ID: 1146489785

View in Genome Browser
Species Human (GRCh38)
Location 17:33272139-33272161
Sequence GCTCATTAGCTCATGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146489785 Original CRISPR GCTCATTAGCTCATGTAGTC AGG (reversed) Intronic
900041177 1:465752-465774 GCTGAATAGATCATGTAGACAGG + Intergenic
900062608 1:700728-700750 GCTGAATAGATCATGTAGACAGG + Intergenic
905654061 1:39674768-39674790 GCTTATTGGCTCATGTAATTGGG - Intergenic
911805013 1:102194809-102194831 GCTCCTTAGCTCAGCTAATCTGG - Intergenic
915391437 1:155547741-155547763 GCACAGTGGCTCATGAAGTCAGG + Intronic
1066530393 10:36331887-36331909 ACTAATTAGCTAATGTCGTCTGG - Intergenic
1068403779 10:56563985-56564007 GCTCATTTGATCCTGTAGCCTGG - Intergenic
1068906911 10:62336850-62336872 GCTCCTTAGCTCAGCTAATCTGG - Intergenic
1070483118 10:76904622-76904644 ACTCATTAGCTCTTGTAGTAGGG + Intronic
1071156212 10:82692421-82692443 GCTCCTTAGCTCAGCTAATCTGG + Intronic
1076967448 11:101982-102004 GCTGAATAGATCATGTAGACAGG + Intergenic
1078169445 11:8917867-8917889 ACTCATTAGGTCATGAAGCCAGG + Intronic
1078865173 11:15290316-15290338 ATTCATTAACTCATGTAATCTGG + Intergenic
1081726168 11:45330952-45330974 ACCCATTTGCTCATATAGTCTGG - Intergenic
1083060514 11:59865644-59865666 GCAAATTATCTCATGAAGTCTGG - Intronic
1086547519 11:88015329-88015351 GTTCATTAGGTAATGTAGTGTGG + Intergenic
1092003304 12:5048631-5048653 GCTCTTTACCTCAGGTAGCCTGG - Intergenic
1092097151 12:5852190-5852212 TCTCTTTAGCTCATGTTCTCTGG - Intronic
1092797398 12:12126210-12126232 CCTTATTAGCACATGAAGTCAGG + Intronic
1097038202 12:56137952-56137974 GCTCTTTAGGCCATGGAGTCTGG + Intronic
1108318248 13:49259729-49259751 CCTCATTATCTCAAGTAGTGGGG - Intronic
1108810260 13:54214236-54214258 GCTCTTTTGCTCCTGTAGTTTGG - Intergenic
1111768555 13:92566793-92566815 GCTATTTAGCTCTTGTAGTTTGG - Intronic
1119140574 14:72263589-72263611 GCTGATTAGGTCATGGAGGCAGG + Intronic
1129023703 15:72548419-72548441 ACTCTTTAGCCCATGAAGTCTGG - Intronic
1132440723 15:101861845-101861867 GCTGAATAGATCATGTAGACAGG - Intergenic
1140334530 16:74092538-74092560 GCTGATTATCTCCTGTAGTGTGG - Intergenic
1141347685 16:83262246-83262268 GCCCATTACCCCATGTGGTCTGG - Intronic
1144008338 17:11121879-11121901 GCTCATTTGCTCAGGCAGTGGGG + Intergenic
1146489785 17:33272139-33272161 GCTCATTAGCTCATGTAGTCAGG - Intronic
1148830903 17:50430330-50430352 GCTCATCAGATCATATAATCAGG - Intronic
1150753356 17:67887676-67887698 TTTAATTAGCTCATGTAGTTGGG + Intronic
1153397948 18:4646266-4646288 GATCATTATAACATGTAGTCTGG - Intergenic
1155422687 18:25672433-25672455 TCTCATGATCTCATTTAGTCTGG + Intergenic
1157049528 18:44145564-44145586 GGTCATTAGCACATGCAGTAAGG + Intergenic
1159405382 18:67995481-67995503 GCTCCTTACCTCATGTAGACAGG + Intergenic
1159434586 18:68399267-68399289 GCTCATGAGATCATGGGGTCTGG - Intergenic
1160644252 19:171605-171627 GCTGAATAGATCATGTAGACAGG + Intergenic
925500955 2:4504414-4504436 GCTTTTTAAATCATGTAGTCTGG - Intergenic
929766730 2:44849965-44849987 GCTGCTTAGCTAATGTAGACAGG - Intergenic
935963011 2:108445669-108445691 GCTCCTTAGCTCAGCTAATCTGG - Intergenic
937753930 2:125513412-125513434 GCTCATTAGCTCATTCAGGGTGG - Intergenic
941096498 2:161244241-161244263 GCTCATTGTCTGATGTAATCAGG - Intergenic
943931902 2:193865469-193865491 TCTCAGTAGCTAATGTAGTCAGG - Intergenic
945567023 2:211413734-211413756 GCTCCTTAGCTCAGCTAATCTGG + Intronic
1171178031 20:23069173-23069195 GCTCAATAGCACATGTAATTAGG + Intergenic
951853175 3:27166104-27166126 GCTCATTAGCTCACATGGTGTGG - Intronic
953414317 3:42706958-42706980 GAGCATTAGGTCATGGAGTCTGG - Intronic
967298890 3:187992728-187992750 GTTCAGTAGCTCATGCAGTAGGG - Intergenic
967324810 3:188228459-188228481 TCTCATTAAATCACGTAGTCTGG - Intronic
968132123 3:196198025-196198047 GCCCATCAGCACATGTAGTGGGG + Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
973738624 4:53897901-53897923 GCTCATTAGCTCCTGTGGTGTGG - Intronic
977320371 4:95507270-95507292 CCTCATTAGCTCATTTTTTCTGG - Intronic
980229380 4:130029447-130029469 GCTCATTATCTCATGGTGTGTGG - Intergenic
980273179 4:130614221-130614243 GCCCCTTATCTCATGTAGTATGG - Intergenic
980318232 4:131234111-131234133 GCTCATCTGCTCATGTAGCCTGG - Intergenic
980450241 4:132959901-132959923 TCTCATTATCTCCTGGAGTCTGG - Intergenic
983355803 4:166656087-166656109 GCTTATTAACTTATGTTGTCCGG - Intergenic
985181132 4:187264484-187264506 GCTCATTAAACCATGTAGTTTGG - Intergenic
987190244 5:15470086-15470108 GCTCATCTGCTCTTGGAGTCTGG + Intergenic
993123602 5:83805186-83805208 GCTCTTTAGCTCATATTGTACGG + Intergenic
998762643 5:145449492-145449514 GTTCATCAGCTCATGGAGCCTGG + Intergenic
1000443226 5:161287108-161287130 GCCTATGAGCCCATGTAGTCAGG - Intergenic
1001447710 5:171798630-171798652 GCACATTACCTCATTTAATCCGG - Intergenic
1002732669 5:181353176-181353198 GCTGAATAGATCATGTAGACAGG - Intergenic
1002751869 6:120930-120952 GCTGAATAGATCATGTAGACAGG + Intergenic
1005375483 6:25178078-25178100 GCTCATCAGCACATGAAGCCTGG + Intergenic
1009507235 6:64499814-64499836 GCACATTATCTCATTTACTCAGG - Intronic
1013702425 6:112789295-112789317 TCTTATTAGCTCATGCAGTGGGG - Intergenic
1015264653 6:131278837-131278859 CCTGATTAGCTAATGTAGTGTGG - Intronic
1019236924 6:170625494-170625516 GCTGAATAGATCATGTAGACAGG - Intergenic
1021992816 7:26153384-26153406 GCTCAGTACCTCATGTACACTGG + Intronic
1023273833 7:38496426-38496448 TCTCTTCAGCTCATGTAGGCAGG - Intronic
1034615533 7:152413322-152413344 GCTCAGGAGCTCAACTAGTCTGG - Intronic
1035510846 8:181116-181138 GCTGAATAGATCATGTAGACAGG + Intergenic
1038670246 8:29577328-29577350 GGTCATTAACTCTTGGAGTCAGG - Intergenic
1042648906 8:71017722-71017744 GCTCATGAGCTCATGAGCTCGGG + Intergenic
1046036247 8:108844793-108844815 CCTCATTATCTCAGGTAGACTGG + Intergenic
1047310245 8:123685898-123685920 GCTCATTAGCTCAAATTGTCTGG - Intronic
1048590012 8:135812576-135812598 GCTCAGTAGCTTCTGTAGTGGGG + Intergenic
1055454960 9:76463727-76463749 GCTCATAAGCTCATAAAGGCAGG - Intronic
1055486260 9:76759442-76759464 GCTCATCTGCTCATGGAGCCTGG - Intronic
1062757075 9:138305500-138305522 GCTGAATAGATCATGTAGACAGG - Intergenic
1186031720 X:5375955-5375977 GCTCATTTGCTCGTGGAGTCTGG - Intergenic
1189074249 X:37899323-37899345 CCTCATTAGCTCAGCTAATCAGG - Intronic
1199757565 X:150879586-150879608 GCTCATTAGATCATGTGTTCTGG - Intronic