ID: 1146496809

View in Genome Browser
Species Human (GRCh38)
Location 17:33329913-33329935
Sequence ACTTGGGGCAAGAGGGGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146496797_1146496809 18 Left 1146496797 17:33329872-33329894 CCCAGGAGGAGAATGTCTTCAGC 0: 1
1: 0
2: 2
3: 28
4: 317
Right 1146496809 17:33329913-33329935 ACTTGGGGCAAGAGGGGAACGGG 0: 1
1: 0
2: 2
3: 27
4: 267
1146496798_1146496809 17 Left 1146496798 17:33329873-33329895 CCAGGAGGAGAATGTCTTCAGCA 0: 1
1: 0
2: 1
3: 25
4: 214
Right 1146496809 17:33329913-33329935 ACTTGGGGCAAGAGGGGAACGGG 0: 1
1: 0
2: 2
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146496809 Original CRISPR ACTTGGGGCAAGAGGGGAAC GGG Intronic
900670031 1:3846359-3846381 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900670373 1:3849637-3849659 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
901077427 1:6564057-6564079 AGTTGGGCCAAGGAGGGAACTGG + Intronic
901202208 1:7473220-7473242 GCCTGGGGCAGGAGTGGAACCGG - Intronic
901316807 1:8315197-8315219 ACTGGGGGCCAGAGTGGAAGGGG - Intergenic
901772228 1:11536302-11536324 CCTGGGGGCAAGAGGAGAGCTGG - Exonic
901869035 1:12126690-12126712 ACATGGGGCAAGAGGGACCCTGG + Intronic
903125152 1:21242687-21242709 ACTTGGAGCAAGTGGGGCACAGG - Intronic
903179555 1:21598339-21598361 CCTTGGGGTAGGAGGGGGACAGG - Intronic
905413972 1:37792401-37792423 TTTTGTGGCATGAGGGGAACTGG + Intergenic
905935493 1:41821014-41821036 TCTGAGGGCAAGAGGGGAAAGGG - Intronic
907094225 1:51761508-51761530 TCTTGGGGCTAAAGAGGAACAGG + Intronic
911073047 1:93847236-93847258 GCTTGGGGCAGGAAGGGAGCCGG + Intergenic
911743746 1:101416590-101416612 ACTTGGGGAAAGGGTGGTACGGG + Intergenic
913063716 1:115230847-115230869 ACTATGGGGAAGATGGGAACAGG - Intergenic
913671333 1:121098972-121098994 AGTTGGTGGAGGAGGGGAACGGG + Intergenic
914023102 1:143886392-143886414 AGTTGGTGGAGGAGGGGAACGGG + Intergenic
914257909 1:145975502-145975524 ACTGGGGGCCAGAGGGGCACAGG + Intronic
914431801 1:147625412-147625434 CTTTGGGGCAAGAGGAGAACAGG + Exonic
914661588 1:149794334-149794356 AGTTGGTGGAGGAGGGGAACGGG + Intronic
914762738 1:150612177-150612199 CCTTGGTGCAAGAGGGGGAAGGG + Intronic
915719906 1:157977304-157977326 ACTGGGGGCGGGAGGGGGACGGG + Intergenic
918142976 1:181733765-181733787 AGTTGGGGGTGGAGGGGAACAGG - Intronic
918471469 1:184880179-184880201 ATTTGGGGGAACAGAGGAACTGG - Intronic
919825878 1:201502788-201502810 ACTGGGGGCAAGTGGGGAAAGGG - Intronic
919855304 1:201702217-201702239 AGTTGGAGCAAGGGGAGAACAGG + Intronic
920271676 1:204769684-204769706 ACTTGGGGCAAGTTGGAAATAGG - Intergenic
924048983 1:240061283-240061305 ACCTGGGGCCAGAGGGGAACAGG + Intronic
924160517 1:241227106-241227128 ACTTATGTCAAGAGGGGAAAAGG + Intronic
1065138868 10:22701171-22701193 AGTTGTGGCAAGAGGGGCAGGGG + Intronic
1065814145 10:29469646-29469668 ACCTTGGGGAAGAGGGGAACCGG - Intronic
1065867783 10:29928641-29928663 ACTTGGGGAAAGAATGGAAGCGG - Intergenic
1067210583 10:44257680-44257702 ACTTAGAGCAAGAGAGGGACTGG + Intergenic
1067233649 10:44428511-44428533 ACTTTGGGGACTAGGGGAACGGG - Intergenic
1067376649 10:45733415-45733437 AAAAGGGGAAAGAGGGGAACTGG - Intronic
1067614240 10:47748027-47748049 ACTTGTGGGAAGTGGTGAACAGG + Intergenic
1067686142 10:48466877-48466899 ACGTGGGGCATTAGGGGAAAGGG - Intronic
1067884343 10:50074106-50074128 AAAAGGGGAAAGAGGGGAACTGG - Intronic
1069405708 10:68095750-68095772 AGTTGGGGGAAGAGGGGAATAGG + Intergenic
1071629647 10:87208003-87208025 ACTTGTGGGAAGTGGTGAACAGG + Intergenic
1073234268 10:102000399-102000421 CCTTGGGGCAAGAGGAGGATGGG + Intronic
1073824161 10:107301383-107301405 ATATGGGGCAAGAGAGGAAGAGG - Intergenic
1075429582 10:122369298-122369320 ATTTGGTGCAATGGGGGAACAGG - Intergenic
1075845828 10:125544487-125544509 CCATGGGGCAGGAGGGGCACAGG - Intergenic
1077701223 11:4444007-4444029 ACTTGGGGCAATGGTGGAAGGGG + Intergenic
1081400743 11:42639927-42639949 ATGTGGGACAGGAGGGGAACAGG - Intergenic
1083144800 11:60750170-60750192 TAATGGGGAAAGAGGGGAACGGG + Intergenic
1084068976 11:66721532-66721554 ACTTCGGGCCAGAGAGGGACGGG + Intronic
1085534032 11:77207485-77207507 ACTGGGGGAGAGAGGGGAAGAGG + Intronic
1085712779 11:78844951-78844973 ACTTGGGGCCAGAGCAGAAGTGG - Intronic
1088900410 11:114111897-114111919 ACTTGGGGTAAAAGGGGAAGAGG - Intronic
1089014127 11:115153136-115153158 CGTTGGGGGAAGAGGGTAACTGG - Intergenic
1090972046 11:131652585-131652607 ACTTGGGGCAAGACAGCAGCTGG + Intronic
1092227116 12:6754599-6754621 ATTTGGGGCAAGAGGATAAGGGG - Intronic
1092479669 12:8848699-8848721 ACCTGGGACAAGAGGGGGAGAGG - Exonic
1093121095 12:15272782-15272804 AGGTGGGACAAGAGGGGAATTGG - Intronic
1093218915 12:16395568-16395590 ACTTGGGGGAAGTGGGGGAGGGG - Intronic
1093233171 12:16574021-16574043 ACTTCGGGGAAGCGGGGAAGCGG - Intronic
1093751890 12:22808837-22808859 ACTTGGGACAGGAGGGGCAGTGG - Intergenic
1096488682 12:52001560-52001582 ACATGGTGCAAGGGGGAAACAGG + Intergenic
1096788632 12:54031784-54031806 ACTTGGGGCTACGGGGGAAGAGG + Intronic
1096992918 12:55819446-55819468 ACTTGCGGGAAGAGGTAAACTGG - Exonic
1097179392 12:57162686-57162708 ACATGGGGCAGGAAGGGAAATGG - Intronic
1097639235 12:62159701-62159723 ACTTGGGGGAAGAGTGGGAGGGG + Intronic
1099630999 12:85145605-85145627 ACTTGGGGGAAAAGGAGAATTGG - Intronic
1102043721 12:109816911-109816933 ACCAGGGCCAAGAGAGGAACTGG - Intronic
1102574863 12:113849933-113849955 ACTGGAGGAAAGAGGGGAAGAGG + Intronic
1104371750 12:128229546-128229568 AGTTGGGGAAACAGGGGCACAGG + Intergenic
1104980010 12:132569540-132569562 ACTTGGCCCAAGAGGGGAGCTGG - Intronic
1107277363 13:38691495-38691517 ATTTGGGGCAAGAGGGCATTCGG + Exonic
1107998545 13:45885832-45885854 CCTTGGGGCTAGAGGAGAAGAGG + Intergenic
1109446699 13:62448534-62448556 AATTGTGGCAGAAGGGGAACGGG - Intergenic
1111311678 13:86495787-86495809 ACTTGGGAGAACAGGGGAATTGG + Intergenic
1111985937 13:95067055-95067077 ACATGGGGCAACTGGGAAACAGG + Intronic
1112879136 13:104084669-104084691 ACTTGGGGGAAGGGTGGAAAGGG - Intergenic
1113330609 13:109323341-109323363 ACTTGGGGGAAGAAGGGGAGGGG + Intergenic
1113950811 13:114069972-114069994 ACTTGGGGGAACCGGGAAACTGG + Intronic
1118171634 14:63395036-63395058 ACTTGTGGAACAAGGGGAACAGG + Intronic
1119640424 14:76310455-76310477 ACTTGGGGTCACAGGGGAGCTGG - Intergenic
1120002308 14:79316491-79316513 AATTGTGGAAAGAGGGGAAAGGG + Intronic
1120159676 14:81131787-81131809 ACTATGGGGAAAAGGGGAACAGG - Intronic
1120389770 14:83890763-83890785 AGTTGGGGGAAGAAGAGAACCGG + Intergenic
1120939273 14:89931272-89931294 AGTAGGGGCAGGAGAGGAACAGG - Intronic
1121442823 14:93959494-93959516 GCTTGGGGCCCGAGGGGAAATGG - Intronic
1121714612 14:96064667-96064689 ACTTGGGGGAAGAGTGGAAGAGG + Intronic
1122775710 14:104116261-104116283 ACTTGGGGCAAGTGCTGAAGGGG + Intergenic
1122959144 14:105086736-105086758 GACTGTGGCAAGAGGGGAACAGG - Intergenic
1123587518 15:21772863-21772885 TGTTGGGGAAAGAGGGGAAAGGG + Intergenic
1123624156 15:22215428-22215450 TGTTGGGGAAAGAGGGGAAAGGG + Intergenic
1124177379 15:27439028-27439050 ACCTGGGGAAAGAGGCCAACAGG + Intronic
1124683032 15:31753449-31753471 ACTTGGGGAAAGAGTGGGAAGGG - Intronic
1125757321 15:42072391-42072413 ACCTGGGGCCAGAGGGCATCAGG + Exonic
1126193248 15:45901229-45901251 AGCTGGGGTAAGAGGGAAACTGG - Intergenic
1127492046 15:59474063-59474085 ACTGGGGGCATGAGAGGAACTGG - Intronic
1128106559 15:65049808-65049830 ACTTTGGGCCAGAGGAGATCTGG + Intronic
1129155235 15:73713565-73713587 ACTTGGGGCAGGGAGGGAAAAGG - Exonic
1129177101 15:73848016-73848038 CCTGGGGGAAAGAGGGGAAAGGG + Intergenic
1130919590 15:88333065-88333087 AATTGGGGCATGTGGGGATCTGG - Intergenic
1131075445 15:89492464-89492486 TCTTGGGGGAATTGGGGAACTGG - Intronic
1132090835 15:98946831-98946853 ACGTGGGGCAAGAGGAGAAGTGG + Intronic
1132155370 15:99492240-99492262 GGTTGGGGCAGGAGGGGAGCTGG + Intergenic
1133270335 16:4608259-4608281 ACTTGGGGCAGAAGGGAGACTGG - Intergenic
1134741483 16:16550992-16551014 ACTTAGGGCAGAAGGGGAAGTGG + Intergenic
1134926075 16:18161440-18161462 ACTTAGGGCAGAAGGGGAAGTGG - Intergenic
1135325967 16:21526108-21526130 ATTTGAGGGAAGAGGGGAAGAGG + Intergenic
1135768072 16:25195118-25195140 GCTTGGGGGAAAAGGGGATCTGG + Intergenic
1138583918 16:57958409-57958431 ACATGGGAAAATAGGGGAACAGG - Exonic
1139084616 16:63569579-63569601 ACTATGGGCAAGTGGGAAACAGG + Intergenic
1140472213 16:75222319-75222341 ACTGGTGGCGAGAGGGGAAGTGG - Intronic
1141538669 16:84700564-84700586 TCTTGGGGCAAAGGGGCAACAGG - Intronic
1142039003 16:87880799-87880821 ATTTGGGGGAAGAGGGGAAGAGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1145107211 17:20128504-20128526 GCTTGGGGCAAGAGTGCAGCGGG + Intronic
1146496809 17:33329913-33329935 ACTTGGGGCAAGAGGGGAACGGG + Intronic
1147296643 17:39488875-39488897 ACTTGGGGGCAGATGGCAACCGG - Intronic
1148205828 17:45779204-45779226 AGTTGGGGAAAGAGGTGATCTGG - Intergenic
1150428327 17:65094957-65094979 AATAGAGGCAAGAGGGCAACGGG - Intergenic
1150791688 17:68205013-68205035 ACTTGGGGCGGGGGGGGGACAGG - Intergenic
1152151664 17:78604972-78604994 ACTGGGAGGAAGAGGAGAACTGG - Intergenic
1152680309 17:81664456-81664478 ACTTGGGGGAAGGTGGGACCTGG + Intergenic
1153919202 18:9773173-9773195 ACCTGGGGCAACAGGGGACTTGG - Intronic
1154335599 18:13462362-13462384 ACTGGGGGCCACAGGGGGACGGG + Intronic
1160373872 18:78396286-78396308 ACCTGGGGCAAGGGGGGAGAGGG + Intergenic
1161881942 19:6961109-6961131 TCCTGGGGCAAGATGTGAACAGG + Intergenic
1162005827 19:7778284-7778306 ACTAGGAGCAGGTGGGGAACTGG + Intergenic
1166529808 19:43535390-43535412 ACTTGGGGCAGTCGGGGCACGGG - Exonic
1167037022 19:47000698-47000720 ACCTGGGGCGACAGGAGAACCGG + Exonic
1167250353 19:48395830-48395852 CCTTGGGGGAAGAGGGGAGCTGG + Intronic
1167449826 19:49560549-49560571 ACCTGGGGCACGAGGGGAGAGGG + Intronic
1168278429 19:55289883-55289905 GCTGGGGGCAGGAGGGGAATGGG - Intronic
927199964 2:20571963-20571985 AGATGAGGCAAGAGGGGAGCAGG - Intronic
927704686 2:25289844-25289866 ACTTTGGGCAAAGGGGGAAGAGG - Intronic
927706401 2:25299078-25299100 ACTTGGAGCAAGAAGGTAAGGGG - Intronic
928952154 2:36822821-36822843 AGCTGGGGGAAGAGGGAAACAGG - Intergenic
929096456 2:38267322-38267344 TCTTGGGGCAGGATGGGAAAGGG - Intergenic
929579345 2:43071788-43071810 AAGTGGGGAAAGAGGGGAAGAGG - Intergenic
930485990 2:52011991-52012013 ACTTGGGGAAAGAGTGGGAGAGG - Intergenic
931229844 2:60364959-60364981 ACCTGGGGCAAGAAGGGAGGGGG + Intergenic
931234991 2:60405753-60405775 ACTTGGGGCAGGAGGAGCAGGGG + Intergenic
935761020 2:106320818-106320840 TCTTGGGTCAAGTGGGGACCTGG - Intergenic
936384089 2:112013113-112013135 GCATGGGGCCAGGGGGGAACTGG - Intronic
937361834 2:121235055-121235077 AAATGTGGCAAGAGGGGCACGGG - Intronic
937700137 2:124854863-124854885 CTTTGGGGCAAGTGGGGACCTGG + Intronic
938911528 2:135889752-135889774 AGTTGGAGGAAGAGGGGAAAAGG - Intergenic
939631362 2:144529869-144529891 ACTGGGGGCAAGAGGGGTTGGGG - Intergenic
939813537 2:146865861-146865883 ACTTGGGGGAAGAGTGGGAGGGG + Intergenic
939902088 2:147862838-147862860 ACTTGGGTCAAAATTGGAACTGG + Intronic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940123703 2:150298068-150298090 TCTTGGGGCAAAAGGGAAAAGGG + Intergenic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
942112213 2:172693730-172693752 ATGTGGAGCAAGAGGGGAAGAGG - Intergenic
943879678 2:193125382-193125404 ATGTGGGGCAAGAGTGGAAGAGG + Intergenic
945313735 2:208347093-208347115 ACTTAGGGGAAGAGGGGAGCGGG - Intronic
947437864 2:230088488-230088510 TCTTGGGGCAGGTGGGGAATGGG - Intergenic
947595788 2:231410785-231410807 CCCTGGGGGAAGAGTGGAACTGG - Intergenic
947712236 2:232322911-232322933 ACTTGGAGCAAGAACAGAACTGG - Intronic
1168821684 20:777689-777711 GCTTGGGGCGAGAGGTGAGCAGG + Intergenic
1168871204 20:1130158-1130180 TACTGGGGCAAGAGGGGAATAGG + Intronic
1172274782 20:33673661-33673683 AGTTGGGGCATGAGGGGGCCAGG + Intronic
1172512073 20:35507812-35507834 ACTGGGGTCCAGAGGGGAGCAGG + Exonic
1172696163 20:36824488-36824510 GCTGGGGGCAAGAGGGAAAGGGG + Intronic
1173078446 20:39843459-39843481 GATTGGAACAAGAGGGGAACAGG - Intergenic
1175420108 20:58826472-58826494 GTTTGGGGCCAAAGGGGAACAGG + Intergenic
1176094875 20:63336050-63336072 TCCTGAGGCAAGAGGGGAAAGGG + Intergenic
1176301635 21:5101562-5101584 ACATGGGGCAAGACAGGGACGGG + Intergenic
1178360161 21:31942587-31942609 ACATGCAGCAAGAGGGGAAGGGG - Intronic
1178879721 21:36439680-36439702 ACTTGGGCTAAGAGGGAAAATGG + Intergenic
1178880005 21:36441930-36441952 ACTTGGGCTGAGAGGGAAACAGG - Intergenic
1179547460 21:42122314-42122336 TCTGGGGGCAAGAAGGGAGCTGG + Intronic
1179714135 21:43279120-43279142 ACACGGGGAGAGAGGGGAACTGG + Intergenic
1179855396 21:44160337-44160359 ACATGGGGCAAGACAGGGACGGG - Intergenic
1180740279 22:18048777-18048799 ACTTGGAATAGGAGGGGAACAGG - Intergenic
1180909375 22:19438166-19438188 GCTTGGGGGAAGAGGGGAACAGG - Intronic
1183675506 22:39296987-39297009 CCTTGGGGCTGGTGGGGAACAGG + Intergenic
1183869970 22:40733943-40733965 AGTTGGGGCAGTAGGGGAAGGGG + Intergenic
1184448805 22:44570743-44570765 ACTAGGAGCAGGAAGGGAACTGG - Intergenic
1185256845 22:49838737-49838759 AGTGGGGGGAAGAGGGGAACCGG + Intergenic
1185343590 22:50302031-50302053 ACTTGGGCTAAGAGGGGCAGTGG + Intronic
950008410 3:9705443-9705465 ACCTGGGAAAAGAGTGGAACCGG - Exonic
950624672 3:14236151-14236173 ACATGGGACAAGCGGGGAATGGG - Intergenic
953399261 3:42598727-42598749 ACTTGGGAAAAGAGGGAAATGGG + Intronic
953571689 3:44076443-44076465 ACTCCTGGCAAGAGGGGAGCGGG - Intergenic
954880103 3:53829635-53829657 GTGTGGGGCAAGAGGGGAAGAGG - Intronic
955621335 3:60867562-60867584 GCTTGGGGCTAAAGGAGAACTGG - Intronic
956177717 3:66489047-66489069 TCTTTGGGCCAGAGGGGAAAAGG + Intronic
959201438 3:103252693-103252715 ACTTGAGGCAGAAGGAGAACAGG + Intergenic
961318717 3:126057734-126057756 ATTGGGGGCACGAGGGGAACAGG - Intronic
964472457 3:157069739-157069761 ACTTGGGGGTAGAGGGATACAGG + Intergenic
964621465 3:158723724-158723746 ACCTGAGGCCAGAGGGGACCTGG - Intronic
965052260 3:163665884-163665906 ACTTGGGGGAAGAGTGGAAGGGG - Intergenic
965202753 3:165680997-165681019 ATGTGGGGCAAAAGGGGAACAGG - Intergenic
966340665 3:178922328-178922350 GCTTGGAGCAAGAGGAGAAGTGG + Intergenic
967953935 3:194862727-194862749 AGTTGGGGGCAGAGGGGAAAGGG + Intergenic
967996761 3:195172816-195172838 ATTTGGGGAAAGAGGGCAAAGGG + Intronic
970666675 4:18344370-18344392 ACTTGGGTTAATAGGGGAAGAGG - Intergenic
972672362 4:41225945-41225967 GCTTGGGGGAAGGGGGGAATAGG + Intergenic
972930388 4:44064640-44064662 ACTCATGGCAAGAGGGGAAGTGG - Intergenic
975353757 4:73375281-73375303 ATTGGGGCCAAGAGGGGAAAAGG + Intergenic
976791827 4:88887138-88887160 ACTTGGGGAAAGAGTGGGAGGGG + Intronic
977724968 4:100285707-100285729 GCTTGGGGAGAGAGGAGAACGGG - Intergenic
979154670 4:117369305-117369327 AGGTGGGGCAGGAGGGGAAATGG - Intergenic
979677692 4:123427890-123427912 ACTTGAAGAAAGAGGGGTACTGG + Intergenic
979810440 4:125029752-125029774 ATATGGGGCAGGAGGGGAAGAGG - Intergenic
980080305 4:128337290-128337312 AAGTGGGGCATGAGGGGAAATGG + Intergenic
981689363 4:147489837-147489859 ACATGGGGGAAAAGGGGGACAGG - Intronic
982077561 4:151753030-151753052 GCTTGGGGGAGGAGGGGAAGAGG + Intronic
982465429 4:155724147-155724169 ACCAGGGGCAGGAGGGGAGCTGG - Intronic
984982339 4:185294502-185294524 ATTTGGGGCAAGAGGGGCATAGG + Intronic
985893955 5:2738494-2738516 ACTCGGCCCAAGCGGGGAACAGG - Intergenic
986994100 5:13586626-13586648 ATGTGGGGCAAGAGGGGAAGAGG - Intergenic
987204421 5:15610304-15610326 ACCAGGGGCAAGAGAGGCACAGG - Intronic
987259436 5:16188557-16188579 TCTTGGGTGAAGAGGGGAGCAGG + Intergenic
988450412 5:31336908-31336930 CCTTAGGGCAAGAAGGGAAGAGG + Intergenic
988640338 5:33034708-33034730 ACTTGGGGGAAGAGTGTACCAGG - Intergenic
989200711 5:38760095-38760117 ACTTGGGGGAAGAGGGGGAGGGG + Intergenic
991670027 5:69038194-69038216 ACTTTGTGCTAGAGGAGAACAGG + Intergenic
992536497 5:77709995-77710017 ACTGGGGACAACAGGGGAATTGG + Intronic
994805557 5:104443446-104443468 ATTTGGGGAAAGAGGAGGACAGG - Intergenic
994867611 5:105297000-105297022 GTATGGGGCAAGAGGGGAAGGGG + Intergenic
995738633 5:115330553-115330575 AGGTGGGGAAAGAGGGGAACAGG + Intergenic
996531522 5:124532537-124532559 ACTTAAGGCAAAAGGGGATCTGG + Intergenic
999037999 5:148375061-148375083 GATAGGGGGAAGAGGGGAACGGG + Intergenic
1000041255 5:157486704-157486726 ACTTGGGGTTACAGGAGAACAGG - Intronic
1000275296 5:159728954-159728976 AGCTGGGGCACGAGGGGAAATGG - Intergenic
1000951209 5:167485565-167485587 ATTTGGGGCAGGAGGGGGGCAGG + Intronic
1001123967 5:169002672-169002694 ATTTGGGACAAGAGGGGATGAGG + Intronic
1001527049 5:172436513-172436535 ACATGAGGCCAGAGGGGAAAGGG + Intronic
1001937331 5:175714724-175714746 TCCTGGGGCAAGAGGGGAAGGGG - Intergenic
1003415018 6:5899392-5899414 ACTTGTGGCCAGTGGGCAACAGG + Intergenic
1003746851 6:9011565-9011587 ACTTGGGGAAAGAGTGGGAGGGG + Intergenic
1004014325 6:11718503-11718525 ACTGGGGGCAAGAGGCAATCAGG - Intronic
1004149010 6:13097351-13097373 ACTAGGGGCAGGAGGTGAAGAGG - Intronic
1006697333 6:35942024-35942046 ACATGGGACTAGAAGGGAACTGG + Intergenic
1007096346 6:39215505-39215527 ACTGGGGGCATGAGAGGAGCAGG + Intronic
1007239975 6:40417797-40417819 ACTTGGGGCAGGAGGAGATTAGG - Intronic
1007435576 6:41808182-41808204 ACTTAGGACAAGAGGTGAAGTGG + Intronic
1008678793 6:53849648-53849670 ACTTGAGCCAAGAGGGAAAGAGG + Intronic
1011451917 6:87502113-87502135 AATTGGGGAAGGAGGGGACCTGG - Intronic
1013295172 6:108752376-108752398 TCTTGGGGAAAGAGATGAACAGG - Intergenic
1013851895 6:114526283-114526305 AGGTGGGGAATGAGGGGAACAGG - Intergenic
1014604384 6:123454122-123454144 ACTTGGGGGAAGAGTGGGAGGGG + Intronic
1014764530 6:125391410-125391432 ACTTGGGATAAAAGGAGAACAGG + Intergenic
1015850649 6:137568382-137568404 ATATGGGGCAAGAGGGGAAGGGG + Intergenic
1015891960 6:137978368-137978390 ACGTGGGGAAGGAGGGGACCTGG + Intergenic
1018309329 6:162492071-162492093 ACTTGGGGCATGAGGGCATGAGG - Intronic
1020013583 7:4818798-4818820 ACTGGTGGGAAGAGGGAAACGGG + Intronic
1020963122 7:14830801-14830823 ATTTGGGGCAAGAGGTCAAATGG - Intronic
1021889278 7:25171854-25171876 AACTGGGGCCACAGGGGAACTGG - Intronic
1023652706 7:42388406-42388428 ACTTTGTGCCAGAGGGGACCAGG - Intergenic
1026392563 7:69916686-69916708 AATGGGGGGAAGAGGGGAAGAGG - Intronic
1028904060 7:96133679-96133701 GCTTGGGGCAAAAAGGGAAAAGG - Intronic
1029426107 7:100494851-100494873 ACCAGGGGCAAGATGGGAAAAGG - Intergenic
1030016444 7:105227334-105227356 ACTTAGGGGAAGAGTGGAAAGGG - Intronic
1030345941 7:108433079-108433101 ACTTGGAGCAAGAGTGCAAATGG + Intronic
1030564791 7:111140154-111140176 AGTTGGGGCAAGAAGGAAAGAGG + Intronic
1032453660 7:132055908-132055930 CCTGGGGACAGGAGGGGAACAGG - Intergenic
1032493842 7:132345929-132345951 AGATGGGGAAAGAGGAGAACAGG - Intronic
1033636548 7:143217507-143217529 ACTTGGGGCAACAGGAAAAGTGG - Intergenic
1035287262 7:157814425-157814447 ACATGGGGCAGGACGGGAGCAGG + Intronic
1036442042 8:8789938-8789960 ACTGGGGGCAGGAGGGGAGAGGG - Intronic
1036615669 8:10385527-10385549 AATTGGGGCAGGAGGGGCAGAGG + Intronic
1037599793 8:20384380-20384402 CCTGGGGGCAAGATGGGAAATGG + Intergenic
1037667193 8:20980313-20980335 ACTTGTGGAAAGAGGCCAACAGG + Intergenic
1038588466 8:28812748-28812770 ACTTGGGGCAGGAGGATCACTGG + Intronic
1038693290 8:29782586-29782608 ATTTGGTGCAAGGGGGGAAGAGG - Intergenic
1039981943 8:42415484-42415506 TCTTGGGGTGAGAGGGAAACAGG - Intergenic
1040901045 8:52417384-52417406 AGTTGGGGAAAGAGGGAAAGGGG + Intronic
1041090480 8:54297012-54297034 ACTTGGGGCAATGGGGCAATGGG + Intergenic
1043753736 8:83974997-83975019 ACCTGGGGGAAGAAGGGAATGGG - Intergenic
1045308234 8:100977795-100977817 ATTTGGGGGAAGGAGGGAACTGG + Intergenic
1045308384 8:100979110-100979132 ATTTGGGGGAAGGAGGGAACTGG + Intergenic
1046175959 8:110575323-110575345 ACTTATGGCAAAAGGGGAAGGGG + Intergenic
1047188953 8:122660782-122660804 ACTTCGGGTAAGAGGGGTAATGG - Intergenic
1048610832 8:136021190-136021212 ACTTGGAATAAGATGGGAACAGG + Intergenic
1049310900 8:141933332-141933354 CCTCGGGGCAAGGCGGGAACAGG + Intergenic
1049654303 8:143791094-143791116 ACTTGGGGCAAGGGTGGTGCTGG + Exonic
1050706641 9:8407054-8407076 ACATGTGGCAAGAGTGGAAATGG - Intronic
1051376577 9:16408343-16408365 ACTGGGGGCCTGAGGGGTACAGG + Intergenic
1054908293 9:70429994-70430016 ACTTGGGGGAAGAGTGGAAACGG + Intergenic
1057473262 9:95376713-95376735 ACTTGGGGGTAGAGAGGCACAGG - Intergenic
1058682794 9:107454796-107454818 AATTGAGGTAAGAGGGGAGCTGG - Intergenic
1058972118 9:110093354-110093376 AGATGGGGCATGAGGAGAACTGG + Intronic
1059641384 9:116220038-116220060 ACTTGGGGGGCGAGGGCAACAGG - Exonic
1060940026 9:127537888-127537910 TCTTGGGCTAAGAAGGGAACCGG - Intronic
1061344716 9:130013857-130013879 ACTTAGGGCAAGAGAGCAAGAGG - Intronic
1061424070 9:130488426-130488448 TCCTGGGGCAAGAGGGGGCCTGG + Intronic
1061832891 9:133306951-133306973 AGTTGGGGGAAGAGGCGAACCGG - Intergenic
1187072666 X:15903586-15903608 GCTGGGGTCAAGAGGGGAAGAGG - Intergenic
1190427709 X:50348095-50348117 GCAAGAGGCAAGAGGGGAACAGG - Intronic
1192608384 X:72543466-72543488 AATTGGGCCAAGAGGGTAAGAGG + Intronic
1192902884 X:75519039-75519061 ACTTGGGGGAAGAGGGAACAGGG + Intronic
1194031196 X:88817753-88817775 ACTTGGGGGAAGAGTGGGAGTGG + Intergenic
1195302391 X:103543407-103543429 ACTTGGGGCTAGATGGCACCTGG + Intergenic
1196768603 X:119272008-119272030 ACATTGGGCAGGAGGGGGACAGG - Intergenic
1199077290 X:143537832-143537854 TCTTGGGGCAAAAGGGAAAAGGG - Intergenic
1200088979 X:153625633-153625655 GCCTGGGACAAGAGGAGAACGGG - Intergenic
1200247692 X:154534724-154534746 GCATGAGGCAGGAGGGGAACGGG - Intronic