ID: 1146496182

View in Genome Browser
Species Human (GRCh38)
Location 17:33324552-33324574
Sequence CTGTACACACAGATCTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146496182_1146496184 -3 Left 1146496182 17:33324552-33324574 CCTACCTAGATCTGTGTGTACAG 0: 1
1: 0
2: 0
3: 18
4: 95
Right 1146496184 17:33324572-33324594 CAGAATCAAGACACCAAGACTGG 0: 1
1: 0
2: 0
3: 20
4: 270
1146496182_1146496187 17 Left 1146496182 17:33324552-33324574 CCTACCTAGATCTGTGTGTACAG 0: 1
1: 0
2: 0
3: 18
4: 95
Right 1146496187 17:33324592-33324614 TGGGTGCCTGCTGCTTCCCGAGG 0: 1
1: 0
2: 1
3: 87
4: 454
1146496182_1146496185 -2 Left 1146496182 17:33324552-33324574 CCTACCTAGATCTGTGTGTACAG 0: 1
1: 0
2: 0
3: 18
4: 95
Right 1146496185 17:33324573-33324595 AGAATCAAGACACCAAGACTGGG 0: 1
1: 0
2: 2
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146496182 Original CRISPR CTGTACACACAGATCTAGGT AGG (reversed) Intronic
908054787 1:60273162-60273184 CTATTCACACAGATCTAGTTTGG + Intergenic
916228480 1:162514821-162514843 CTGTACTCACTGAAATAGGTTGG + Intronic
1067687734 10:48477496-48477518 CTGTACACACATTTCTATGTAGG + Intronic
1069228036 10:65968773-65968795 CTCTACACACAGATTTGGGGTGG - Intronic
1070063726 10:73012664-73012686 CTGAACAGACAGATTTTGGTAGG + Intronic
1070643156 10:78183275-78183297 CTCCACACACAGATCTGGGATGG + Intergenic
1075008268 10:118846047-118846069 CTGTCCTCACAGATCTCAGTGGG - Intergenic
1086615577 11:88814480-88814502 CTGTACCCATAAATCTAAGTAGG + Intronic
1088164357 11:106914982-106915004 CTGTACATACAATTCTAGGTTGG - Intronic
1088875902 11:113936056-113936078 CTGTACACAGACATCTTTGTAGG - Intronic
1092130984 12:6113182-6113204 CTGTAAAAACTGTTCTAGGTGGG - Intronic
1093343544 12:18010452-18010474 CTGTATATAGAGTTCTAGGTTGG + Intergenic
1101907855 12:108841002-108841024 ATATAAACACAGATCTAGATTGG + Intronic
1103047013 12:117744518-117744540 CTATAAACAAAGTTCTAGGTTGG - Intronic
1106758625 13:32846568-32846590 CTGTAGACACACATCTGGGAGGG + Intergenic
1108743108 13:53359440-53359462 CTGCAGACACAGATGTACGTGGG + Intergenic
1109227793 13:59717494-59717516 CTGTACACACTGGCCTTGGTTGG - Intronic
1109278356 13:60326796-60326818 CTCAACACACAGATCTTTGTAGG - Intergenic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1125786771 15:42325625-42325647 CTATACATACAGAACTAAGTAGG - Intronic
1131486574 15:92825832-92825854 CTGAACAGACAGGTCTTGGTGGG - Intergenic
1131881126 15:96863285-96863307 TTGTATACACAGAACTATGTTGG - Intergenic
1136627001 16:31467387-31467409 CTGGACACACAGATCTTGCTTGG + Intergenic
1139966358 16:70747698-70747720 CTGTGCAGACAGACCTGGGTGGG - Intronic
1144696061 17:17304460-17304482 GTTTACACACAGATCTTGGTTGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146496182 17:33324552-33324574 CTGTACACACAGATCTAGGTAGG - Intronic
1148497674 17:48063186-48063208 CTGTACATACATTTCTAGGAAGG - Intergenic
1148887793 17:50786313-50786335 CAGTTCACACAGGTCTAGATGGG + Intergenic
1152939636 17:83161373-83161395 CTGGGCACACAGATCTCGGGGGG + Intergenic
1154114496 18:11599729-11599751 CTGGATACAGAGCTCTAGGTTGG - Intergenic
1157788193 18:50505805-50505827 CTGTACACTAATATTTAGGTTGG - Intergenic
1158244507 18:55416126-55416148 ATGTACACACACATATAGGTAGG + Intronic
1163689278 19:18730035-18730057 CTCCCCACACAGATCGAGGTGGG + Intronic
1165084977 19:33338547-33338569 CTGAACATAGAGTTCTAGGTTGG - Intergenic
1165883757 19:39062389-39062411 CTGTACACCCAGAGCTGGGCTGG - Intergenic
930885977 2:56327373-56327395 CAGTTCAAACAGCTCTAGGTTGG - Intronic
936760666 2:115777031-115777053 CTATAAACACAGATCAAGGCAGG - Intronic
944792251 2:203142992-203143014 CTGTACACACAGGTCTTTGCAGG - Intronic
946179004 2:217938792-217938814 CTGTAAACACAGATCTGCATGGG + Intronic
1173754999 20:45508219-45508241 CTGTGCACGCAGATCCTGGTTGG - Intergenic
1174309744 20:49642714-49642736 CTCTAAACAAAGATCTATGTTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG + Intergenic
1175661067 20:60812947-60812969 ATGTACACACAGCTCTATCTTGG - Intergenic
1179447608 21:41443948-41443970 CTGTACACACAGATCTTCTGAGG + Intronic
1180120158 21:45740662-45740684 GTGTACACACAGACCTGTGTGGG - Intronic
1180899793 22:19362026-19362048 CTGGACACAGAATTCTAGGTTGG - Intronic
952003389 3:28811155-28811177 CTGTGCCCACAGATCTAAGTGGG - Intergenic
954252218 3:49376811-49376833 CTTTACAAACAAATCTAGATTGG - Intronic
954276664 3:49546550-49546572 CTTTACAAACAAATCTAGATTGG + Intergenic
961842728 3:129730743-129730765 ATGTACACACAGTTCTTTGTAGG - Intronic
966720767 3:183060954-183060976 CTGTACACCCAGCACTAGTTGGG - Intronic
966772183 3:183514099-183514121 CTGTACACCCAGCACTAGTTGGG - Intronic
968793156 4:2683098-2683120 CTGGACACATAATTCTAGGTTGG + Intronic
974430361 4:61789295-61789317 GTGTACACACACATATATGTTGG + Intronic
974795981 4:66750409-66750431 CTGTCCACACTGATTTAGATGGG - Intergenic
975574685 4:75850935-75850957 CTCGACACACTGATGTAGGTAGG + Intergenic
977034631 4:91934289-91934311 CTGTATACAGAACTCTAGGTTGG + Intergenic
978054539 4:104247720-104247742 CTGTATATACAGTTCTTGGTTGG + Intergenic
979769196 4:124501632-124501654 CTGTGGCCACAGACCTAGGTAGG - Intergenic
981473087 4:145159212-145159234 CAATACACACACATATAGGTAGG + Intronic
983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG + Intergenic
984931016 4:184847089-184847111 CTGAACAGGCAGATCTGGGTGGG - Intergenic
988705957 5:33726133-33726155 CTGGACACCCAGATCTTTGTTGG - Intronic
989233261 5:39112790-39112812 TTGAACACACAGATATAGGAGGG - Intronic
990189620 5:53244406-53244428 CTCTACAAAAACATCTAGGTAGG + Intergenic
993050043 5:82915936-82915958 CTGTGCACAGAATTCTAGGTTGG + Intergenic
993556458 5:89345560-89345582 CTATACACAGAGAACTAGGGAGG + Intergenic
993799544 5:92315461-92315483 ATGTATACATAAATCTAGGTAGG - Intergenic
994381474 5:99076911-99076933 CAGGACACAGAGTTCTAGGTTGG + Intergenic
995821171 5:116234684-116234706 ATTTACACACAGATCGAGTTAGG + Intronic
999669574 5:153946846-153946868 TTGTACACATAGATCTGGGAAGG - Intergenic
999788800 5:154917972-154917994 CTGTACACACAGAGATAAGTTGG - Exonic
999902976 5:156106765-156106787 CTGTATACACAGATATTAGTGGG - Intronic
1000600039 5:163261814-163261836 CTGTACACACGGATGTTGGCTGG - Intergenic
1002317269 5:178351219-178351241 CTCTAGAGAAAGATCTAGGTGGG + Intronic
1004229591 6:13819357-13819379 CTGTACAAAGAGATATAGGTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1008042817 6:46819765-46819787 CTGTCCACACAGATTTGGCTTGG - Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1013066008 6:106685043-106685065 CTGTACAAACAAATCAAGGATGG + Intergenic
1014607934 6:123501011-123501033 CTCTACAAACAGATTTAGATGGG + Intronic
1015485757 6:133767890-133767912 CTGCACAGTCAGATCCAGGTCGG - Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020661378 7:10987853-10987875 CTGTTAAAACAGATCTAGCTGGG + Intronic
1022558239 7:31322480-31322502 CTGGTCACACAGACCTGGGTTGG + Intergenic
1023066716 7:36385470-36385492 ATGTACACATAGGTCTATGTCGG - Intronic
1025204697 7:56985473-56985495 CTGATCACACAGATCTGGGTGGG - Intergenic
1025224885 7:57149530-57149552 CTGTACCCACACATCCAGGGAGG + Intergenic
1025667240 7:63591462-63591484 CTGATCACGCAGATCTGGGTGGG + Intergenic
1026808846 7:73445199-73445221 CTGGACACAGAGGTCTAGGAAGG + Intronic
1030083315 7:105796412-105796434 CTGGACCCACAGATCTCGGTAGG + Intronic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1031479127 7:122257201-122257223 CTGTACAGACAGATCTTGCTGGG + Intergenic
1031743999 7:125470029-125470051 CTGGACACACAGTTCAAGGTTGG + Intergenic
1034894655 7:154868682-154868704 CTGGACTCACAGCTCTAGGAGGG + Intronic
1035616008 8:1002499-1002521 CTGTACACACAGCTCTGGGCTGG + Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1040705461 8:50121360-50121382 CAGTGCACATAGAACTAGGTAGG - Intronic
1041223666 8:55676508-55676530 ATGTACACACAGCACTGGGTGGG + Intergenic
1041935313 8:63326261-63326283 CTGTGCCCACATACCTAGGTGGG + Intergenic
1047082698 8:121481486-121481508 CTGTTCTCACAGTTCTAGGTGGG + Intergenic
1047476206 8:125233743-125233765 TTGTAATCACAGATCTAGGTTGG + Intronic
1050116282 9:2266797-2266819 GTATTCACACAAATCTAGGTAGG - Intergenic
1061286734 9:129627764-129627786 CTGTCCACAAAGATCCAGGGAGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189928875 X:45986652-45986674 CTGTACATATGGATCAAGGTGGG - Intergenic
1190388696 X:49910678-49910700 GTACACACACAGATTTAGGTAGG - Intergenic
1193084672 X:77438504-77438526 CTGTAGACAAAGGTCTAGGTAGG - Intergenic
1200118141 X:153778168-153778190 CTGTGCACAGAGCTCTGGGTGGG + Intronic
1202195047 Y:22291551-22291573 CTGTGCTCACTGAACTAGGTGGG - Intergenic