ID: 1146495558

View in Genome Browser
Species Human (GRCh38)
Location 17:33318960-33318982
Sequence GTGGGAAGGACTAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146495551_1146495558 19 Left 1146495551 17:33318918-33318940 CCAGGAGCAAAACTGGGGCAGCC 0: 1
1: 0
2: 2
3: 19
4: 153
Right 1146495558 17:33318960-33318982 GTGGGAAGGACTAAAATGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 155
1146495553_1146495558 -2 Left 1146495553 17:33318939-33318961 CCAGAAAGATGGAGAAAGTCTGT 0: 1
1: 0
2: 4
3: 27
4: 279
Right 1146495558 17:33318960-33318982 GTGGGAAGGACTAAAATGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146495558 Original CRISPR GTGGGAAGGACTAAAATGGC AGG Intronic
904999571 1:34657757-34657779 GTGGGAAGGAGGAAAAAGCCAGG - Intergenic
907375915 1:54039830-54039852 GTGGGGAGGAGTAAAATGTGGGG + Intronic
908746055 1:67377692-67377714 CTGGGAAGGAAAAAAATGGGTGG - Intronic
911220406 1:95239808-95239830 TTGGTAAGGACTGACATGGCTGG + Intronic
911721163 1:101192644-101192666 GAGGGTGGGATTAAAATGGCAGG + Intergenic
913144745 1:115977575-115977597 GAAGGAAAGAGTAAAATGGCTGG - Intronic
913374753 1:118138655-118138677 ATGGAAAGGACCAAAATTGCTGG + Intronic
914422183 1:147539378-147539400 GTGAGAAGGCATAATATGGCGGG + Intergenic
914884335 1:151572967-151572989 CTGGGAAGCACTGAAATGGATGG + Intronic
916028400 1:160855379-160855401 GTGGGAAGGAGGAAGATGGTTGG + Intronic
918093304 1:181315571-181315593 GAAGGAAGAAATAAAATGGCAGG + Intergenic
919207506 1:194436862-194436884 GTGGGAAGGCCGAAAGTGGATGG + Intergenic
920289136 1:204904455-204904477 GTTGGAAGGATTAAAAGGGATGG + Intronic
923783745 1:237048467-237048489 TTCAGGAGGACTAAAATGGCAGG - Intronic
924447156 1:244144035-244144057 GTGGGAAGGAAAAGAAAGGCAGG + Intergenic
1064287191 10:14002146-14002168 CTGGGAAAGACTGAAATGGTGGG - Intronic
1065901991 10:30216364-30216386 GTGGGAAGGAGTAGGATGGGAGG + Intergenic
1067186025 10:44028969-44028991 GTGGGATGTCCTAAAATGCCAGG + Intergenic
1068791142 10:61032773-61032795 ATGGGAACTGCTAAAATGGCCGG + Intergenic
1068903877 10:62301085-62301107 GTGGAAAGGACTGAAATGAAGGG + Intergenic
1070156732 10:73839965-73839987 GAGGGAAGGACTAGAAGGGAGGG - Intronic
1071810577 10:89176700-89176722 GTGGGGTGGTCAAAAATGGCAGG - Intergenic
1072088834 10:92106983-92107005 TTGGGAAGGTCTTAAATAGCTGG + Intronic
1072243348 10:93518448-93518470 GTGGTAAAGACTAAGATGGCAGG - Intronic
1072475481 10:95756094-95756116 GTGGGAGGGGCTAAATTAGCCGG - Intronic
1075015713 10:118908784-118908806 CTGGACAGGACTCAAATGGCTGG - Intergenic
1076024970 10:127103807-127103829 GTGGCCAGGAGTACAATGGCTGG + Intronic
1077801207 11:5539532-5539554 GTGAGTAGGACTAAAATCCCAGG + Intronic
1078067703 11:8089173-8089195 GTGGGAAGGAAGGAAAAGGCTGG + Intronic
1080085733 11:28279602-28279624 TTAGGAAAGACTAACATGGCCGG + Intronic
1080875223 11:36268831-36268853 GTGGGAAGAACCCAAATGTCTGG + Intergenic
1083620475 11:64046983-64047005 CTGGGAAGGTCTGAAATGCCAGG - Intronic
1084400295 11:68939395-68939417 GGGTGAAGGACTGACATGGCGGG + Intronic
1088931278 11:114352897-114352919 CTGGGAAGGCCTGAGATGGCCGG - Intergenic
1089088455 11:115844831-115844853 GTTGGAAGGAGCAAAATGTCAGG - Intergenic
1092064655 12:5579810-5579832 GTGGAAAGAACTAATGTGGCAGG - Intronic
1094846276 12:34362780-34362802 GGGGGCCGGACTAAAGTGGCAGG - Intergenic
1096206358 12:49725486-49725508 GCTGGAAGGACTCAAATGACCGG + Intronic
1098812149 12:75108454-75108476 GTTGAAAGGAGAAAAATGGCAGG - Intronic
1100693003 12:97058787-97058809 GAGGGAAGAAATTAAATGGCTGG + Intergenic
1100903823 12:99274577-99274599 TGGGGAAAGACTAAAAAGGCAGG - Intronic
1102420182 12:112797263-112797285 GTGTGAATGACTAATAAGGCTGG - Intronic
1104413359 12:128577806-128577828 AAGGGCAGGACTAAAAGGGCAGG - Intronic
1108514021 13:51180529-51180551 GTGGGAAGGACTCAGATAGATGG - Intergenic
1108764281 13:53607552-53607574 GTGAGAAGGACTAACAGGGAGGG - Intergenic
1108803788 13:54130680-54130702 GTGGGGATGACTAAAAAGGAGGG + Intergenic
1109037125 13:57278643-57278665 GTAGGATGGACTAAAATGATAGG - Intergenic
1109059926 13:57602623-57602645 CTGGGAAGAACTAAATTGGTAGG - Intergenic
1109169551 13:59078310-59078332 TTGGGAAGTAAGAAAATGGCAGG - Intergenic
1111255465 13:85661908-85661930 GTTGGAAGGGCTAAGATGGTGGG - Intergenic
1111707218 13:91765188-91765210 GCTGGAAGGACTAAAAGGGCTGG - Intronic
1112007354 13:95265881-95265903 GGGGGAAAGACTAAAATGGGGGG + Intronic
1115906553 14:38208960-38208982 CTGGGAAGGAAAAAAATGGGGGG + Intronic
1117355564 14:54920635-54920657 GTGGGAAGAAAGAAAATGTCAGG - Intergenic
1117908899 14:60617611-60617633 CTGGGAAGGACTAAAATTACAGG + Intergenic
1122850465 14:104525605-104525627 GTGGGAAGGACTGAACAGGAAGG + Intronic
1124842689 15:33258251-33258273 GTGTGAAGGACTAGCATGGAGGG - Intergenic
1125345417 15:38714284-38714306 GTGGGCAGGGCCAAAATGGCTGG - Intergenic
1125768637 15:42150999-42151021 GTGGGAAGCACACAAATGCCTGG + Intronic
1126671979 15:51124700-51124722 GGGGTAAGGACTAAAGAGGCTGG - Intergenic
1126811869 15:52414649-52414671 ATGCTAGGGACTAAAATGGCTGG + Intronic
1135997271 16:27260052-27260074 GTTGGAAGGTCTAAAATGCAGGG + Intronic
1137435304 16:48449597-48449619 GTGGGAGGGGCTAAAAAGGTAGG - Intergenic
1139343450 16:66286958-66286980 GTGGGCAGGACTAGAGTGACTGG - Intergenic
1140856524 16:78982632-78982654 GAGGGAAGGACTAATATTTCTGG + Intronic
1141580667 16:84996406-84996428 GAGGGGTGGACTAGAATGGCAGG + Intronic
1141856357 16:86683731-86683753 CTGGGAAGACCCAAAATGGCCGG + Intergenic
1144338503 17:14293977-14293999 TTGGGAAGGACAAAAATCCCAGG - Intergenic
1146495558 17:33318960-33318982 GTGGGAAGGACTAAAATGGCAGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149231353 17:54537545-54537567 GAGGAAAGGACACAAATGGCTGG + Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151612288 17:75183911-75183933 GAGGAAAGGATTAAATTGGCTGG - Intergenic
1151617896 17:75226263-75226285 GTGAGATGGACTAAGATAGCAGG - Intronic
1203196536 17_KI270729v1_random:237319-237341 ATGGGAAGGAATAGAATGGATGG + Intergenic
1203206141 17_KI270730v1_random:38085-38107 ATGGGAAGGAATAGAATGGATGG + Intergenic
1158881083 18:61780324-61780346 TTGGGGAGGAATAAAAAGGCAGG - Intergenic
1159778217 18:72628521-72628543 GTGGGAAGGAGTATAAAGGCCGG - Intronic
1159950923 18:74482832-74482854 CTGGGAAGGTCTGAGATGGCCGG - Intergenic
1164508623 19:28879410-28879432 CTAGGAAGGACTGAAGTGGCTGG + Intergenic
1165789481 19:38483051-38483073 GTGGGCAGGACGAAGACGGCAGG - Exonic
1167779379 19:51588106-51588128 GTGGGAAGGCCTTCAACGGCAGG + Exonic
931710142 2:64982006-64982028 GTTGGAAGGACTTGATTGGCAGG + Intergenic
933387331 2:81628027-81628049 GTGGGAATGAATAAAATGTTTGG - Intergenic
935272159 2:101444068-101444090 GTGTGGAGCACTGAAATGGCAGG + Intronic
935324087 2:101920343-101920365 CTGGGAATCTCTAAAATGGCAGG + Intergenic
935788758 2:106571694-106571716 AGGGGAAGGATTAAAATGGTGGG + Intergenic
936684357 2:114810604-114810626 GTTGGAAGTACTAATATTGCTGG - Intronic
940062248 2:149585444-149585466 GTGGGATGCACAAAAATGTCTGG - Intronic
940285108 2:152026248-152026270 GAGGGAAGGAGGAAAATTGCTGG - Intronic
940445321 2:153770786-153770808 GAGGGAAGGACCAAGATGACTGG + Intergenic
943021700 2:182582164-182582186 GTGGCAAGGATCAAAATGTCTGG + Intergenic
944084122 2:195824625-195824647 GTGGGAAGGACTTAAGTGGTGGG + Intronic
948657174 2:239483640-239483662 GTGGGATGGACAAAAATGCCGGG + Intergenic
1174919992 20:54691592-54691614 GTGGGAAGGACTAACATGATGGG + Intergenic
950630006 3:14276016-14276038 GTGGGAAGGACTCAACTGTCTGG + Intergenic
952037081 3:29215663-29215685 GTGGCAAGGAGTAATATGTCTGG - Intergenic
952649576 3:35709149-35709171 GTGGCAGGGAATAAAAAGGCTGG + Intronic
955920053 3:63946199-63946221 GAGTGAAGGGCTGAAATGGCAGG + Intronic
960593591 3:119388610-119388632 GTGGGAAGGAGGAAAGTGGCTGG + Intronic
961667950 3:128505248-128505270 GTGGGGATGACTCAGATGGCTGG - Intergenic
963762482 3:149297714-149297736 CTGGGATGGAATAAAGTGGCAGG + Intergenic
964699811 3:159553715-159553737 GTGGGAAAGACCAAAGTGGGAGG - Intronic
969994893 4:11301966-11301988 TTGGGATGGAGTAAAATGGTGGG - Intergenic
975710068 4:77152635-77152657 CTGGGAGGGACTAAAGTGGCTGG + Intergenic
977171124 4:93763830-93763852 GTAGAAATGACTAAAAAGGCAGG + Intronic
980875775 4:138660499-138660521 GGTGGAAGGAATAAAATTGCTGG + Intergenic
981326551 4:143455097-143455119 ATGGGAAGGACTGAAACGGAAGG - Intronic
989004589 5:36796331-36796353 GCTGGAAGGACAAAAATAGCGGG + Intergenic
989582566 5:43046593-43046615 GTGAGAAGAACTAAAAGGGGAGG - Intergenic
990836456 5:60027048-60027070 GAGAGAAGGAAAAAAATGGCGGG - Intronic
991346334 5:65672667-65672689 ATGGGAAGGATTGAAATTGCTGG - Intronic
991549075 5:67816927-67816949 GTTGGAAGGATTAAATTAGCTGG - Intergenic
997410785 5:133689167-133689189 GTGGGAAGGAAGAAACTGGCTGG - Intergenic
998145078 5:139722996-139723018 GGAGTAAGGACTACAATGGCTGG + Intergenic
998394509 5:141809992-141810014 GTGGGAAGGGCTAGAGTGGAGGG + Intergenic
999000239 5:147912902-147912924 GTTGGAAGGAAAAAAATGGAGGG + Intergenic
999437472 5:151574290-151574312 GAGGGAAGGACTGTAATGGATGG + Intergenic
1001428223 5:171638875-171638897 GTTGGAAGGACTAAGAGGGAGGG + Intergenic
1002569372 5:180131337-180131359 GTGGGAAGGAGTCAAAGGGGCGG - Intronic
1006591789 6:35163339-35163361 GTGAGAAGGAAGAACATGGCTGG + Intergenic
1009874438 6:69487904-69487926 ATGGGAAGAACTAAAATTACAGG + Intergenic
1011002648 6:82608240-82608262 GAGGGAAGGAGAAAAATGGGAGG + Intergenic
1011311084 6:85980703-85980725 GTGGTGAGGACAAAAATGGGTGG + Intergenic
1011847732 6:91587431-91587453 CTGAGGAGGACTAGAATGGCTGG - Intergenic
1012188974 6:96257649-96257671 GTGGAAAGGGATAAAATTGCTGG + Intergenic
1013050529 6:106530025-106530047 CAGGAAAGGGCTAAAATGGCAGG + Intronic
1014803471 6:125803236-125803258 ATGGGAAGTAAGAAAATGGCTGG - Intronic
1015003121 6:128244657-128244679 ATGGGAAAGAATAAAATGGCTGG - Intronic
1015358940 6:132314067-132314089 GTGAGAAGAATTAGAATGGCTGG - Intronic
1015481195 6:133711812-133711834 ATGGGCAGGAATATAATGGCAGG - Intergenic
1015797855 6:137031114-137031136 GTGGGAAGCAGGCAAATGGCAGG + Intronic
1017382067 6:153842753-153842775 GTGGAAATGACTGAAATGGAAGG + Intergenic
1017764025 6:157592691-157592713 GGGGGAAGGAGGAAAAGGGCGGG + Intronic
1028893363 7:96013364-96013386 GTTGGAAGGACTAAAATCGAGGG - Intronic
1030393633 7:108958171-108958193 GTGAGAACCACTAAAATAGCTGG + Intergenic
1033319994 7:140330686-140330708 GAAGGAAGGACTAGCATGGCTGG + Intronic
1033444162 7:141405589-141405611 GTGGGGAGGACAAAAGTGGGAGG - Intronic
1034465780 7:151227660-151227682 GAGGGGAGGACTAAAATGAAGGG + Intergenic
1037265244 8:17051845-17051867 AAGGGAAGGAGAAAAATGGCAGG + Intronic
1037763914 8:21759960-21759982 GGTAGAATGACTAAAATGGCGGG + Intronic
1040950802 8:52937708-52937730 GTGGGAAGGAGTAAGATGGCTGG - Intergenic
1041291389 8:56311503-56311525 GTGGGGAGGCCTGAGATGGCTGG + Intronic
1044502803 8:92979105-92979127 TGGGGAATGACTCAAATGGCTGG + Intronic
1044814970 8:96102549-96102571 GAGGTCAGGACAAAAATGGCAGG + Intergenic
1045916853 8:107482049-107482071 TAGGGATGGACTAAGATGGCTGG + Intronic
1046809792 8:118520328-118520350 TTGGGAAGGTCTGAACTGGCAGG + Intronic
1047987222 8:130247652-130247674 GTGGGAAGGAGTCAACTTGCAGG + Intronic
1049939442 9:531140-531162 GTGAGAAGTACTTAATTGGCTGG + Intronic
1050265678 9:3887119-3887141 GTGGGAAGGAAAAAAAAGACAGG - Intronic
1050478616 9:6066744-6066766 GTGGGAAGCAATAAAATGGGAGG + Intergenic
1050926509 9:11269768-11269790 GTGGGAGGGACTAAAATGTTAGG + Intergenic
1052350651 9:27455374-27455396 GTGGGGAGGACCAGAATGACTGG - Exonic
1053159937 9:35806883-35806905 GTGGGAGGGAGGAAAGTGGCTGG - Intronic
1055567108 9:77580364-77580386 GTGGGAAGGACAGCAATGACAGG + Intronic
1056577066 9:87863551-87863573 GTGGGATGGAATGAAATGGAAGG + Intergenic
1059557973 9:115300502-115300524 TTGGGAAGGAAAAACATGGCAGG - Intronic
1059697925 9:116746380-116746402 GTGAAAAGGACTCAATTGGCCGG - Intronic
1060930751 9:127488032-127488054 ATTGGAAGGACTTAAGTGGCAGG + Intronic
1061755719 9:132811137-132811159 GTGGCAAAGATTCAAATGGCTGG + Intronic
1062312878 9:135948698-135948720 GTGGGAGGGGGCAAAATGGCAGG + Intronic
1203342447 Un_KI270442v1:2311-2333 ATGGAAAGGACTAAAATGGAAGG + Intergenic
1203350234 Un_KI270442v1:75572-75594 GTGGAACGGACTCAAATGGAAGG + Intergenic
1186138675 X:6547767-6547789 TAGGAATGGACTAAAATGGCTGG + Intergenic
1186628732 X:11324695-11324717 TAGAGATGGACTAAAATGGCGGG + Intronic
1187677097 X:21727148-21727170 GTGGGAAGGATTAAAGTGCTTGG - Intronic
1189880624 X:45487742-45487764 GTGAGAAGTACAAAAATTGCGGG + Intergenic
1194050880 X:89067015-89067037 GTTGGAATAGCTAAAATGGCAGG - Intergenic
1196121007 X:112050666-112050688 GTAGGAAAAACTAAACTGGCAGG - Intronic
1197696323 X:129554194-129554216 GTTGGAAGGAATAACATGTCAGG + Intronic
1198680591 X:139177817-139177839 GTTTGAAGCACAAAAATGGCTGG - Intronic
1200155257 X:153971685-153971707 GTGGGAAGGAGTCATAAGGCGGG - Exonic
1202073319 Y:21014958-21014980 GAGGGAAGGAAGAAAATGGAGGG + Intergenic
1202078019 Y:21056812-21056834 GAGGGAAGGAAGAAAATGGAGGG + Intergenic