ID: 1146495347

View in Genome Browser
Species Human (GRCh38)
Location 17:33317276-33317298
Sequence GAACCCTTGATTGCAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146495347_1146495350 -7 Left 1146495347 17:33317276-33317298 CCTCCTGCTGCAATCAAGGGTTC 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1146495350 17:33317292-33317314 AGGGTTCATGTGAGCTCTGAGGG 0: 1
1: 0
2: 0
3: 23
4: 278
1146495347_1146495352 7 Left 1146495347 17:33317276-33317298 CCTCCTGCTGCAATCAAGGGTTC 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1146495352 17:33317306-33317328 CTCTGAGGGTAGACCTTAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 112
1146495347_1146495349 -8 Left 1146495347 17:33317276-33317298 CCTCCTGCTGCAATCAAGGGTTC 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1146495349 17:33317291-33317313 AAGGGTTCATGTGAGCTCTGAGG 0: 1
1: 0
2: 2
3: 12
4: 186
1146495347_1146495351 6 Left 1146495347 17:33317276-33317298 CCTCCTGCTGCAATCAAGGGTTC 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1146495351 17:33317305-33317327 GCTCTGAGGGTAGACCTTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146495347 Original CRISPR GAACCCTTGATTGCAGCAGG AGG (reversed) Intronic
900519082 1:3097008-3097030 GCACCCATGGCTGCAGCAGGTGG - Intronic
901008899 1:6187219-6187241 GATCCCTTGAATCCAGGAGGCGG + Intronic
901234669 1:7661518-7661540 GAACCCCCGATGGGAGCAGGGGG + Intronic
901917089 1:12508148-12508170 GATCCCTTCACTGTAGCAGGTGG + Intronic
902078272 1:13804226-13804248 GAGCCCTTGAGTACAGCCGGTGG - Intronic
902111490 1:14082503-14082525 CAACCCTTGATTGCATCCTGTGG + Intergenic
902489180 1:16768485-16768507 GACCCCTGGATTGGAGCAGTGGG + Intronic
903968342 1:27103183-27103205 GGGCCCTTGGTTGCAGAAGGAGG - Intronic
904038520 1:27571413-27571435 GAACCCTGAGCTGCAGCAGGAGG + Intronic
905001257 1:34671624-34671646 GCACCATGGATGGCAGCAGGAGG + Intergenic
907491677 1:54812518-54812540 GGAACCTTGATGGCAGAAGGTGG + Intronic
907973168 1:59404601-59404623 GGAGCATGGATTGCAGCAGGGGG + Intronic
909009986 1:70323554-70323576 AACCCCTTGAATGCAGGAGGCGG + Intronic
909278909 1:73723688-73723710 GAAGCCTTAATTTGAGCAGGAGG + Intergenic
909740726 1:79026575-79026597 GAACCCTTGAGTCTAGGAGGTGG - Intergenic
912425194 1:109582090-109582112 CTACCCTTGAGTGAAGCAGGAGG - Intronic
912710169 1:111944376-111944398 GTGCCCTTGATTGCAACAGTGGG + Intronic
913203637 1:116516227-116516249 GAACCCATTGTGGCAGCAGGGGG - Intronic
914243856 1:145871884-145871906 GCAACCTTTATTGCAGCAGTGGG - Intronic
917284459 1:173409902-173409924 CAAACCTTGAATGCAGCAGGAGG - Intergenic
917390320 1:174529646-174529668 GAAGCCTTGGTTCCAGCAAGTGG + Intronic
917507798 1:175644323-175644345 GTATTCTTGATTGCAGCTGGGGG - Intronic
919680604 1:200431093-200431115 GATCACTTGAATGCAGGAGGTGG - Intergenic
920713536 1:208317880-208317902 GAACCCTTGGTAGGAGCATGTGG + Intergenic
921207713 1:212862793-212862815 GAACCCTTGAATACGGCTGGTGG - Intronic
921564954 1:216705840-216705862 GGACTCATGAATGCAGCAGGTGG + Intronic
922548706 1:226477925-226477947 GATGCCTTGATTTCAGCTGGGGG + Intergenic
923531257 1:234814040-234814062 GACCCCTGGATTGGAGCAGTGGG - Intergenic
923687043 1:236160680-236160702 AGACCCTGGATGGCAGCAGGAGG - Intronic
1063999209 10:11649355-11649377 GATCCCTTGAATCCAGGAGGCGG + Intergenic
1066405499 10:35114356-35114378 AAACACTTGAATGCAGCTGGGGG - Intergenic
1067850554 10:49751310-49751332 GAGCCCTTGAGTGTGGCAGGAGG - Intronic
1069950099 10:72012707-72012729 GAGCCCTGGATTTCAGCAGATGG - Exonic
1070736407 10:78866507-78866529 GGGCCCTGGCTTGCAGCAGGAGG - Intergenic
1071337472 10:84612478-84612500 CAGCCCTTGTCTGCAGCAGGGGG + Intergenic
1072081045 10:92032357-92032379 GAACCCTTTCTTGAAGCAGGAGG - Intergenic
1072158447 10:92744829-92744851 GAAAGCTTGAATGCAGCTGGAGG + Intergenic
1077521975 11:3041812-3041834 GGACGCGTGGTTGCAGCAGGTGG - Intronic
1077791287 11:5442914-5442936 GTACCCTTGAATGGAGAAGGTGG - Intronic
1079317465 11:19421251-19421273 GGAACCTGGACTGCAGCAGGTGG - Intronic
1081666265 11:44918725-44918747 TAGCCTTTGACTGCAGCAGGAGG + Intronic
1082882187 11:58048580-58048602 GAACCCTTGAACTCAGGAGGTGG + Intronic
1085276292 11:75302277-75302299 GAACCCGTGAATGCGGCAGGAGG - Intronic
1085807686 11:79651291-79651313 AAGCCCTTGAATGCAGGAGGCGG - Intergenic
1088437415 11:109830680-109830702 GAACACTTGAGTGCAGGAGTTGG + Intergenic
1089175665 11:116547299-116547321 GGTCCCTGGATTGCAGTAGGTGG - Intergenic
1089249426 11:117146877-117146899 GATCGCTTGAGTGCAGGAGGCGG + Intronic
1089389489 11:118090689-118090711 GAGCCCTTGAGCGCAGGAGGTGG + Intronic
1089409187 11:118224800-118224822 GAACTCTTGATCTCTGCAGGGGG - Intronic
1091914037 12:4254952-4254974 GAACACTTGAACGCAGGAGGTGG + Intergenic
1096133349 12:49178815-49178837 GAATCCTTGAATTCAGGAGGCGG - Intergenic
1098299133 12:69036111-69036133 GAATCCTTGAACGCAGGAGGTGG + Intergenic
1099287114 12:80727289-80727311 GATCGCTTGAGTGCAGGAGGTGG - Intergenic
1101460694 12:104890154-104890176 GAGCCCTCGATTCCAGCACGTGG - Intronic
1102594494 12:113982068-113982090 CAACAGGTGATTGCAGCAGGAGG - Intergenic
1102649027 12:114423785-114423807 GAACCAATCATTGCAGCTGGAGG - Intergenic
1103170325 12:118813078-118813100 GAACCATTGTTTGAAGCTGGGGG - Intergenic
1104304330 12:127595629-127595651 GAACTCTGGATTGCAGCAGCTGG + Intergenic
1105385382 13:19924479-19924501 GATCGCTTGAGTGCAGGAGGCGG + Intergenic
1108713976 13:53060806-53060828 GAACCTTTAAGCGCAGCAGGGGG + Intergenic
1109470615 13:62799408-62799430 GCACCCTGAATAGCAGCAGGAGG + Intergenic
1112324821 13:98436952-98436974 GAACCTTGGATTGGAGGAGGTGG + Intronic
1113267219 13:108633058-108633080 GCAGCATTGTTTGCAGCAGGAGG + Intronic
1114305348 14:21418431-21418453 GATCACTTGAATGCAGGAGGCGG + Intronic
1115236417 14:31212499-31212521 GATCCCTTGAGTCCAGGAGGTGG - Intergenic
1117213973 14:53530419-53530441 GATCCCTTGAATCCAGTAGGTGG + Intergenic
1117374627 14:55109273-55109295 GATCCCTTGATTCCAGGAGGTGG - Intergenic
1120990974 14:90377088-90377110 GATCACTTGAATGCAGGAGGCGG - Intergenic
1121009684 14:90512630-90512652 GAGCCCTTGTGTGCGGCAGGAGG + Intergenic
1121866054 14:97363953-97363975 GAACACTTGATTCCATGAGGTGG - Intergenic
1122694646 14:103546764-103546786 CAACCCATGATGGTAGCAGGTGG + Intergenic
1125122876 15:36183644-36183666 GAAACCTCGATTGGGGCAGGAGG - Intergenic
1127421005 15:58805985-58806007 GAACCCTTGAACCCAGGAGGTGG + Intronic
1128889252 15:71316344-71316366 AACCCCTTGGTTGGAGCAGGGGG - Intronic
1135078918 16:19417330-19417352 GATCCCTTGAGTCCAGGAGGCGG + Intronic
1137619796 16:49868657-49868679 GAAACCTTGTCTGAAGCAGGAGG + Intergenic
1138033561 16:53580217-53580239 GTACCATGGACTGCAGCAGGAGG - Intergenic
1138712776 16:58987345-58987367 GAACCAGTGGTGGCAGCAGGAGG - Intergenic
1141491088 16:84373411-84373433 AAACGCTTGAATGCAGGAGGTGG + Intronic
1142957008 17:3529204-3529226 GAGCCCGGGCTTGCAGCAGGAGG + Intronic
1143014134 17:3882779-3882801 GAGCCCCTCATTGCAGCTGGAGG - Intronic
1144284212 17:13757007-13757029 CAAGCCTTGATTACAACAGGCGG + Intergenic
1146495347 17:33317276-33317298 GAACCCTTGATTGCAGCAGGAGG - Intronic
1147369904 17:39985139-39985161 GATCACTTGAATGCAGGAGGTGG + Intronic
1148515869 17:48216576-48216598 GATCCCTTGATCCCAGGAGGTGG - Intronic
1150436383 17:65157473-65157495 GAATCCTTGAGGGGAGCAGGTGG + Intronic
1151133935 17:71926904-71926926 GAATCCTGGATTACAGCATGTGG + Intergenic
1151497693 17:74468552-74468574 GATCCCTTGATCCCAGGAGGTGG - Intronic
1151627220 17:75284511-75284533 GACCCCTTCAGTGCAGCTGGCGG + Intronic
1152123618 17:78433566-78433588 GAACCCAGGTTTGGAGCAGGAGG - Intronic
1154030402 18:10748535-10748557 AAACTCTTCTTTGCAGCAGGAGG + Exonic
1160094587 18:75860100-75860122 GACTCCTTGATTGCAGGGGGTGG - Intergenic
1160976244 19:1794112-1794134 GATCGCTTGAGTGCAGGAGGTGG - Intronic
1161285308 19:3465542-3465564 GCACCCCTGAATACAGCAGGAGG - Intronic
1162792795 19:13071791-13071813 GCACCCCTGCTTGCAGCATGAGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163622190 19:18367688-18367710 CAGCCCTTGATTGGAGCAGGTGG - Exonic
1166897448 19:46032810-46032832 GCACCATGGATGGCAGCAGGAGG + Intergenic
1167255158 19:48423122-48423144 GATCGCTTGAATGCAGGAGGCGG + Intronic
925124709 2:1445787-1445809 GAACCACTCATTGCTGCAGGAGG + Intronic
925124735 2:1445921-1445943 GATCCCGTCATTGCTGCAGGAGG + Intronic
925747566 2:7056653-7056675 GAACACTTGAGGGCAGCAGCAGG - Intronic
925991275 2:9256918-9256940 CAGCCCTTGGCTGCAGCAGGAGG - Intronic
927275894 2:21262112-21262134 GAACTTTTGAATGCAGGAGGTGG + Intergenic
928579787 2:32695815-32695837 GAACCCTTGAACCCAGGAGGTGG + Intronic
930664461 2:54088379-54088401 GCCCCTTTCATTGCAGCAGGAGG - Intronic
931255201 2:60565688-60565710 CAACCTGTGATTGCAGCAGGGGG - Intergenic
931648574 2:64448324-64448346 GAACCCTTGCTTCCAGCATTTGG - Intergenic
932151459 2:69376430-69376452 GAACCCTTGAACCCAGGAGGCGG + Intronic
932584542 2:73018848-73018870 GGATCCTGGGTTGCAGCAGGTGG - Intronic
933669940 2:84997855-84997877 GAACACTTGAATCCAGGAGGCGG - Intronic
934699075 2:96423979-96424001 GAGCCCCTGATTGGGGCAGGGGG - Intergenic
935480077 2:103575908-103575930 AAACACTTGATTCCAGGAGGCGG + Intergenic
935544063 2:104382115-104382137 GAACTCTAGATAGCAGCAGTAGG + Intergenic
936698732 2:114984299-114984321 GAACCCTGGTTTGCAGAATGGGG + Intronic
938422981 2:131158603-131158625 GAACACTTTTTTGGAGCAGGGGG - Intronic
939351451 2:141043114-141043136 GATCACTTGAGTGCAGGAGGAGG + Intronic
941615493 2:167713963-167713985 GGACCACTGATTGCAGCAAGAGG + Intergenic
947363675 2:229372287-229372309 GAGCTCTTCAGTGCAGCAGGAGG + Intronic
948151714 2:235749661-235749683 GAACCCTCACCTGCAGCAGGTGG - Intronic
1171422022 20:25023993-25024015 GTCACCTTGATTGCTGCAGGTGG - Intronic
1175174915 20:57105676-57105698 GAGCCCCTGATTGTGGCAGGGGG - Intergenic
1177402801 21:20627603-20627625 GATCCCTTGAGTGCAGAAGTTGG + Intergenic
1180071996 21:45441261-45441283 GAACCCTGAAGGGCAGCAGGTGG - Intronic
1182059183 22:27384828-27384850 GATCCCTTGAGTCTAGCAGGTGG - Intergenic
1182419068 22:30240006-30240028 GATCCCTTGATCCCAGGAGGTGG - Intergenic
1184454842 22:44603830-44603852 GCACCCTCGATTGCAGCTGTTGG - Intergenic
949930287 3:9072923-9072945 GATCCTTTGATTACATCAGGAGG + Intronic
950694342 3:14686445-14686467 AAACCCTTGTATGCAGCTGGTGG - Intronic
952915736 3:38239706-38239728 GAACCCTAGATAGCTGCAGACGG - Intronic
953386446 3:42508913-42508935 TACCCCATGATTTCAGCAGGGGG + Intronic
958758089 3:98274395-98274417 GAACAGGTGATAGCAGCAGGAGG + Intergenic
958761481 3:98314054-98314076 GATCCCTTGAGTCCAGAAGGTGG + Intergenic
960451482 3:117814375-117814397 AAATCCTTGAGTACAGCAGGAGG + Intergenic
960632754 3:119749435-119749457 GATCACTTGAGTGCAGGAGGTGG + Intronic
960912801 3:122666090-122666112 GGACCCTTGGTTGCAGCTGATGG + Intergenic
963139402 3:141935227-141935249 GAACTCTTGATTGGAAGAGGAGG - Intergenic
963384546 3:144574112-144574134 GAACGCTTGATCCCAGGAGGTGG + Intergenic
967765186 3:193271569-193271591 AAATTCTTGGTTGCAGCAGGTGG + Intronic
971439328 4:26663022-26663044 CAATCCTAGATTGGAGCAGGAGG + Intronic
971512119 4:27439650-27439672 GAACCCTTGTATGCTGCTGGTGG + Intergenic
972697348 4:41460664-41460686 GAACTCATGATTAAAGCAGGTGG - Intronic
972788152 4:42346380-42346402 GGTCCCATGATGGCAGCAGGAGG + Intergenic
978216243 4:106208150-106208172 CTACCATTGATAGCAGCAGGAGG + Intronic
984033131 4:174630072-174630094 GAACCCTTGAACCCAGGAGGCGG - Intergenic
985085410 4:186308101-186308123 GAAGGCTTGGCTGCAGCAGGAGG - Intergenic
985233045 4:187842320-187842342 GATCACTTGAGTCCAGCAGGTGG + Intergenic
992027790 5:72687711-72687733 GAACCCATGATTGAAGCACATGG + Intergenic
992295775 5:75325093-75325115 GAACTCTTCATTTCAGCAGCAGG - Intergenic
993863047 5:93159308-93159330 GAACCCTTGCTGGCAGTGGGAGG - Intergenic
999270424 5:150293665-150293687 GAGCCGATGATTGCAGGAGGGGG + Intergenic
999861452 5:155651556-155651578 GAACCCTTATTTGCTGCTGGTGG + Intergenic
1004223829 6:13769172-13769194 GATCCCTTGAACGCAGGAGGCGG - Intergenic
1005471101 6:26163520-26163542 GAATCCTTGACTGTAGCTGGAGG + Intronic
1007079815 6:39091963-39091985 CAACTCCTGATAGCAGCAGGTGG + Intergenic
1013859978 6:114624106-114624128 AAACACTCGATTGGAGCAGGAGG - Intergenic
1015686231 6:135864978-135865000 GAACACTTGGATGCAGGAGGGGG - Intronic
1018791581 6:167152586-167152608 GAACCCTTGTGTGCTGCTGGTGG + Intronic
1019582797 7:1775636-1775658 GAAGCCTTGAGGGCAGCTGGAGG - Intergenic
1019887439 7:3917863-3917885 GAAACCTTGAGTGCAGGAGGAGG - Intronic
1019894280 7:3971657-3971679 GAACTTTTGATTTCAGCAGCAGG + Intronic
1025682799 7:63693417-63693439 GAAGCCTTGCTTCCAGTAGGGGG + Intergenic
1026664125 7:72327400-72327422 AATCCCTTGAATCCAGCAGGCGG + Intronic
1027054021 7:75037975-75037997 GAACCCTTGGTTGGTGCAGCAGG + Intronic
1027635473 7:80667341-80667363 GATCACTTGATTCCAGGAGGTGG + Intronic
1029645975 7:101856091-101856113 GATCGCTTGAGTCCAGCAGGAGG + Intronic
1029681844 7:102117009-102117031 GTCCCCTTGATTGCAGCACTGGG - Intronic
1030568095 7:111186505-111186527 GAACCCTTGAACCCAGGAGGTGG - Intronic
1031912958 7:127536794-127536816 GAACCTGGGCTTGCAGCAGGCGG - Intergenic
1033536476 7:142316961-142316983 GAACACTTGATTTCAGCCAGAGG + Intergenic
1034866321 7:154645486-154645508 GAAGTCTGGATTTCAGCAGGAGG - Intronic
1034881022 7:154762698-154762720 GAGCCCTTGCTTGAAGCAGGAGG - Intronic
1035016582 7:155771824-155771846 GATCCCTTGAGCCCAGCAGGTGG - Intronic
1035457234 7:159016542-159016564 GAACCCTTGTCTGCAGCCAGTGG + Intergenic
1036112984 8:5926121-5926143 AATCCCTTGAATGCAGGAGGTGG + Intergenic
1036983853 8:13503635-13503657 GAACACTTGATTTCAGCCAGTGG - Intronic
1038884608 8:31649331-31649353 GAACCCTTGTTTACTGCTGGTGG - Intronic
1041901419 8:62987354-62987376 GAACCCTTGAATTCAGGAGGTGG + Intronic
1044872562 8:96633727-96633749 GAGCCCTTGATTCCAGGAGTTGG - Intergenic
1046980874 8:120335333-120335355 GGGCCCTTGAAAGCAGCAGGAGG + Intronic
1047581803 8:126223940-126223962 GTGTCCTTGATAGCAGCAGGAGG - Intergenic
1047597228 8:126391124-126391146 GATCCCTGGATTGAAGCATGAGG + Intergenic
1048686143 8:136907300-136907322 GAGCAATTGATAGCAGCAGGAGG - Intergenic
1059082166 9:111261638-111261660 AATCCCTTGAATGCAGGAGGTGG + Intergenic
1186838044 X:13457490-13457512 GAAGCACTGATTGAAGCAGGTGG - Intergenic
1187641518 X:21295839-21295861 GTTCCTTTGACTGCAGCAGGAGG - Intergenic
1187694977 X:21910488-21910510 GATCACTTGAATGCAGGAGGCGG + Intergenic
1188854012 X:35170109-35170131 GAACCCTTGAACCCAGGAGGTGG - Intergenic
1192019958 X:67377593-67377615 GAACTTTTGATAGCAGCAGGAGG - Intergenic
1194574437 X:95594293-95594315 GATCCCTTGAGTCCAGGAGGTGG + Intergenic
1197657979 X:129138050-129138072 GATCACTTGAATGCAGGAGGTGG - Intergenic
1197714381 X:129695871-129695893 GACGTCCTGATTGCAGCAGGTGG - Intergenic
1200324799 X:155225278-155225300 GATCCCTTGAATCCAGGAGGTGG - Intronic