ID: 1146495543

View in Genome Browser
Species Human (GRCh38)
Location 17:33318878-33318900
Sequence TAGGGAAGGAAAGTGATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146495539_1146495543 1 Left 1146495539 17:33318854-33318876 CCTTTTCTGGAGAGAGCTGATGA 0: 1
1: 0
2: 0
3: 12
4: 249
Right 1146495543 17:33318878-33318900 TAGGGAAGGAAAGTGATTCCAGG 0: 1
1: 0
2: 4
3: 28
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146495543 Original CRISPR TAGGGAAGGAAAGTGATTCC AGG Intronic
901435515 1:9245174-9245196 TGGGGCAGGAGAGGGATTCCAGG - Exonic
901739293 1:11331748-11331770 CAGGGAAGGAAAGAGAGTTCAGG - Intergenic
902913192 1:19616475-19616497 GAGGGAAGGAAAGTATTTTCTGG + Intronic
903587930 1:24431160-24431182 GAGGGAAGAAAAGTCATTCTTGG + Intronic
903760263 1:25692796-25692818 CAGGGAAGGCATGTGATTCGTGG + Intronic
904398170 1:30236975-30236997 CAGAGAAGGGAAGTGATTCGAGG - Intergenic
904605920 1:31697571-31697593 TATGCAAGGAAAGGCATTCCAGG + Intronic
904754146 1:32758875-32758897 TTGGGAAGGAAGGGAATTCCAGG - Intronic
904791725 1:33027439-33027461 TAGGGAAGAAAACTAATTCCTGG + Intronic
904813437 1:33179073-33179095 TAGGAATGGAAAGTGAGGCCTGG - Intronic
905120346 1:35677023-35677045 TAGGGAAGGAGAGGGTTTCAGGG + Intergenic
905872688 1:41414278-41414300 GAGGGATGGAAGGTGAATCCAGG + Intergenic
908897607 1:68918157-68918179 TTGGGAAGGAAGCTGAATCCTGG - Intergenic
909429878 1:75575090-75575112 TAGGGAAAGAAAATGATTTTTGG - Intronic
911020050 1:93377078-93377100 AAGGGAAGAAAAGACATTCCTGG + Intergenic
911377175 1:97064933-97064955 TAAAGAAAGAAAATGATTCCGGG + Intergenic
912254143 1:108041944-108041966 GAGGGCAGGCAAGTGATTCATGG + Intergenic
913047986 1:115089671-115089693 GAGGGAAGGAAGGTGGTCCCTGG - Intergenic
913461992 1:119097493-119097515 TAGGTCAAGAAAGGGATTCCAGG - Intronic
913513266 1:119581691-119581713 TAAGAAAGGAAAATGCTTCCGGG + Intergenic
913516896 1:119612675-119612697 TAAGAAAGGAAAATGCTTCCGGG + Intergenic
915754582 1:158247751-158247773 CAGGTTAGGAAAGTGAGTCCAGG + Intergenic
916146854 1:161747798-161747820 AAGGGGAGGAAAGTTTTTCCTGG - Intergenic
916164900 1:161957813-161957835 TATGGAAGGGAAGTGATCTCTGG + Intronic
917355142 1:174119600-174119622 TAGGGAAGGGATGGGGTTCCTGG + Intergenic
918102654 1:181390043-181390065 TCAGGAAGGAAAGTCCTTCCTGG - Intergenic
919758037 1:201078126-201078148 AAGGGAAGGAGAGTGATGCCGGG - Intronic
921275999 1:213520641-213520663 TAGGGAAGGAAAGTGGGTATGGG - Intergenic
923923195 1:238593072-238593094 TAGAGAGGGATAGTTATTCCTGG - Intergenic
924018000 1:239748880-239748902 TACTGAAGGAAAATGATTTCTGG + Intronic
924037714 1:239953859-239953881 CTGGGAAGGAAAGAGATGCCAGG - Intergenic
1065469366 10:26061456-26061478 CATGGAAGGAAAATAATTCCAGG + Intronic
1065482601 10:26210855-26210877 TGGGGAAGGGCAGTAATTCCAGG - Intronic
1065948326 10:30627090-30627112 CAGGGAAGGAATGTGACTGCAGG + Intronic
1066022486 10:31318545-31318567 AAGGGAAGGGAAGGGAGTCCGGG + Intronic
1067907903 10:50313064-50313086 CAGAGAAGGAAAGTAATTCTAGG + Intronic
1069006631 10:63324762-63324784 TCGGGAAGAAAAGAGGTTCCAGG + Intronic
1069030366 10:63589568-63589590 TAGGGGAGGAAAAGGCTTCCTGG - Intronic
1071013663 10:80968674-80968696 GGGTGAAGGAAAGTGATGCCAGG + Intergenic
1073289758 10:102407751-102407773 TAGGGAAGGAAAGTGCTGAGAGG - Intronic
1073523149 10:104154318-104154340 TAAGGAAAGAGACTGATTCCGGG + Intronic
1075491456 10:122874384-122874406 GAGGGAAGGAAAATGATCCAAGG - Intronic
1075535123 10:123264572-123264594 TTGGGAGGGAGAGTGATTTCAGG - Intergenic
1076355770 10:129852030-129852052 TTGGCATGGAATGTGATTCCCGG - Intronic
1077376324 11:2206445-2206467 TAGGGAAGGACAGTGAGTCTGGG + Intergenic
1077986159 11:7353293-7353315 TATTGCAGGAAAGTGGTTCCTGG - Intronic
1078529188 11:12123493-12123515 TAAGGAAGGAATGTGAGTCCTGG - Intronic
1078933150 11:15928689-15928711 TCAGGAAGGAAAGGCATTCCAGG + Intergenic
1079430414 11:20384419-20384441 CAGGGAAGCAAAGTGATTCGAGG + Intergenic
1079764160 11:24369770-24369792 TAGGGATCAAAAGTCATTCCAGG + Intergenic
1080352091 11:31396955-31396977 TTGGGAAGGAAAGGTATTCCAGG - Intronic
1082561950 11:54628536-54628558 CAGGGCAGGAAAGAGATCCCTGG + Intergenic
1082663082 11:55938673-55938695 TAGGAAAAGACAGTGATTCTTGG + Intergenic
1082946366 11:58764925-58764947 TAGGGGAGGAGAGTCTTTCCTGG + Intergenic
1083269357 11:61563706-61563728 TAGAGAAGGAAAGGCGTTCCAGG - Intronic
1083737013 11:64687237-64687259 AGGGGAAGGCAAGTGCTTCCTGG - Intronic
1083854199 11:65384344-65384366 TGGGGAAGGAAAGGCATTCCAGG - Intergenic
1085296872 11:75436328-75436350 GAGGGAAGGAAGGGCATTCCAGG - Intronic
1086988645 11:93278386-93278408 TAGGGAAAGAATGTGAAACCAGG - Intergenic
1087379154 11:97382275-97382297 TAGAGAAGGAAATTGAAACCTGG - Intergenic
1089228260 11:116945557-116945579 TTGGGAAGGCAAGTGAGACCAGG - Intronic
1089528081 11:119109780-119109802 TAGGGGATGAAAGGGATTGCAGG + Intronic
1090373726 11:126274719-126274741 TAGGGAAGGAAAGGCAGTCAAGG + Intronic
1090498709 11:127240562-127240584 TATGGCAGGAAAGGGATTCCAGG - Intergenic
1090633838 11:128675593-128675615 TGGGGAAAGCAATTGATTCCAGG + Intergenic
1090787561 11:130063524-130063546 CAGAGAAGGAAACTGAATCCTGG - Intergenic
1091238215 11:134035603-134035625 TAGGGAAGGATGGTGATACCAGG - Intergenic
1091917132 12:4277745-4277767 TAGCAAATGAAAGAGATTCCAGG + Intronic
1093795408 12:23304295-23304317 TCTGGAAGGAAAGTGCTTACAGG - Intergenic
1096405149 12:51338577-51338599 TGGGGAAGGAAAGTCTTTTCTGG + Intronic
1096656660 12:53096726-53096748 GAGGGAAGGAAACGGATTCTGGG + Intergenic
1097967022 12:65592172-65592194 TAGGGAAGGAAATCTGTTCCTGG + Intergenic
1098979010 12:76934890-76934912 TAGGGAAAGTAAGTGACTTCTGG - Intergenic
1099531881 12:83792334-83792356 TATGGAAGGAAACTTATTCAAGG - Intergenic
1099783535 12:87231538-87231560 TAAGGAAAGAAAGAGGTTCCAGG - Intergenic
1099939590 12:89169920-89169942 GAGGAAAGAAAAGTGTTTCCAGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101925976 12:108971682-108971704 AAGGGAAGGAAGGTAATTCAGGG + Intronic
1102543117 12:113636495-113636517 AAGGGAAGGAAAGGAATTCATGG + Intergenic
1102657212 12:114492107-114492129 AAGGGAAGGAAAACGATTACTGG + Intergenic
1104149046 12:126064362-126064384 GAGAGAAGCAAAGTCATTCCTGG + Intergenic
1107640606 13:42439509-42439531 TAGGGAAGGAAAGAATTTCATGG + Intergenic
1107770540 13:43785344-43785366 GTGGGAAGGAAATTGATTCCTGG - Intronic
1108778325 13:53795152-53795174 TAGGGAAGGATAGTGGAGCCTGG + Intergenic
1109023582 13:57131116-57131138 TAGGAAAGGAAACTGGTTCCGGG + Intergenic
1109239068 13:59861015-59861037 TAGGGAGGGACACTGATTGCTGG + Intronic
1110410764 13:75201799-75201821 TTGGGAAGGAAAGTGGTAACTGG - Intergenic
1113679806 13:112235280-112235302 TAGGGAATGAAAGTGACCCTTGG - Intergenic
1114721923 14:24891884-24891906 AAGAGCAGGAAAGTCATTCCAGG - Intronic
1116426295 14:44795917-44795939 TAGGGAGGCAAAGGGATTGCTGG + Intergenic
1118049274 14:62009036-62009058 AAGGGAAGGAAATTTATTCAAGG - Intronic
1119226218 14:72946437-72946459 TAGGGAAAGAAAAGGACTCCAGG + Intronic
1119488192 14:75006282-75006304 TAGTGAATGAAAAAGATTCCTGG + Intronic
1120559955 14:85979196-85979218 TAGGCATGAAATGTGATTCCTGG - Intergenic
1121616443 14:95316895-95316917 TAGGGATTGAGAGGGATTCCTGG - Intronic
1121724286 14:96135263-96135285 TAAGGAAGGAATGTGATATCTGG - Intergenic
1124568057 15:30834336-30834358 TGGGGGAGGAAAGTGAATCTCGG - Intergenic
1124668704 15:31617702-31617724 GAGGGAAGGAAAGAGATTTCTGG + Intronic
1125539311 15:40460622-40460644 TAGGGAAGAGAAATGATTCTGGG - Intronic
1125980549 15:43996352-43996374 GAGGGAAGGAGAGTGAGTACCGG - Intronic
1127812158 15:62573670-62573692 TAGGGAGGGAAGGGGGTTCCTGG - Intronic
1128284835 15:66428207-66428229 TAGGGAAGGAGGGGAATTCCTGG - Intronic
1130012906 15:80165803-80165825 GAGGGAAGGAGAGTGAGACCAGG + Intronic
1130877141 15:88024317-88024339 TAGGGAAAGAGAGTGAGGCCAGG + Intronic
1131530117 15:93183746-93183768 TAGGGAAGGCAATTCATACCAGG + Intergenic
1132733711 16:1375473-1375495 TGGGGAAGGACAGTGTTGCCAGG - Intronic
1133100858 16:3478758-3478780 TAGGGGAGTGGAGTGATTCCAGG - Intronic
1133408844 16:5551209-5551231 TGGGGAAGGAAAGTGCTTGCTGG - Intergenic
1133441034 16:5821030-5821052 TAGGGAAGGAAAGGGAAACGAGG - Intergenic
1133500513 16:6361837-6361859 TAGGGAAGGAAAAGGAATACAGG + Intronic
1137705826 16:50535199-50535221 TAGGGAAGGAATCTGATTGGTGG - Intergenic
1138606482 16:58093345-58093367 AAGTGAAGGAAAGTGAGGCCAGG - Intergenic
1139091047 16:63648045-63648067 AAGGGAAGGTAATTGAATCCTGG - Intergenic
1140101245 16:71919344-71919366 TAGGGAAGGAAGCACATTCCAGG - Intronic
1140971904 16:80021562-80021584 GAGGATAGGAAAGTCATTCCAGG - Intergenic
1141133611 16:81451580-81451602 GAGGGAAGGGCAGTGTTTCCTGG + Intronic
1141328493 16:83085315-83085337 TAGGGGAGGTAATTGAATCCTGG - Intronic
1141379668 16:83565064-83565086 TAGGGCAGGGAAGTGATGCAGGG - Intronic
1143256267 17:5560246-5560268 CAGTGAAGGAAAGTCATTCAGGG - Intronic
1145849079 17:28073484-28073506 GAGGGAAGCAAAGAAATTCCTGG - Intronic
1146495543 17:33318878-33318900 TAGGGAAGGAAAGTGATTCCAGG + Intronic
1146587132 17:34092045-34092067 TGGGGAAGAAAAGAGATGCCAGG + Intronic
1147005145 17:37396855-37396877 TAGGGAAGATAAGTAATTCAAGG - Intronic
1148067336 17:44881781-44881803 TAGTGAGGGAAAGTGATTGATGG - Intronic
1148080093 17:44963194-44963216 GAGGGCAGGAACGTGTTTCCTGG - Intronic
1148328738 17:46800064-46800086 TTGGGAAGGAGTCTGATTCCTGG + Intronic
1149760073 17:59220925-59220947 GAGGGAAGGAGAGGGATTCCCGG + Intronic
1149971643 17:61224412-61224434 TAAGAAAGGAAAGTCATCCCAGG + Intronic
1151017479 17:70573354-70573376 TAGGTAAGGAAAATGCTTTCAGG + Intergenic
1151219434 17:72601344-72601366 TTGGGAAGGAAGGTCATCCCAGG - Intergenic
1151241096 17:72758538-72758560 TAGGGAAGGAAAGACTTTCCAGG - Intronic
1151947174 17:77326044-77326066 TAAGGATGGCAAGTGCTTCCAGG - Intronic
1152324251 17:79626441-79626463 CAGGGAAGGAATGGGCTTCCCGG + Intergenic
1152642136 17:81453746-81453768 CAGGGAGGGAAACTGAGTCCAGG + Intronic
1153021630 18:634757-634779 AAGGGAGGGAAAAGGATTCCTGG - Intronic
1153044861 18:846701-846723 TAGGTAAGGAAATTGAGTCTTGG + Intergenic
1156220122 18:35042361-35042383 TACAGTAGGAAGGTGATTCCTGG + Intronic
1159227095 18:65553940-65553962 TAGAGATGGAAAATGATTACTGG + Intergenic
1159263619 18:66049783-66049805 GAAAGAAGGAAAGAGATTCCTGG + Intergenic
1159455768 18:68658823-68658845 AAGAGAAGGAATGGGATTCCAGG + Intergenic
1161953272 19:7479148-7479170 TAGGGAAAAACACTGATTCCTGG + Intronic
1162748036 19:12810276-12810298 AAGGGAAGGAGGGAGATTCCAGG + Intronic
1162764789 19:12912316-12912338 CAGGAAGGGAAAGTCATTCCAGG - Intronic
1163371970 19:16906116-16906138 CAGGCAAGGAAAGTGATGCTTGG + Intronic
1163526620 19:17825301-17825323 AAGGGAAGGAAAGGCATTCCTGG - Exonic
1165000429 19:32757388-32757410 TAGGGACAGACAGTGATTACTGG - Intronic
1166645636 19:44529725-44529747 CAGGGAAGGAAAGTGAGCCCTGG - Intronic
1166955004 19:46457917-46457939 TAGGGAATGTTAGTGATGCCGGG - Intergenic
1167436182 19:49480230-49480252 TAAGGAAGGAAAGAGAGGCCTGG - Intronic
924961135 2:35617-35639 TAGGGAAGGAAAGTTTTCCCAGG + Intergenic
925947563 2:8879902-8879924 AAGGGACGGAAAGTGATGGCAGG + Intronic
926145414 2:10394247-10394269 TGGAGAAGGAAAGAGACTCCGGG - Intronic
926367128 2:12143797-12143819 TAGGGAGGGAAAATGCTTTCTGG + Intergenic
926802509 2:16671486-16671508 TAGGGAAGGAAAGTGGAGGCAGG + Intergenic
927021948 2:19026393-19026415 AATGGAAGGAAAGTGAGGCCGGG + Intergenic
928193539 2:29195820-29195842 GAGGGAAAGAAAGTGAATACAGG + Intronic
928391164 2:30912072-30912094 GAGGGAGGGAAAGTGCTGCCTGG - Intronic
930738233 2:54801220-54801242 TGGGGCAGGAGAGTGAATCCGGG + Intronic
931117825 2:59183628-59183650 CAGGGCAGGCAAGTGATTCTGGG + Intergenic
931121553 2:59225842-59225864 TTGGGAAGCAAAGAGAATCCAGG + Intergenic
933900220 2:86844327-86844349 TAGGGAAGGAAAGCAATGGCTGG + Intronic
935269424 2:101420670-101420692 TGGGGTAGGAGAGGGATTCCAGG - Intronic
935413142 2:102786989-102787011 TAGGGAAGGAAACTGAGGCATGG + Intronic
935780335 2:106504896-106504918 TAGGGAAGGAAAGCAATGGCTGG - Intergenic
935984401 2:108658766-108658788 TAGGTTAGGAAAGTGACACCAGG - Intronic
939697863 2:145350105-145350127 TAGAGAAGGGAACTGAATCCAGG + Intergenic
942767128 2:179470070-179470092 TAGGGAAGGCAAGGAATTCAGGG - Intronic
943066181 2:183089177-183089199 CAAGAAAGGAAAGTGATTCAAGG + Intronic
943278845 2:185903926-185903948 TAGTGAAAGGATGTGATTCCAGG + Intergenic
943486576 2:188492592-188492614 TAAGTAAGGAAAGTGATGCTGGG + Intronic
943655161 2:190500549-190500571 GAGGGAATGAAAGTGTTTCGAGG + Exonic
943883899 2:193185980-193186002 TATGGAAGGAAAGTGACACTAGG + Intergenic
945432864 2:209785105-209785127 TAGGAGAGGTAAGTGATACCTGG + Intronic
946606274 2:221408770-221408792 TAGGGAAGAAGAGTTAGTCCTGG - Intergenic
947105118 2:226661091-226661113 TAGGGAAGGAAAGGAATTAAGGG + Intergenic
947134565 2:226964312-226964334 TGGGGAAGGAAAGTGACTCCAGG - Intronic
947956331 2:234195311-234195333 GAGGGAAAGGAAGTGAATCCTGG - Intergenic
1169188404 20:3639791-3639813 TAGGGAAGGAGAGTATTCCCTGG - Intronic
1169552740 20:6717823-6717845 TAGGGAGGGACAGTGATTAGGGG + Intergenic
1169760520 20:9087606-9087628 TAGGGAAGAAAAGGAATTCCTGG + Intronic
1170714600 20:18820763-18820785 GAGGGAAGGAAGGTGATACAGGG + Intronic
1170747815 20:19116385-19116407 CAGGGAAGGAAACTGAGGCCAGG + Intergenic
1171187048 20:23130070-23130092 TAGGGAAGGGAACTGACCCCGGG - Intergenic
1171475214 20:25403379-25403401 TAGGGAAGGCAGGAAATTCCAGG - Intergenic
1172601596 20:36187651-36187673 GAGGGAAAGAAAGTGATCACAGG - Intronic
1174986522 20:55460259-55460281 TAGGGAAGGAAATAGATTCTAGG + Intergenic
1175343252 20:58248933-58248955 TAGGCAAAGACAGTGATACCTGG - Intergenic
1175535916 20:59712145-59712167 TAGGGAAAAAAACTGATTCAGGG - Intronic
1176971479 21:15271088-15271110 TAGGGAAGGTAAGTGTTTTTAGG + Intergenic
1179141346 21:38728132-38728154 TAGAGAAGGAAAGTGAGACAGGG - Intergenic
1181474390 22:23159408-23159430 TAGGCAATGAAAGTGCTGCCAGG - Intronic
1181521578 22:23451442-23451464 TTGGGATGGAAAGTGACTCATGG - Intergenic
1182078867 22:27514842-27514864 TAGGGAAGGAAAATGAGACTTGG - Intergenic
1182967004 22:34531672-34531694 CAGGGAAGCAAAATCATTCCTGG + Intergenic
1184930244 22:47675486-47675508 TAGGGAAGGCATGGGATGCCAGG + Intergenic
949383336 3:3469978-3470000 TAAGGCAGGAAAGTGTTTCAAGG - Intergenic
950845463 3:16011420-16011442 TAGGGAAGGAAAGAGGTGCTGGG + Intergenic
951702768 3:25512620-25512642 TAGGGAGGGAAAGGCATTGCAGG - Intronic
952313415 3:32211062-32211084 TAAAGAAGGAATGTGAGTCCTGG - Intergenic
952708455 3:36405068-36405090 TAGGAAAGGACAGTGTTTTCAGG + Intronic
953725518 3:45394535-45394557 TGGGAAAGGAGAGTAATTCCCGG + Exonic
954007204 3:47601325-47601347 TAGGAAAAGAAAGTGAATCTAGG + Intronic
957616867 3:82540815-82540837 TAGTCTAGGAAAATGATTCCTGG + Intergenic
958029776 3:88094433-88094455 TAGGGATGGAAAGTGATCAGGGG + Intronic
958792973 3:98673296-98673318 TGGAGAAAGAAAGTGAATCCTGG - Intergenic
959450530 3:106493676-106493698 TAGAATAGGAAAGTGATTACAGG + Intergenic
959455615 3:106557264-106557286 AAGTGAAGGTAAGTGATCCCTGG - Intergenic
959970062 3:112399655-112399677 CAGGCAAGGAAGGGGATTCCGGG + Intergenic
960737604 3:120797728-120797750 TAAAGAAGGAAAATGATTTCAGG + Intergenic
961313784 3:126020442-126020464 TAGAGAATGAAAGAGTTTCCAGG - Intronic
963294438 3:143530087-143530109 GAGGGAAGGGAAGGGATACCTGG + Intronic
963941217 3:151097984-151098006 TAGGGAAGAAGATTAATTCCAGG + Intronic
964667530 3:159190572-159190594 GATGAAAGGAAAGTCATTCCTGG + Intronic
965800039 3:172482896-172482918 AAGGGAAGGAATGTGAGTCTTGG - Intergenic
965809929 3:172580556-172580578 TAGGTCAGGAGAGAGATTCCTGG + Intergenic
967109474 3:186280987-186281009 AAGGGAAGGAAGGTGGGTCCAGG - Intronic
968053814 3:195675600-195675622 TAGGGAAGAAAAGGGATTGGTGG + Intergenic
968066046 3:195760347-195760369 CAGGGAAGGAAGGGTATTCCAGG + Intronic
968102077 3:195973554-195973576 TAGGGAAGAAAAGGGATTGGTGG - Intergenic
968545924 4:1198370-1198392 CATGGAAGGAAAGTCATCCCAGG + Intronic
969091672 4:4698629-4698651 TTGGGAGGGAACGTGATTCCAGG - Intergenic
970244411 4:14044432-14044454 GAGGGAAGGAAAGAGAATCTTGG - Intergenic
970537223 4:17041954-17041976 AAGGGAAGGATAGTGAGCCCTGG + Intergenic
971141665 4:23931281-23931303 TAGAGAAGGAATGTGACTCTTGG + Intergenic
971222080 4:24717539-24717561 CAGGGAAGGAGAGTGCTTTCTGG - Intergenic
972387606 4:38582896-38582918 TTTGGAGGAAAAGTGATTCCAGG - Intergenic
973061258 4:45728658-45728680 TAGGGAATGATAGTAATTCATGG - Intergenic
973170978 4:47143362-47143384 AAGGGAAGGAAAATAATACCGGG - Intronic
973734627 4:53858768-53858790 GAGAGAAGGAAAGTGATCCCAGG - Intronic
976922414 4:90456089-90456111 AAGGGAAAGAAAGGGAGTCCTGG + Intronic
976936812 4:90646279-90646301 TAGAGAATGAAAGTGATACCAGG + Intronic
979742255 4:124166604-124166626 GAGGGAAGGATAGAGATTCCTGG + Intergenic
982444607 4:155475389-155475411 TAAGGAAGGAAATTGAATTCAGG + Intergenic
982582474 4:157196218-157196240 TAGGGAAGGGGAGTGAGCCCAGG - Intergenic
985316599 4:188664548-188664570 TAGGGAAGGAGAGTTATTGATGG + Intergenic
985737276 5:1591504-1591526 TAGGGAAGAAAAGGGATTGCTGG - Intergenic
986187448 5:5458270-5458292 TAAAGAAAGAAACTGATTCCAGG - Intronic
986252321 5:6071883-6071905 GAGGAAAGGAAACTGATGCCAGG - Intergenic
986982287 5:13462506-13462528 AAAGGAAGGAAAGAGATTACCGG + Intergenic
987793424 5:22597488-22597510 TGGGGAAGGAAGATGAGTCCAGG - Intronic
988627283 5:32891084-32891106 TAGGGAAAAATAGTAATTCCCGG - Intergenic
988898369 5:35702724-35702746 TAGAGAAGGGATTTGATTCCAGG - Intronic
989140899 5:38200342-38200364 TAGGGAAGGAAAATCTTTCTGGG + Intergenic
991043275 5:62196923-62196945 TATGGAAGGAAAATAAATCCCGG - Intergenic
992161807 5:74011663-74011685 CAGGGAATGAAAGTTATTCAAGG + Intergenic
992796184 5:80256507-80256529 GAGGGAAGGAAAGGGATTTCAGG - Intergenic
993671969 5:90771774-90771796 TAAAGAAAGAAAGGGATTCCAGG + Intronic
993735793 5:91476081-91476103 CAGGTAGGCAAAGTGATTCCAGG - Intergenic
998817267 5:146027160-146027182 TAGGGAAGGAGTGTGACTCTTGG + Intronic
998876317 5:146603641-146603663 CAAGGAAGGAAAATAATTCCTGG - Intronic
999589554 5:153130208-153130230 TTAGGAAGGAAAATGATTTCAGG - Intergenic
1000684168 5:164226274-164226296 TAATGAATGAAAGTGTTTCCAGG + Intergenic
1001202643 5:169732248-169732270 AAGGGAAGAAAAGTGATTCCAGG - Intronic
1001410044 5:171505025-171505047 GAGAGAGGGAAAGTGATGCCTGG + Intergenic
1001931959 5:175679455-175679477 TAGGTAAGGAAAGACCTTCCAGG + Intronic
1002436759 5:179236237-179236259 GAGGGAGGGAAAGTGATTTCTGG - Intronic
1002607160 5:180390251-180390273 AAGATAAGGAAAGGGATTCCAGG + Intergenic
1003869777 6:10392366-10392388 GAGGAAAGAAAAGTGATTTCAGG - Intergenic
1004996819 6:21201322-21201344 TGTGGAAGCACAGTGATTCCAGG + Intronic
1005804638 6:29462677-29462699 TAGGGAAGGAAAGAGACTCCAGG + Exonic
1007299696 6:40857540-40857562 TGGGGAAGAAAAGTGGATCCAGG - Intergenic
1007842899 6:44731205-44731227 TAGGGAATCACAGTGTTTCCCGG + Intergenic
1008447029 6:51604634-51604656 TATGGAAGGAAAATAATACCGGG - Intergenic
1008802437 6:55386041-55386063 TAGGAAAGGAAAGTTATTGGTGG - Intronic
1011484639 6:87829255-87829277 TAGGCAGGGAAAGGGATTCTTGG - Intergenic
1011969891 6:93210052-93210074 TAGGGAAGGAAAGTGACAGGAGG + Intergenic
1013051197 6:106537100-106537122 CATGGAAGGAAAGTCATTCTGGG - Intronic
1014188753 6:118467091-118467113 GAGGGAAGGAAAGTGTGTTCTGG + Intronic
1014903461 6:126997791-126997813 AAGTGAAGGAAAGATATTCCAGG + Intergenic
1016799662 6:148156025-148156047 TAGGGGAGGAAAGAACTTCCTGG - Intergenic
1017497389 6:154994439-154994461 AAGGCGAGGAGAGTGATTCCAGG + Intronic
1018241893 6:161785066-161785088 TAGAGAAAGAAAGTGATTGGTGG + Intronic
1018572751 6:165227999-165228021 TAGGGAAGCAGCGTGTTTCCAGG - Intergenic
1019512440 7:1424437-1424459 TTGGGAAGGATAATGAATCCAGG - Intergenic
1022050309 7:26661971-26661993 CAGGGAAGGAAACTTATTCTAGG + Intergenic
1023932310 7:44713326-44713348 AAGGCAGGGAAAGGGATTCCAGG - Intergenic
1027947742 7:84770648-84770670 AAGGCAATGAAAGTGATTACAGG - Intergenic
1028413766 7:90558424-90558446 AAGGTCTGGAAAGTGATTCCTGG - Intronic
1028633890 7:92965850-92965872 TAAGGAGGGAAAGGCATTCCAGG + Intergenic
1029941703 7:104487620-104487642 GAGGAAAGAAAAATGATTCCTGG - Intronic
1030699265 7:112621087-112621109 AAAGGTAGGAAAGTGATTCTTGG + Intergenic
1031251869 7:119393457-119393479 TAGGAAATGAAAGTGATTATTGG + Intergenic
1031326559 7:120406719-120406741 CAGGGCAGGAAAGTCATTCTAGG + Intronic
1032273119 7:130429677-130429699 TAGTGAAGGAAAGGCATTCTAGG - Intronic
1032731315 7:134646194-134646216 TGGGGAAGAAAAGTGATTAATGG - Intergenic
1032842188 7:135723105-135723127 TGGGGAGGTAAAATGATTCCTGG + Intronic
1033311374 7:140264444-140264466 TAGGGAATGACAGTGATGCCAGG + Intergenic
1034700195 7:153088711-153088733 TGGCGCAGGTAAGTGATTCCAGG + Intergenic
1035850140 8:2910814-2910836 CAGGGAATGAAAATTATTCCTGG + Intergenic
1036175293 8:6531995-6532017 TAGAAATGGAAAATGATTCCCGG + Intronic
1039498687 8:38000273-38000295 AAGGGAAAGGAAGTGATTACTGG - Intergenic
1039940551 8:42086820-42086842 TGAGGAACGAAAGTGATTTCTGG - Intergenic
1040365777 8:46713449-46713471 TGGGGTAGAAAAGTGAGTCCCGG - Intergenic
1042046897 8:64663490-64663512 TGGAGAAGGAAAGTGAATCATGG - Intronic
1042847207 8:73180463-73180485 GAGAGAAAGAAAGTGATTGCTGG + Intergenic
1043638390 8:82415397-82415419 TAGGGAAAGAAAGAGATATCAGG + Intergenic
1043714148 8:83460476-83460498 TAGGAAAGGAAAATGATTTGGGG + Intergenic
1044509574 8:93058845-93058867 TACAGAAGGAAGGTGATTTCTGG - Intergenic
1046044612 8:108948810-108948832 AAGGCAAGGAAGGTCATTCCAGG - Intergenic
1047868386 8:129055055-129055077 TGGAGAAGCAAAGTCATTCCTGG + Intergenic
1048545984 8:135387577-135387599 GGGGGAAAGAAAGAGATTCCAGG + Intergenic
1048652081 8:136489314-136489336 AAGGGAAGGAAACTTTTTCCTGG - Intergenic
1048899351 8:139022698-139022720 TAGGAAAGGAGAGTGTTTCTTGG + Intergenic
1050335281 9:4584405-4584427 CAGGGAAGGTAACTGGTTCCAGG - Intronic
1051341020 9:16110678-16110700 TAGGGAAGAAAAGGGAGTCAGGG - Intergenic
1052566343 9:30157477-30157499 TAGAGAAGGTAACTGATTCAAGG - Intergenic
1053161614 9:35817417-35817439 TAGGGAAAGAAAGTGATGCCAGG - Exonic
1056041515 9:82672546-82672568 TTATGAAGGAAAGTGATCCCAGG + Intergenic
1056475943 9:86950953-86950975 TGGAGAAGGAAAGAGATGCCTGG + Intergenic
1059467625 9:114478891-114478913 TAGAGAAGGAAAGGGACTTCAGG - Intronic
1060041864 9:120307124-120307146 GAGGGAGGGAAAGGAATTCCAGG - Intergenic
1060187275 9:121571390-121571412 AAGGCAAGGAAAGGCATTCCAGG + Intronic
1061168569 9:128938887-128938909 CAAGGAAGGAAAGGGCTTCCTGG - Intronic
1062304269 9:135894177-135894199 TGGGGAAGGAGAGTGCTTCTGGG - Intronic
1185758836 X:2673836-2673858 GAGGGTATGAAAGAGATTCCTGG - Intergenic
1187030334 X:15480681-15480703 AAGAGAAGGAAAGATATTCCAGG + Intronic
1187224415 X:17361959-17361981 TCGGGAAGGAAAGTGAGAGCTGG - Intergenic
1187490169 X:19744046-19744068 TAGGGAAGGAAGTTGCTTTCAGG - Intronic
1188243487 X:27815235-27815257 AAAGGAAGGAAAGTTATTCTGGG - Intronic
1188245940 X:27835790-27835812 AAAGGAAGGAAAGTTATTCTGGG - Intergenic
1189297594 X:39929892-39929914 TGGGGAAGGCCAGAGATTCCTGG - Intergenic
1190738089 X:53268876-53268898 CAGGTAAGGAAAGTGTGTCCTGG - Intronic
1190931331 X:54951467-54951489 TTGGGAAGAAGAGTGATTCAAGG + Intronic
1191854138 X:65609160-65609182 TAGGGAAGGGAAGAGATTGTTGG + Intronic
1192034515 X:67547276-67547298 TAGGGAAAGAAAGTGGTCTCTGG + Intronic
1193468248 X:81872069-81872091 AAGGGAGGGAAAGGGAGTCCCGG + Intergenic
1195283771 X:103362563-103362585 TAGAAAAGGAAAGTGAGGCCTGG + Intergenic
1195320384 X:103717030-103717052 TAAGGAAACTAAGTGATTCCTGG + Intronic
1201850568 Y:18475257-18475279 TAGGGGAAGAAAGTGAGTTCTGG - Intergenic
1201882750 Y:18845120-18845142 TAGGGGAAGAAAGTGAGTTCTGG + Intergenic