20335799 CTTCTCTGGGTTCCTTTAACAGG + Intronic
1135926744 16:26701562-26701584 CTTCTCTCAGTTCCTTTAAAAGG + Intergenic
1135955714 16:26954860-26954882 CTTCTGTCTGTCCCTTGAAGGGG + Intergenic
1136057417 16:27700705-27700727 CTTCTTCCTGCTCCTTGATCAGG - Intronic
1138928368 16:61619845-61619867 CTTCTCTTTGTTCCTGGAACAGG - Intergenic
1139026974 16:62830031-62830053 CTTCTAATTGTTCCTTTATCAGG + Intergenic
1140934105 16:79654731-79654753 CTGCCCACTGATCCTTGAATGGG + Intergenic
1142225026 16:88873013-88873035 CTCCTCACTGCTCCTTGTCCCGG - Intergenic
1143486630 17:7258861-7258883 CTTCTCTCTCTTTCTTGGACAGG - Exonic
1144861112 17:18302822-18302844 CATCTCACAGCTTCTTGAACTGG - Intronic
1146486613 17:33248256-33248278 CTTCTCACTGTTCCTTGAACAGG - Intronic
1146753618 17:35406278-35406300 TTTTTCAGTGTTCATTGAACAGG - Intergenic
1147584507 17:41646175-41646197 CTTCTCTCTGTCCCTGGAAATGG + Intergenic
1149123777 17:53203100-53203122 CTTCTCACTGTGGTTTGAAATGG - Intergenic
1149148038 17:53521646-53521668 CTTCTCTCCGTTCCATCAACTGG - Intergenic
1149290369 17:55212656-55212678 CTTCTCACTGTTTGTTAAAATGG + Intergenic
1153057281 18:958648-958670 ATTCTCAGTGTTTCTGGAACAGG + Intergenic
1153291741 18:3508578-3508600 CTTCACACAGTTCTCTGAACTGG + Exonic
1155117886 18:22787605-22787627 CTCCTCACTCTTCCCTGAATGGG - Intergenic
1155519266 18:26652807-26652829 CTTCTCACTGCTACTTAATCTGG + Intronic
1157086814 18:44588830-44588852 GTTCTTTCAGTTCCTTGAACTGG + Intergenic
1157436420 18:47673565-47673587 CTTCTTGCTCTTCCTTGAAGGGG - Intergenic
1157572859 18:48724421-48724443 CTTCTCGCTGTTCTTTGAACAGG + Intronic
1157661260 18:49447191-49447213 CTTCTTTCAGGTCCTTGAACAGG - Intronic
1157696877 18:49730125-49730147 CATCTCACTGTTATGTGAACGGG + Intergenic
1158326704 18:56320755-56320777 CTTCTCCCTGTGTCTTCAACTGG + Intergenic
1161257290 19:3316455-3316477 CTCCTCGCTGTTCCTCCAACAGG - Intergenic
1162513393 19:11133391-11133413 CTTATCACGGTTCCCTGCACTGG - Intronic
1162575571 19:11496974-11496996 CTCCTCGCTGTTCCTGGAGCGGG + Intronic
1165369196 19:35392140-35392162 CTTCTCTCTGTCCCTTGAGCAGG + Intergenic
925662223 2:6214326-6214348 CTGGTCACTGTTCCTGGAGCTGG - Intergenic
925777754 2:7351137-7351159 CTTCTCAGAGTTCCCAGAACTGG - Intergenic
926644857 2:15278922-15278944 ATATTCACTGTTCCTTGTACAGG - Intronic
926730763 2:16034039-16034061 CTCCTCACTGTCCCTTGTAGGGG + Intergenic
926887055 2:17607427-17607449 CTTCATTCTGTCCCTTGAACAGG - Intronic
927219062 2:20689881-20689903 CTTCACACTGTAGCTTGTACTGG - Intronic
928739099 2:34328709-34328731 CTTCTCACTGTGGCTCTAACAGG + Intergenic
929289353 2:40171504-40171526 CTTCTCACTTTTCACTTAACTGG + Intronic
930550080 2:52822774-52822796 ATTCTCACTGGTTCTTGAACAGG + Intergenic
930666578 2:54105155-54105177 CTTCCCACTGTACTTGGAACAGG + Intronic
931105976 2:59056175-59056197 CTTCTCTCTGTGCCTTCAAAAGG - Intergenic
936290171 2:111217046-111217068 CTTCTCACTGCTCCGGGCACAGG - Intergenic
937072733 2:119076482-119076504 CTCCTCACTGTCCCATGCACTGG - Intergenic
937589308 2:123594203-123594225 CTTCTCACTGTGCCTTCACATGG - Intergenic
938981349 2:136530253-136530275 CTTCACCCTGTTCCTTGAGCAGG + Intergenic
942195172 2:173510257-173510279 CTTCTCCATGATCTTTGAACTGG + Intergenic
942409860 2:175697650-175697672 CTTGGCACTGCTCCTTGATCTGG - Intergenic
942555639 2:177169939-177169961 CTTTTCACTTTGCTTTGAACTGG - Intergenic
942961301 2:181832453-181832475 CTTCTGTCTGTTCCCTGAACTGG + Intergenic
945241056 2:207677479-207677501 CTTTTCCCTTTTCCTTGACCAGG + Intergenic
948436740 2:237958856-237958878 CTTCTCCCTGTTTCTTCACCTGG + Intergenic
1169646720 20:7819330-7819352 CTTCCCATTGTTCTTTGAATAGG - Intergenic
1169882826 20:10366083-10366105 CTGCTCACAGTTCCTGGCACAGG - Intergenic
1170861204 20:20105233-20105255 CTTCTCATTGTTCCTGGCATGGG + Intronic
1171947212 20:31389360-31389382 CTTCTCTCTTTTCCTGGGACTGG - Intronic
1172498376 20:35406017-35406039 TTTCTTTCTGTTCCTTGGACTGG - Intronic
1173063286 20:39682441-39682463 CTTTTCACTGTGCTTTGTACAGG + Intergenic
1174053493 20:47783394-47783416 CTTCTCACTTTTTCTGGCACTGG - Intronic
1174417764 20:50378847-50378869 CCCTTCTCTGTTCCTTGAACTGG - Intergenic
1176219894 20:63964869-63964891 CTTACCACTGTTCCCTGACCTGG + Intronic
1176220181 20:63965922-63965944 CTTACCACTGTTCCCTGACCTGG + Intronic
1183646231 22:39128545-39128567 CTTCTCACTGTGTCTTTACCTGG - Intronic
1184308941 22:43628613-43628635 CCCCTCACTGTTCTCTGAACAGG + Intronic
1185138508 22:49087553-49087575 CTTCGCTCTGTTCCATGACCTGG + Intergenic
952093799 3:29923870-29923892 TTCCTCACTGCTCCTTTAACAGG - Intronic
952783443 3:37127389-37127411 TTTCTCACTCTTTCTTGATCAGG + Intronic
955566626 3:60254270-60254292 GTTCTCACTGTTCATTGCACTGG - Intronic
956842161 3:73150902-73150924 CTTCTCACTGTGTCCTCAACTGG + Intergenic
956927124 3:74001702-74001724 CCTCTGACTGTTCCTTCTACAGG + Intergenic
957011997 3:75017027-75017049 CTCATGACTCTTCCTTGAACTGG - Intergenic
957269957 3:78017087-78017109 GTTCCCACTGTGCCTTGACCTGG - Intergenic
960556883 3:119039695-119039717 CTCCTCAATGTTTCTTGAATAGG + Intronic
961931333 3:130536667-130536689 GATTTCACTTTTCCTTGAACAGG - Intergenic
964663039 3:159142131-159142153 GTTGTCACAGTTCCTTGAAATGG + Intronic
964776791 3:160287882-160287904 CTAGTGCCTGTTCCTTGAACTGG - Intronic
965633817 3:170760639-170760661 CCTCACACTGTTACTTCAACAGG + Intronic
967614064 3:191543968-191543990 CTTCTCACAGTTCATTGGATGGG - Intergenic
968899242 4:3423173-3423195 CTCCTCCCTGTCCCGTGAACAGG + Intronic
969448127 4:7257030-7257052 CTTCTCAGTATTTCTAGAACAGG + Intronic
970230658 4:13907396-13907418 CTTCTCAAAGTCCCTTGAGCTGG - Intergenic
970725350 4:19037394-19037416 CTTCTCACTGTCCCTTAATATGG - Intergenic
974485839 4:62504792-62504814 CTTGACACGGTTCCTTGAAAAGG - Intergenic
974940035 4:68456545-68456567 CTTCTCACACTTTCTAGAACAGG - Intronic
976551473 4:86401086-86401108 CTTGCCTCTGTTCCTTTAACAGG + Intronic
976960311 4:90963614-90963636 CTTCTCACTGTGCCCTCAAATGG - Intronic
977777247 4:100935808-100935830 CTTCTCATTGTTCCTTCTACTGG - Intergenic
980759994 4:137220326-137220348 ATTCTGACTGCTCCTTCAACTGG + Intergenic
982408457 4:155045914-155045936 CTTCTCACTGTGTCTTCACCTGG - Intergenic
982544231 4:156712594-156712616 CTTCTGCCTGGTCTTTGAACAGG + Intergenic
983764417 4:171459907-171459929 CTTCTAACTGCTCCATCAACTGG - Intergenic
984483270 4:180333429-180333451 CTCCTTGCTGTTCCTTGAACAGG - Intergenic
984658381 4:182344969-182344991 CTTCTCACTGTTCAACGCACAGG + Intronic
985665207 5:1178548-1178570 CTTCTCACTGTCTCCAGAACAGG + Intergenic
987600146 5:20057514-20057536 CTTGACACTGTTCCATGCACTGG + Intronic
988755871 5:34248753-34248775 CTTCTCCCTGTTACTAGATCAGG + Intergenic
988997327 5:36726943-36726965 CTTATCACTGTTCCTTGGATGGG - Intergenic
989814092 5:45714351-45714373 CTTCTTCCTGTTGCTTGAAGAGG - Intergenic
991119664 5:62997105-62997127 CTTCTCACTGTTACTTCACATGG + Intergenic
991744128 5:69714606-69714628 CTTCTCCCTGTTACTAGATCAGG + Intergenic
991753579 5:69840631-69840653 CTTCTCCCTGTTACTAGATCAGG - Intergenic
991795700 5:70294330-70294352 CTTCTCCCTGTTACTAGATCAGG + Intergenic
991803196 5:70397358-70397380 CTTCTCCCTGTTACTAGATCAGG - Intergenic
991823501 5:70589873-70589895 CTTCTCCCTGTTACTAGATCAGG + Intergenic
991832897 5:70715755-70715777 CTTCTCCCTGTTACTAGATCAGG - Intergenic
991888069 5:71293848-71293870 CTTCTCCCTGTTACTAGATCAGG + Intergenic
991998553 5:72412947-72412969 CTTCTTGCTGCTCCTTGGACAGG - Intergenic
992901123 5:81297579-81297601 CCTCTCATTGTTCCTTGGAATGG + Intergenic
993239890 5:85368891-85368913 CTGCCCACAGTTCCGTGAACGGG - Intergenic
995352567 5:111197560-111197582 CTTCTCTATGATCCTGGAACTGG + Intergenic
996043206 5:118840249-118840271 TTTTTCAGTGTTCATTGAACAGG - Exonic
996797946 5:127371160-127371182 CTTTTAACTGTACCTTAAACAGG + Intronic
1000639770 5:163687844-163687866 CTTCTCACTGCCCCTTGAAGAGG - Intergenic
1001841791 5:174882439-174882461 CCTACCACTGTTCCTTAAACTGG - Intergenic
1003527000 6:6906360-6906382 CTTCTCACTATTCCTGGTTCCGG + Intergenic
1004007601 6:11651545-11651567 CTTCTCCCTTTTCCTTGGGCAGG - Intergenic
1004053431 6:12111023-12111045 GTTCTCACTGCTCCATCAACTGG - Intronic
1004132484 6:12933827-12933849 CTTCTCTTAGCTCCTTGAACAGG - Intronic
1005385753 6:25282432-25282454 CTCCTTGCTGTTCCTTGAACAGG + Intronic
1005554517 6:26960547-26960569 CTTCTCCCTGTTACTAGATCAGG + Intergenic
1006336294 6:33422560-33422582 CTCCTCACTGTGCCTTGAGAAGG + Intronic
1006928005 6:37669402-37669424 ATTCTCACTGTTACTTGATGAGG + Intronic
1006931277 6:37690113-37690135 CTCCTCACTGTTGCTCCAACAGG + Intronic
1008112614 6:47509173-47509195 CTTCTAACTGTTCCACCAACTGG - Intronic
1009601622 6:65808461-65808483 CTTCTCACTATTCATAAAACAGG + Intergenic
1009719098 6:67441627-67441649 CTTTGCACTGGTCCTAGAACAGG - Intergenic
1009993508 6:70873741-70873763 CTTTTTTCTGTTCCTTAAACTGG + Intronic
1012943605 6:105442851-105442873 CTCCTCACTGTCCCCTGAATAGG + Intergenic
1013636908 6:112037882-112037904 CCTCCCACTGTTCCTTCAGCTGG - Intergenic
1013888389 6:114998713-114998735 CTTCTCACTGTGCCATGATCTGG - Intergenic
1014317448 6:119884936-119884958 CTTCTCACTGTGCCTTCACATGG - Intergenic
1014615658 6:123595830-123595852 GTTCTGACTGTTCCATTAACTGG + Intronic
1014962707 6:127706734-127706756 CTTCTCAATGTGCCTTGCTCTGG - Intergenic
1016380759 6:143476232-143476254 CTCCTTGCTATTCCTTGAACAGG - Intronic
1016546651 6:145231805-145231827 CTTCTCACAGTTCCCTGCATCGG - Intergenic
1016839600 6:148513248-148513270 CTTCCTACTGTTCCATGAACTGG + Intronic
1018395691 6:163376513-163376535 CTCCTCCTTGTTCCTAGAACAGG - Intergenic
1018505366 6:164462023-164462045 ATCTTCTCTGTTCCTTGAACAGG - Intergenic
1020863968 7:13532681-13532703 CATCTCTCTATTCCTTGAACTGG + Intergenic
1021708694 7:23393814-23393836 CTTCTCACTGATCCTAGATTAGG - Intronic
1024005486 7:45222403-45222425 CTTCTTGTTGTTCCTTGAACAGG + Intergenic
1025206865 7:56998537-56998559 CTTCTCACTGTCCCTAGATCTGG + Intergenic
1025252885 7:57363707-57363729 CCCTTCTCTGTTCCTTGAACTGG + Intergenic
1025665075 7:63578389-63578411 CTTCTCACTGTCCCTAGATCTGG - Intergenic
1026413029 7:70146113-70146135 CCTCTCAGTCTTCCTTGGACAGG + Intronic
1027878226 7:83799356-83799378 CTACTCACTGTTTCTAGTACAGG - Intergenic
1028366973 7:90043650-90043672 ATTCTGACTGTTCCATGGACTGG + Intergenic
1028391521 7:90322008-90322030 CTTCTCACAGGTTCTTGAGCTGG + Intergenic
1029045724 7:97626148-97626170 CTTCACTCTGGTCCTTGAACAGG + Intergenic
1031052291 7:116956163-116956185 CTTCTCACTGTTACTTAAAAGGG - Intronic
1031850662 7:126858870-126858892 CTCCTTTCTGTTCCTTGAACAGG + Intronic
1032858011 7:135852773-135852795 CTGCTGACTGTTCCTTTTACTGG + Intergenic
1034150907 7:148914704-148914726 CCTCTCCCAGTTCCTAGAACAGG + Intergenic
1034699543 7:153084182-153084204 CTGCTCACAGCTCCGTGAACTGG - Intergenic
1037620073 8:20555873-20555895 CTCCTCATTCTTCCTTGAGCTGG + Intergenic
1037760518 8:21738662-21738684 CTTCTCTCTGTTCCTTGCAGAGG - Intronic
1038096890 8:24323154-24323176 CTTCTCACTGTGCCTTTATATGG + Intronic
1038324794 8:26564688-26564710 CTTCCCACTGGTCCTTGATCTGG - Intronic
1038792049 8:30676717-30676739 ATTCTCATCGGTCCTTGAACTGG - Intergenic
1041276110 8:56158999-56159021 TTACTCACTGTTCCTTATACTGG - Intergenic
1041958663 8:63585973-63585995 GTTCTCATTGTTCCTTGAACAGG - Intergenic
1042670946 8:71262743-71262765 TTTCTCTCTTTTCCTTTAACAGG - Intronic
1043541056 8:81263085-81263107 GTTCTCAATGTTCCTTAAAATGG + Intergenic
1044873641 8:96643909-96643931 CTTTTTACTGCTCCATGAACAGG + Intergenic
1044902541 8:96963051-96963073 CTACTTACTGTTACTTAAACTGG - Intronic
1045616156 8:103914116-103914138 CATCTCACTGTCCCTGGAAATGG - Intronic
1046717550 8:117584213-117584235 CCTATCTCAGTTCCTTGAACTGG - Intergenic
1048314489 8:133352051-133352073 CTTCTCCCTGTGCCTTGATGGGG + Intergenic
1048387286 8:133923841-133923863 CTTCTGACTTTTCCGTGTACAGG + Intergenic
1049906336 9:220528-220550 CTTCTCACGGTCCCTTAAAGAGG - Intronic
1050437318 9:5624808-5624830 GTTCTGACTGTTCCATCAACTGG - Intergenic
1050988460 9:12113839-12113861 TTTCACACTGTTTCTTGAAGGGG + Intergenic
1051728728 9:20115556-20115578 CTTCTTTCTGTTCATTGTACAGG - Intergenic
1052565948 9:30151728-30151750 CTTCTCTCTGTTTCTTAGACTGG + Intergenic
1053463057 9:38285399-38285421 CATCTCAGTGTTCCTTGAACAGG + Intergenic
1055434260 9:76276543-76276565 CTTCTTGATGTTCCTTGAAGGGG + Intronic
1055493326 9:76828286-76828308 TTGCTTTCTGTTCCTTGAACTGG - Intronic
1055637547 9:78293745-78293767 CTTCTCACTGCTCTCTAAACAGG + Intergenic
1055864363 9:80795090-80795112 CTTATAAATGTTCCTTGAATGGG - Intergenic
1057164258 9:92913804-92913826 CTTCCCTGTGTTTCTTGAACAGG - Intergenic
1058975395 9:110121414-110121436 CTTCTCTGTGTGCCTTGAATTGG + Intronic
1060297589 9:122353722-122353744 CTTCTCACAGTTCCTCTAAAGGG + Intergenic
1060647873 9:125297561-125297583 CTTCTTGCTGTTCCTTGAACAGG - Intronic
1060666906 9:125437098-125437120 CTTTCCACTGTTCCTTCACCTGG + Intergenic
1060800865 9:126545272-126545294 CGTCTCACTCTTCCTGGAACAGG + Intergenic
1061551407 9:131336910-131336932 CCTCTCGCTCTTCCTTGAACTGG - Intergenic
1061671964 9:132193900-132193922 CTTCTCACTGTGCCTTCAAACGG + Intronic
1062646100 9:137549105-137549127 CTTTTCACTGTTGCTTTAATGGG + Intronic
1185848409 X:3462375-3462397 CTTCTCACTGTGTCTTCAAATGG + Intergenic
1186999183 X:15157534-15157556 CTTCCCTCGGTTCCTTAAACTGG - Intergenic
1187038455 X:15567065-15567087 CTCCTTGCTGTTCCTTTAACAGG + Intronic
1188690820 X:33126512-33126534 GTTCTCACTCTTCCTTGAGTGGG - Intronic
1190586938 X:51954434-51954456 GTCCTCATTGTTCCTTGAATAGG - Intergenic
1190936747 X:55004699-55004721 TTTCTCACTGTGCCCTGAATTGG + Intronic
1193993127 X:88333376-88333398 CTTCTCACTGTTTCATCAAACGG - Intergenic
1196293691 X:113975572-113975594 TTTCTCACTGTTTCTTAAAGGGG - Intergenic
1197712903 X:129684875-129684897 CTTCTTCCTGTTCCTCTAACAGG - Intergenic
1197961277 X:132008774-132008796 CTTCTAACTGTTGCTTGAGTTGG + Intergenic
1198520668 X:137449247-137449269 CTTCTCCCTTTTCCTTTCACTGG + Intergenic
1199852375 X:151734694-151734716 CTTCTCAGTGTTCTTTGAAGAGG - Intergenic
1200006048 X:153084997-153085019 CTTCTCACTAGTCCCTGAAAAGG - Intergenic
1200366196 X:155667329-155667351 CTTCAGACTGTTCCCTGAAATGG - Intronic
1200815215 Y:7524430-7524452 CTTCTCACTGTGTCTTCAAATGG - Intergenic
1201622909 Y:15980063-15980085 ATTCTCAATGTTCCTACAACAGG - Intergenic
1201671244 Y:16523149-16523171 CTTCTCCCTGTTTCTTCACCTGG - Intergenic