ID: 1146494815

View in Genome Browser
Species Human (GRCh38)
Location 17:33312274-33312296
Sequence GCAGCATTCTAAACTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146494811_1146494815 23 Left 1146494811 17:33312228-33312250 CCTGGTGTATAGTAAACAAGCTT 0: 1
1: 0
2: 1
3: 8
4: 83
Right 1146494815 17:33312274-33312296 GCAGCATTCTAAACTGTTATTGG 0: 1
1: 0
2: 0
3: 6
4: 132
1146494814_1146494815 -10 Left 1146494814 17:33312261-33312283 CCATTCTTAAATGGCAGCATTCT 0: 1
1: 0
2: 1
3: 26
4: 314
Right 1146494815 17:33312274-33312296 GCAGCATTCTAAACTGTTATTGG 0: 1
1: 0
2: 0
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146494815 Original CRISPR GCAGCATTCTAAACTGTTAT TGG Intronic
902106563 1:14041460-14041482 GGAGCATTCTATACAGCTATTGG - Intergenic
902977501 1:20099470-20099492 GCAGCCTTCTTACCTGTCATGGG + Intergenic
903402812 1:23069560-23069582 GCCGCATTCAAAACTGTCCTGGG + Intronic
904124703 1:28229885-28229907 GCAGCATTTAAAACTGTTGATGG + Intronic
906960019 1:50414569-50414591 GCAGCATTGTGATCTGTTGTAGG - Intergenic
907855707 1:58301421-58301443 GCTACATTCAAAGCTGTTATGGG - Intronic
908689831 1:66766496-66766518 CCAGTATTCTGAACTGATATTGG + Intronic
908858525 1:68456117-68456139 GCATCATTCAAAAATGTCATGGG + Intergenic
914431278 1:147621909-147621931 GTCGAATTCTAAACTGTGATTGG + Intronic
916711076 1:167409606-167409628 GAAGCATTCAAAATTGTTCTAGG - Intronic
917694284 1:177505020-177505042 GGAGCATTCTATACTGATAAAGG + Intergenic
921272853 1:213488315-213488337 GGACCATTATAAACTGTTATGGG + Intergenic
923333203 1:232944933-232944955 GCAGCAGTCTTACCTGTTTTGGG - Intergenic
923896080 1:238271474-238271496 TCAGCATTCTAAAAAGCTATGGG - Intergenic
1068242146 10:54316859-54316881 GTAGAATTCTGAAATGTTATTGG - Intronic
1071012752 10:80956752-80956774 GCAGAATTATAAACTGTCAAAGG - Intergenic
1071564231 10:86663339-86663361 GGAGAAATCTAATCTGTTATTGG + Intronic
1078190568 11:9090405-9090427 GCCGCATTCAAAACTGTCCTGGG - Intronic
1079474912 11:20820046-20820068 CCAGCCTTCAAAACTGATATAGG - Intronic
1080493561 11:32794158-32794180 GCAACATTTGGAACTGTTATTGG - Intronic
1082053147 11:47789597-47789619 TCAGCATTCTAATCTGCTAAAGG - Intronic
1084932578 11:72569027-72569049 GCAGCATCCTAATCTGTGCTGGG + Intergenic
1086120172 11:83297593-83297615 GCAATACTCTAAGCTGTTATAGG + Intergenic
1086354527 11:85981136-85981158 GCAGCATTCCAAGCGGTTGTTGG + Exonic
1086434521 11:86768292-86768314 GCAGAATCCCAAAGTGTTATAGG - Intergenic
1088426113 11:109705402-109705424 GCAGCATGCTAAAATCTTCTAGG + Intergenic
1092686889 12:11058668-11058690 GCAGAATTCAAAGCTGTTAGAGG + Intronic
1093153727 12:15655115-15655137 TCAGCATGCTATACTGTTCTAGG + Intronic
1093636036 12:21469304-21469326 GCTGCATTCAAAGCTGTTCTGGG - Exonic
1098430558 12:70415057-70415079 GCAGCATGGTAAACAGGTATCGG - Intronic
1098942177 12:76550645-76550667 GCCGCATTCAAAACTGTCCTGGG + Intronic
1099252701 12:80276501-80276523 GCAACTTTATAAACTTTTATTGG - Intronic
1099324404 12:81195705-81195727 GCAGCATTGCATACTGTTAGAGG + Intronic
1107629190 13:42326166-42326188 ACAGCATTTTAAGCTCTTATAGG - Intergenic
1108969772 13:56359005-56359027 GTAGCATTCTAAAATATTAGAGG + Intergenic
1111837818 13:93410891-93410913 GCAGCATTCAAAACAGTTCTAGG + Intronic
1112974896 13:105305253-105305275 CCAGGACGCTAAACTGTTATTGG + Intergenic
1113252006 13:108463735-108463757 AAAGCATTCTAAGCTGTTCTCGG - Intergenic
1116942548 14:50804867-50804889 GCCGCATTCAAAACTGTCCTAGG + Intronic
1117114906 14:52500982-52501004 TCAGCATTCTAAAATGTCCTTGG + Intronic
1118844967 14:69541070-69541092 GCAGCATTCTACTTTTTTATTGG + Intergenic
1119405805 14:74398755-74398777 GCAGCATTCAAAGCTGTCCTGGG + Intergenic
1121943453 14:98095322-98095344 GCAGCAATCTAGACTGTGCTAGG + Intergenic
1124950820 15:34318946-34318968 GAAGCAGGCTAAACTGTTCTTGG - Intronic
1140334255 16:74089455-74089477 TTAGCATTCTAATTTGTTATCGG - Intergenic
1141310894 16:82912339-82912361 GCTCCATTCTAAACCTTTATGGG + Intronic
1141853340 16:86663572-86663594 GCAGAATTCTGAACTGAAATTGG - Intergenic
1146494815 17:33312274-33312296 GCAGCATTCTAAACTGTTATTGG + Intronic
1149333682 17:55611948-55611970 GCTGCATTCAAAACTGTCCTGGG - Intergenic
1156655534 18:39281527-39281549 GCTGCATTCAAAACTGTTCTGGG + Intergenic
1164663704 19:30006082-30006104 GCAGCTTTGTAAGCTGTTTTTGG + Intronic
1165592524 19:36982206-36982228 TCACCATTCAAAACTGTTCTGGG - Intronic
1167516657 19:49927447-49927469 GCTGCATTCAAAGCTGTTCTAGG + Intronic
926876351 2:17483913-17483935 GCTGCATTCAAAACTGTCCTGGG - Intergenic
929849661 2:45573744-45573766 TCAGTATTATAAATTGTTATTGG - Intronic
935006958 2:99088572-99088594 GCTGCATTATAAATTGTTACTGG + Intronic
936928379 2:117761305-117761327 GCTGCATTATAAACATTTATGGG + Intergenic
937823638 2:126340477-126340499 GCAACATTTTACACTGTTAGTGG + Intergenic
938260847 2:129894318-129894340 GCAGCATTCTAAACAGTGCCAGG + Intergenic
939325618 2:140684004-140684026 GCAACATTTTAGACTGATATTGG - Intronic
940863549 2:158794542-158794564 GCCACATGCTAAACTTTTATTGG + Intergenic
945310813 2:208310512-208310534 GCAGGATTCTGAACTATTCTTGG + Intronic
1168911077 20:1447365-1447387 GCTGCATTCAAAACTGTCCTGGG - Intronic
1169169582 20:3453910-3453932 GCTGCATTCAAAGCTGTTCTGGG + Intergenic
1169353066 20:4885675-4885697 GGAGCATTCTAAGCTGTTTGTGG + Intronic
1175672472 20:60917328-60917350 GCTGCATTCAAAACTGTCCTGGG + Intergenic
1180905794 22:19410213-19410235 ACACCATTTGAAACTGTTATTGG - Intronic
1183660994 22:39221148-39221170 GCAACATACAAATCTGTTATTGG - Intergenic
951246061 3:20342945-20342967 ACAGCAATCTGAACTGATATGGG + Intergenic
952683165 3:36119192-36119214 TCAGCATTCTAAAAAGTAATTGG + Intergenic
953211290 3:40877560-40877582 GCAGCCTTCTAAACTGCTGCTGG + Intergenic
953513290 3:43565797-43565819 GCAGCATTTAAAAATGTAATGGG + Intronic
953840067 3:46382879-46382901 TCAGCTTTCTAATCTGTAATTGG + Intergenic
954488395 3:50876882-50876904 GCCACATTCAAAACTGTTCTGGG - Intronic
957004078 3:74923347-74923369 GCTGCATTCAAAGCTGTTCTGGG + Intergenic
957383589 3:79467232-79467254 CCATGATTCTAAACTGTTCTTGG + Intronic
957919019 3:86724462-86724484 GCAGCAATATAAAGTATTATTGG + Intergenic
958258031 3:91347677-91347699 GCATCATTCTAAAGCCTTATGGG - Intergenic
963076152 3:141348126-141348148 TAAGCATTTTAAAATGTTATGGG - Intronic
963193517 3:142500732-142500754 GCCTTATTCTAAACTGTTTTTGG - Intronic
965360089 3:167728289-167728311 GCAACAATCTAAACTCGTATAGG + Intronic
970028170 4:11646658-11646680 GGAGCATTTTAAACTATTTTTGG - Intergenic
970413094 4:15829561-15829583 GCTGCATTCAAAGCTGTCATGGG + Intronic
972205866 4:36771923-36771945 GCAGCAGACTTAACTGTCATGGG - Intergenic
976982950 4:91254765-91254787 TCTGCATTTTAAAATGTTATAGG + Intronic
977055532 4:92185714-92185736 GCCGCATTCAAAACTGTCCTGGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978019478 4:103789253-103789275 GCAGCTTTTGAAACTGTCATTGG - Intergenic
978362211 4:107943078-107943100 GCAGCTTTTTATACGGTTATTGG - Intronic
979920832 4:126493842-126493864 GCAGCATTCGAAACTGTACTGGG + Intergenic
980155563 4:129100272-129100294 GCTGCATTCTAAGCTGTCCTGGG - Intronic
990687408 5:58321417-58321439 GGAGCATTCTAAGCTTTTAGAGG - Intergenic
994172891 5:96677817-96677839 GCAGCATTCAAAACTGGAAGAGG + Intronic
995753834 5:115480608-115480630 GCAGGAATCTAAACTGGGATGGG + Intergenic
996000678 5:118359297-118359319 GCAGCATCATAAACTTTTAAGGG + Intergenic
996198256 5:120637163-120637185 GAACCATTTTAAACTGTTGTTGG + Intronic
997020619 5:129996473-129996495 GCAGCATTTTAATATGTTGTAGG + Intronic
997025562 5:130056746-130056768 GCAGGATTCTTAACTGTATTGGG + Intronic
998931844 5:147189908-147189930 GCCGCATTCAGAACTGTTCTGGG + Intergenic
1000395168 5:160767177-160767199 GCTGCATTCTAAGCTGCTCTGGG + Intronic
1001163359 5:169340949-169340971 TCAGCAGGCTAAACTGTTACAGG - Intergenic
1003054887 6:2809328-2809350 GCAGCATCATAAACTCTGATTGG - Intergenic
1004482735 6:16036664-16036686 TCTGCATTTTAAACTGTTTTAGG + Intergenic
1008761202 6:54852865-54852887 GCAGCATTCAAAACTGTCCTGGG - Intronic
1008997227 6:57673031-57673053 GCGGCATTCTAAAGCCTTATGGG + Intergenic
1009185740 6:60572361-60572383 GCGGCATTCTAAAGCCTTATGGG + Intergenic
1009942283 6:70303339-70303361 GCAGCTTTCAGAACTGCTATAGG + Intergenic
1011045561 6:83077925-83077947 GCCACATTCAAAACTGTTCTGGG + Intronic
1011351931 6:86433051-86433073 TGAGCATGATAAACTGTTATTGG - Intergenic
1012565700 6:100647444-100647466 GCTGCATTCTAAAAAATTATAGG + Exonic
1012621896 6:101355251-101355273 TCAGAATGCTAAACTATTATAGG - Intergenic
1012647750 6:101709377-101709399 GAAGCACTCTAAAATGTTAGAGG - Intronic
1016024729 6:139274746-139274768 GCAGCATTCTAGACTAATACAGG - Intronic
1017099807 6:150838335-150838357 GCCACATTCAAAGCTGTTATGGG - Intronic
1018941611 6:168312078-168312100 GTAGCATTTTGAACTGTTACAGG + Intronic
1020287778 7:6698608-6698630 GCTGCATTCTGAACTGCTGTAGG - Intronic
1032422683 7:131795446-131795468 GCAGCATATTAAACTGACATCGG - Intergenic
1032631138 7:133653354-133653376 TGAGTATTCTCAACTGTTATAGG - Intronic
1032684032 7:134212374-134212396 GCAGCATGCTAAACTGTATTTGG + Intronic
1033629870 7:143147191-143147213 GGAACATTCTAATCTGATATTGG + Intergenic
1034732910 7:153403457-153403479 GCAGCATTTTAAACTGCTCATGG + Intergenic
1036036250 8:5022564-5022586 GCAGAATTGGAAATTGTTATGGG - Intergenic
1037661862 8:20934702-20934724 GCAGATTTCTAAACTGTACTGGG + Intergenic
1041836043 8:62216502-62216524 GCAGCATTCTAAAATGAAAATGG + Intergenic
1044208908 8:89526193-89526215 GCTGCATTCAAAGCTGTTCTGGG - Intergenic
1047249103 8:123168214-123168236 GCAGCATTCAAAGCTGTCCTGGG - Intergenic
1047853656 8:128886204-128886226 ACAGCATAATAAACTGTCATGGG + Intergenic
1050273503 9:3971786-3971808 CCAGCATTCTAAAGTGTGGTAGG - Intronic
1052120962 9:24715533-24715555 GCACAGTTCTAATCTGTTATTGG - Intergenic
1052439185 9:28471565-28471587 GCACCATTCTTACCAGTTATAGG + Intronic
1057450325 9:95152992-95153014 GCAGCATTCAAAGCTGTCCTGGG + Intronic
1057630935 9:96718718-96718740 GCAGCATTCAAAGCTGTCCTGGG - Intergenic
1061411973 9:130426689-130426711 GCCGCATTCAAAGCTGTTCTGGG - Intronic
1186938120 X:14473585-14473607 GCAGCATTTTACACACTTATAGG - Intergenic
1188565054 X:31517469-31517491 GCGGCATTCTAAGCTCTCATTGG - Intronic
1189511089 X:41662187-41662209 GCAAGATTCTAAGCTGCTATGGG - Intronic
1191896864 X:66002067-66002089 GCAGCATTCTAATCTGATTGTGG + Intergenic
1193171407 X:78340979-78341001 GCAGCATTCTTATCTGGTTTGGG + Intergenic
1195018759 X:100804847-100804869 GCAACATTCTAACCTGTCAAGGG + Intergenic