ID: 1146497558

View in Genome Browser
Species Human (GRCh38)
Location 17:33336658-33336680
Sequence TGCTCAAGGCTGCCTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146497552_1146497558 24 Left 1146497552 17:33336611-33336633 CCCATTCCACAGGTGAAAATAGT 0: 1
1: 0
2: 2
3: 35
4: 369
Right 1146497558 17:33336658-33336680 TGCTCAAGGCTGCCTGTGTCTGG 0: 1
1: 0
2: 2
3: 21
4: 226
1146497554_1146497558 18 Left 1146497554 17:33336617-33336639 CCACAGGTGAAAATAGTGAAGTT 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1146497558 17:33336658-33336680 TGCTCAAGGCTGCCTGTGTCTGG 0: 1
1: 0
2: 2
3: 21
4: 226
1146497553_1146497558 23 Left 1146497553 17:33336612-33336634 CCATTCCACAGGTGAAAATAGTG 0: 1
1: 0
2: 4
3: 39
4: 339
Right 1146497558 17:33336658-33336680 TGCTCAAGGCTGCCTGTGTCTGG 0: 1
1: 0
2: 2
3: 21
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146497558 Original CRISPR TGCTCAAGGCTGCCTGTGTC TGG Intronic
900924947 1:5699155-5699177 TGCTCAAGGCTGTGGGTGCCAGG - Intergenic
901041665 1:6368014-6368036 TGCTCTAGTCTGGCTGAGTCCGG + Intronic
901454553 1:9355599-9355621 GGCTCCAGCCTGCCCGTGTCAGG + Intronic
901856384 1:12046873-12046895 TGCTCAAGGCTGTGTGTGTAAGG - Intergenic
901859981 1:12068196-12068218 GGCTGAAGGATGACTGTGTCTGG + Intronic
903063245 1:20684613-20684635 TGCTGGTGGCAGCCTGTGTCTGG + Intronic
903567925 1:24283105-24283127 TGCTGGAGTCTGCCTGTGCCTGG + Intergenic
904058353 1:27686873-27686895 TGCCCAAGGGTGCCTCTGCCGGG - Intergenic
904594089 1:31632223-31632245 TCCTTAAGGCTCCCTGTGGCTGG + Intronic
905275455 1:36814969-36814991 TGCACAACTCTGCCTGTGTGGGG - Intronic
906698237 1:47839248-47839270 TGCTCACGGGTGTGTGTGTCAGG - Intronic
906738918 1:48161710-48161732 TTCTCAAGTCTGTCTGTCTCAGG - Intergenic
912044501 1:105437370-105437392 TGCCCAAGTCTGGCTGAGTCTGG - Intergenic
913296047 1:117321354-117321376 TTCTGAAGGCTTCCTGTATCAGG + Intergenic
916730880 1:167565838-167565860 GGCTCTAGGCTGCCTGTTTCTGG - Intergenic
917332904 1:173900805-173900827 TGCTGAAGGCTTCCTGTTACTGG + Exonic
918121299 1:181543252-181543274 TGCTGATGGGTGCGTGTGTCGGG + Intronic
920090416 1:203448797-203448819 AGGTCAAGGGAGCCTGTGTCTGG + Intergenic
922325021 1:224520257-224520279 TGCTCAAGCCTTTCTGTGTAAGG - Intronic
922492874 1:226032531-226032553 TGCTCAAAGAAGCCTGGGTCTGG + Intergenic
922862878 1:228834364-228834386 TGCTGAAAGCTGCCAGTGTGTGG - Intergenic
922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG + Intergenic
1064262262 10:13795483-13795505 GGCTTAAGGATGCCTATGTCTGG + Intronic
1068157685 10:53222771-53222793 TGCTCAAGTCTGGCTGAGTCCGG + Intergenic
1070401366 10:76056226-76056248 TGCCCAAGTCTGGCTGAGTCTGG + Intronic
1071157335 10:82706207-82706229 TGCTAAATGCTGCCTGTGGGTGG + Intronic
1072790141 10:98311862-98311884 TGCTAAAGCCTCCTTGTGTCAGG - Intergenic
1072803527 10:98409616-98409638 TGGGCAAGGCTGCATGTGCCAGG + Intronic
1073921219 10:108462163-108462185 TGGGGGAGGCTGCCTGTGTCAGG - Intergenic
1073971771 10:109052023-109052045 TGCTCAAGGTTATTTGTGTCAGG + Intergenic
1074247929 10:111713641-111713663 TGCTCAAGTTTGTCTGAGTCTGG + Intergenic
1075811090 10:125225460-125225482 TGCTGAAGGCTGCCAATTTCAGG - Intergenic
1075838213 10:125474537-125474559 TGCTGGAGTCTGCCTTTGTCAGG + Intergenic
1077321723 11:1945903-1945925 AGCTCCAGGCTGCCAGTGGCAGG - Intergenic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1077636436 11:3844685-3844707 TGCTCAGGCCTGCCTCTGTCAGG - Intergenic
1077777740 11:5290199-5290221 TGCTCAGGGCTGTGTGTGTATGG + Intronic
1080851960 11:36078102-36078124 TCCTCAAGTCTGGCTGAGTCCGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082881338 11:58041199-58041221 CACACAAGGCTGCCTGGGTCAGG + Intronic
1084651825 11:70494056-70494078 TGGTCTGGGCTGCCTTTGTCAGG - Intronic
1084656675 11:70523673-70523695 TGTTCACCGCTTCCTGTGTCAGG + Intronic
1085270833 11:75268973-75268995 CGCTCAAGGCTCACTGGGTCTGG - Intronic
1085349360 11:75788673-75788695 TGCTGTAGGCTGCCTGGCTCTGG - Intronic
1085810072 11:79671972-79671994 TGCCCGAGGCTGCCACTGTCAGG + Intergenic
1088146245 11:106683518-106683540 TGCTCAGGCCTGACTGTGTGTGG + Intronic
1088327798 11:108618690-108618712 TTCTCATGGCTGCCTGAGGCTGG + Intergenic
1089729538 11:120511740-120511762 AGCTGAAGGCAGTCTGTGTCCGG - Exonic
1091225470 11:133954410-133954432 TTCAGAAGGCTGCCTGTGTCAGG - Intronic
1202804741 11_KI270721v1_random:1216-1238 AGCTCCAGGCTGCCAGTGGCAGG - Intergenic
1092027450 12:5254615-5254637 TGCTCAGCACTGCCTGTGTCTGG - Intergenic
1092962217 12:13607079-13607101 TGCACAGGGCTGCCAGTGTGGGG - Intronic
1093764953 12:22952481-22952503 TGCTCGAGGCTGGCTGAGTCTGG + Intergenic
1097175130 12:57138199-57138221 TCCTCTAGGCTGCCTGTTCCTGG - Intronic
1097178896 12:57159732-57159754 TGCTCAAAGGTACCTGAGTCCGG + Intronic
1097225522 12:57475064-57475086 TCCTCCTGGCTGCCTGTGCCAGG + Intronic
1099653683 12:85461734-85461756 TGCTCAATGTTCCCTGGGTCGGG + Intergenic
1100605804 12:96151015-96151037 TGCTAAAGCCTTTCTGTGTCTGG - Intergenic
1102614251 12:114139255-114139277 TTCTCAAAACTGCATGTGTCAGG - Intergenic
1102749904 12:115283424-115283446 TGCTAAAGCCTGCATCTGTCAGG + Intergenic
1104591253 12:130085948-130085970 AGCTCCAGGCTACCTGTGCCGGG + Intergenic
1104823853 12:131694540-131694562 TGCACACAGCTGCCTGTGCCTGG + Intergenic
1106979065 13:35256051-35256073 TGCTGAGGGCTGCATTTGTCAGG - Intronic
1109313059 13:60717922-60717944 TGCTCACAGCTCCCTGTGGCTGG - Intergenic
1109345898 13:61113982-61114004 TGTTCAAGCCTGGCTGGGTCTGG - Intergenic
1112709469 13:102110966-102110988 TCTTCAAGGCCGCCTCTGTCAGG - Intronic
1115754373 14:36518126-36518148 AGCGCTAGGCTGCCTGGGTCAGG - Intronic
1117555151 14:56876387-56876409 TACTCAAGGCTGGCTGGGTGTGG - Intergenic
1119257164 14:73208615-73208637 TGCCCAAGTCTGACTGAGTCTGG + Intronic
1119975073 14:79016145-79016167 TGCACAAAGCTGCTTATGTCAGG - Intronic
1120460477 14:84788433-84788455 AGCTTATGGTTGCCTGTGTCTGG + Intergenic
1121042404 14:90759852-90759874 TGCACAGGGGTGCCTGTGACGGG - Intronic
1121106521 14:91283463-91283485 CGGTCAAGGCTGCCTCTGTGTGG + Exonic
1121505334 14:94472871-94472893 TCCTCAAAGCTGCCTGGCTCTGG - Intronic
1122720582 14:103719794-103719816 TCCTCAAGGGTCCCTGTGGCTGG + Intronic
1122882004 14:104694382-104694404 TGCTCCAGGCAGCCAGTGCCAGG - Intronic
1127456695 15:59161637-59161659 TCCTCAAGCTGGCCTGTGTCTGG - Intronic
1127798159 15:62455679-62455701 TGCTCGGGGCTGCCTGTCACGGG + Intronic
1128600579 15:68992232-68992254 TTATCAAGACTGCCTGGGTCTGG + Intronic
1129303819 15:74643688-74643710 TACTGAAGGGTGTCTGTGTCAGG - Intronic
1130944043 15:88537574-88537596 TGCTCAACTCTGCCTATGTAGGG - Intronic
1131270170 15:90942433-90942455 TGCTCAGGGTTGCCACTGTCTGG - Exonic
1132339123 15:101066928-101066950 TGGCCATGGCTGCCTGTTTCTGG + Intronic
1132393800 15:101457741-101457763 TGGCCAGGGCTGCCTGTGTGTGG - Intronic
1132929080 16:2449477-2449499 TTCCCAGGGATGCCTGTGTCGGG + Intronic
1135629003 16:24021408-24021430 TCCTCTTAGCTGCCTGTGTCTGG + Intronic
1137023912 16:35454971-35454993 TCCTGAAGGCTGCCAGCGTCAGG + Intergenic
1137237710 16:46629075-46629097 TGGTGAAGGCTGCCTGTATTTGG + Intergenic
1137423206 16:48353840-48353862 AGTGCAAGGCTGCCTGTGTCAGG - Exonic
1137962629 16:52898226-52898248 TGCTCCAGAATCCCTGTGTCAGG + Intergenic
1140103521 16:71938654-71938676 TGCCCAAGTCTGGCTGAGTCTGG - Intronic
1140362101 16:74353147-74353169 TGCTCAAGACTGACTGTTCCAGG - Intergenic
1141252309 16:82369747-82369769 TTCGAAAGGCTGCCTGTGTTGGG + Intergenic
1141862265 16:86725909-86725931 TGCTCAAGGCTGTCTAAGGCTGG + Intergenic
1142211142 16:88809117-88809139 TTCTCCAGGCTGCCTGTGTCGGG - Exonic
1142309673 16:89305153-89305175 TGCTCCGGGCTGCCTGTGGAGGG + Intronic
1142697321 17:1640610-1640632 GACTCACAGCTGCCTGTGTCTGG + Exonic
1146497558 17:33336658-33336680 TGCTCAAGGCTGCCTGTGTCTGG + Intronic
1148771218 17:50068022-50068044 TGACTAAGGCTGCCTGTGTTTGG + Intronic
1150917443 17:69451183-69451205 TGCTCAAGCTGGCTTGTGTCTGG + Intronic
1152038423 17:77887810-77887832 TGCGCAAGGGTCCCTGTGTCCGG - Intergenic
1152662722 17:81550432-81550454 TGCTCTGCGCTGCCTGTGGCGGG - Exonic
1153428773 18:4992888-4992910 TGCCCAAGTCTGGCTGAGTCTGG + Intergenic
1153647127 18:7205291-7205313 TGCCCAAGGCTGTGTGTGTCTGG + Intergenic
1153738644 18:8099400-8099422 TACTCATGGAAGCCTGTGTCTGG - Intronic
1155352964 18:24924707-24924729 TGCTCTAAGCTGCCCGTGTTGGG - Intergenic
1156649470 18:39207745-39207767 TCCTTGAGGCTGTCTGTGTCCGG + Intergenic
1157410984 18:47463295-47463317 TGGTAAAGGCTGCCTGGGTGAGG - Intergenic
1157570459 18:48708928-48708950 TGCTCAGGGCTGAGTGTGCCAGG - Intronic
1157873447 18:51250818-51250840 TGCTCTAGGCTACGTGTGTCAGG + Intergenic
1159758324 18:72393330-72393352 TGATCAAGACTGCCTCTGGCAGG + Intergenic
1160533905 18:79581065-79581087 TCCTGAGGGCTGCCTGTGGCAGG - Intergenic
1161219034 19:3109524-3109546 TGCTCAGGGCCACCTGTGGCAGG + Intronic
1162779412 19:12998996-12999018 TGCTCAGGGCTCCATGAGTCTGG - Intronic
1163399207 19:17081900-17081922 TCCACAAGGCTGCGTGTGCCTGG + Intronic
1163550807 19:17965692-17965714 CTCTCAAAGCTGCTTGTGTCTGG + Intronic
1165304443 19:34995008-34995030 TGTTAGAGGCTGCCTGGGTCTGG - Intronic
1166044111 19:40219488-40219510 TGCTCAGGGCTGTCACTGTCTGG - Intergenic
1166932468 19:46309268-46309290 GGCTCCAGGCTGCCTGGGTGGGG - Exonic
1168703157 19:58453453-58453475 TGCTCTAGCCTGCTTGTGTAGGG + Intronic
925045695 2:771589-771611 TGCTCAGAGCAGCCTGTGTAGGG - Intergenic
925336461 2:3102342-3102364 TGCTCACAGCTGCCTTTTTCTGG + Intergenic
925358103 2:3256843-3256865 TGCCCAAGCCCGCCCGTGTCCGG - Intronic
928275688 2:29898162-29898184 AGCTCTAGGCTGCCTGGGGCTGG - Intronic
929927503 2:46227776-46227798 TGCTGAAGGCTTGCTGGGTCAGG - Intergenic
930448988 2:51510693-51510715 TGCCTAAGGCTGCCTGCTTCTGG - Intergenic
930564099 2:52997938-52997960 TGCTGAAGGATGGCTCTGTCAGG - Intergenic
931177720 2:59870526-59870548 TGTTCAAGGCTGGCTGAGCCTGG - Intergenic
931634977 2:64332793-64332815 TGCTCAAGGCAGTCAGTGCCTGG - Intergenic
933589709 2:84218684-84218706 GGCCCAAAGCTGGCTGTGTCTGG + Intergenic
936967968 2:118146009-118146031 TGCTCAATGCAGCCTCTGGCAGG + Intergenic
938744604 2:134265379-134265401 TGCTCAAGGATGTGTCTGTCAGG + Intronic
945770375 2:214035165-214035187 TCCTCAAGTCTGGCTGAGTCTGG + Intronic
947247643 2:228067504-228067526 TGCTGATGGCTGGCTGTTTCTGG - Intronic
948147588 2:235719680-235719702 TGCCCAAGGCTTCCTGGGTCAGG + Intronic
948793776 2:240391993-240392015 TGCTCATGGCTCCATGTGGCTGG - Intergenic
949055018 2:241922782-241922804 TGCTAATGGCAGCCTGTGACTGG + Intergenic
1169199917 20:3703903-3703925 CGCTCCAGGCTGCCTGGGGCAGG + Exonic
1169506187 20:6213604-6213626 TGCTCGCTGCTCCCTGTGTCTGG - Intergenic
1169880526 20:10341796-10341818 TACCCAAGTCTGGCTGTGTCTGG - Intergenic
1170159721 20:13298938-13298960 CGCTCACAGCTGTCTGTGTCTGG - Exonic
1170231770 20:14055648-14055670 TGCTCTTTGCTGTCTGTGTCAGG - Intronic
1170327875 20:15176471-15176493 TGTTCAAGTCTGGCTGAGTCTGG - Intronic
1170692001 20:18624635-18624657 GGCTCAAGGAAGCCTGTGTGGGG - Intronic
1171232501 20:23498868-23498890 GGCTCATGACTTCCTGTGTCTGG - Intergenic
1172843081 20:37913735-37913757 TGCGCCTGGCTGCCTGGGTCTGG + Intronic
1172856339 20:38006364-38006386 TGCCCAAGATTACCTGTGTCTGG + Exonic
1172914346 20:38432620-38432642 TGAGCAAGGCAGCCTGTGTGGGG - Intergenic
1173749925 20:45469121-45469143 TGATCAGGGCTGACTGTGCCAGG - Intergenic
1174810010 20:53637548-53637570 TACTCAACTCTGCCTTTGTCAGG - Intergenic
1174910818 20:54605648-54605670 TGCTCAAGGAAGCCTGGGTCAGG + Intronic
1175251873 20:57614861-57614883 GGCCCCCGGCTGCCTGTGTCTGG - Intronic
1175956484 20:62612314-62612336 TGCCCAAGGCCCCCTGTGCCTGG - Intergenic
1177110735 21:17024949-17024971 TTCTCATGGCTGCCTATCTCTGG + Intergenic
1177319172 21:19498113-19498135 TTCTTAAGGCTTCCAGTGTCAGG - Intergenic
1178435118 21:32551380-32551402 TTTTCAAGGCTGCTTGTATCTGG - Intergenic
1180025896 21:45161850-45161872 TGCCCAAGTCTGGCTGAGTCCGG - Intronic
1180041512 21:45282718-45282740 TGCACAGGGCTGCCTCTGTCCGG - Intronic
1181753492 22:25006536-25006558 AGCTCAATGCTGCCTCTTTCAGG + Intronic
1182276528 22:29192720-29192742 TGCAGAAGGCAGCCTGTGTCAGG + Intergenic
1183332847 22:37230517-37230539 GGCTCAGGGCTGCCTGCATCAGG - Intronic
1184497138 22:44848581-44848603 AGCTCAGGCCTGCCTGTCTCAGG + Intronic
1185092963 22:48786234-48786256 TGCTGAGGGATCCCTGTGTCTGG + Intronic
1185418610 22:50722788-50722810 TGGTAAAGACAGCCTGTGTCGGG - Intergenic
952793356 3:37217724-37217746 TCCCCAAGTCTGCCTGAGTCTGG - Intergenic
954173072 3:48820978-48821000 TACTCCAGGCTCCCTATGTCAGG + Intronic
954375627 3:50192833-50192855 TAATAAAGGCTGCCTGTGCCGGG + Intronic
955754427 3:62213623-62213645 TACTCAGGTCTGCCTGAGTCTGG + Intronic
956137299 3:66111737-66111759 TACTTTAGGCTGCCTCTGTCTGG + Intergenic
960987958 3:123292659-123292681 TGAATAAGGCTACCTGTGTCTGG + Intronic
961644934 3:128387860-128387882 TGCTCCATGCTGCCTGGGGCAGG - Intronic
961871033 3:129988430-129988452 TTCTCAGCCCTGCCTGTGTCTGG + Intergenic
962953443 3:140242715-140242737 TTCCCCAGGATGCCTGTGTCTGG + Intronic
965367796 3:167820942-167820964 TGCTCAAGTCTGACTGAGTTTGG - Intronic
966815677 3:183887891-183887913 CCCTGAAGGCTGCCTGGGTCTGG - Intergenic
967283127 3:187841753-187841775 TGCTCAAGGATGCCAGTGAAGGG + Intergenic
968195526 3:196703352-196703374 TGATTATGGCTGCCTGGGTCTGG - Intronic
968838321 4:2981596-2981618 TGCCCAAGTCTGGCTGAGTCTGG + Intronic
969330369 4:6471098-6471120 TGCGCGTGGGTGCCTGTGTCAGG - Intronic
969432749 4:7165560-7165582 TGTTAAAGGCTGGCTGTTTCTGG - Intergenic
969443344 4:7230107-7230129 TGGTCAAGTCTTCCAGTGTCTGG + Intronic
969443362 4:7230314-7230336 TGGTCAAGTCTTCCAGTGTCTGG + Intronic
969443379 4:7230521-7230543 TGGTCAAGTCTTCCAGTGTCTGG + Intronic
969842247 4:9891158-9891180 TTTTCCAGTCTGCCTGTGTCTGG + Intronic
969869417 4:10095448-10095470 TCCTCAAAGCTGACTGTGGCTGG + Intronic
970644697 4:18106918-18106940 TGCTCAAGCCTGTCTGGGTTGGG + Intergenic
971666352 4:29491126-29491148 TGCTCAAGGATGCTTATTTCTGG - Intergenic
973341842 4:49013263-49013285 TGAGCAAGGCTCCCTGTGTGAGG + Intronic
974340089 4:60603759-60603781 GGCTGAAGACTGCCTGTGACAGG - Intergenic
975321346 4:73012232-73012254 TCCTCAAGCCTGGCTGAGTCTGG - Intergenic
976097800 4:81527942-81527964 TGCCCAAGTCTGGCTGAGTCTGG + Intronic
976301976 4:83523900-83523922 AGCTCAGGGTTGCCTGTGTTGGG + Intergenic
977430312 4:96924250-96924272 TCCTCAAGGCACCCTGTGTGGGG + Intergenic
980088668 4:128418287-128418309 TTCCCAAGCCTGCCTGTTTCAGG - Intergenic
987097206 5:14560599-14560621 TGCTCAGGAGTGCCCGTGTCGGG + Intergenic
987951933 5:24687257-24687279 TGCCCAAGTCTGGCTGAGTCTGG + Intergenic
989279163 5:39621776-39621798 TGCTCAAGGCTGGCTGAGTCCGG + Intergenic
989339188 5:40354785-40354807 TGCCCAAGTCTGCCTGAATCTGG - Intergenic
990962169 5:61405600-61405622 TGCTCAAGTTTTCCTGTATCTGG - Intronic
993703328 5:91143572-91143594 TGCTCAAGGCTGGCTGAATCTGG + Intronic
995456131 5:112353986-112354008 TTTTCAAAGTTGCCTGTGTCTGG - Intronic
995694682 5:114865958-114865980 TCCTCAAGGATGCCTGTGATGGG + Intergenic
999887149 5:155936538-155936560 TGCTCAAGTCTGGCTAGGTCTGG + Intronic
1001437286 5:171710008-171710030 TGCTCTAGGCTGGCTGATTCTGG - Intergenic
1001732381 5:173969873-173969895 TGCTCCAGGCTACCTTTATCAGG - Intergenic
1002541866 5:179911500-179911522 TGCCCAGGGGTGCCTATGTCAGG - Intergenic
1002620529 5:180484960-180484982 CCCTAAAGGCTGCCTGTATCTGG + Intergenic
1004340607 6:14804598-14804620 TGCTCGAGGCTGCCTGTGGTCGG - Intergenic
1007607755 6:43128902-43128924 TGCACAAGGTGGCCTGTGTTAGG + Intronic
1007991404 6:46260041-46260063 TGATCAATTCTGCCTGTGTAAGG - Intronic
1009771204 6:68144938-68144960 TGGTGAAGGCTGCCTGTCTTGGG + Intergenic
1010379353 6:75207491-75207513 TGCTGGAGGCAGCCTGTGTGTGG - Intergenic
1011277182 6:85642857-85642879 TGCTCGCTGCTCCCTGTGTCCGG + Exonic
1011916007 6:92508112-92508134 GGCTAAAGTCTGCCTGAGTCAGG + Intergenic
1012752796 6:103184382-103184404 TGCTCAAGTTTGGCTGAGTCTGG - Intergenic
1014418725 6:121215107-121215129 TGCCCAAGTCTGGCTGAGTCTGG + Intronic
1015135443 6:129863873-129863895 TGCACAAAGCAGCCTGTGTTGGG - Intergenic
1016841766 6:148532677-148532699 GGCTCAAGGCTTCCTTTCTCTGG + Intronic
1018842190 6:167525330-167525352 TGCTCCCTCCTGCCTGTGTCCGG + Intergenic
1018965498 6:168484783-168484805 TCCACATTGCTGCCTGTGTCAGG - Intronic
1019476888 7:1248636-1248658 TCCGCAAGGCTGCCTGCGTGAGG - Intergenic
1020676278 7:11188713-11188735 TGCTAAAGGCTGCCTGAGTGTGG + Intergenic
1020932615 7:14416853-14416875 TACTCAACGCTCCCTTTGTCTGG + Intronic
1022743504 7:33146312-33146334 TGATCAAGGCTGTTTGTGTCTGG + Exonic
1026392133 7:69912301-69912323 AGCTCAGGGATGCCTGGGTCTGG + Intronic
1026880702 7:73905063-73905085 TGTTCGAGGCTGGCTGTGCCCGG + Intergenic
1029424927 7:100489225-100489247 AGCTCAAGGCCCCCTGTGCCAGG + Exonic
1030673535 7:112362851-112362873 TGCTAATGGCAGCCTGCGTCTGG + Intergenic
1031878724 7:127171867-127171889 TGTCCAAGACTGCATGTGTCTGG - Intronic
1032591170 7:133193767-133193789 TGCCCAAGTCTGGCTGAGTCTGG + Intergenic
1032658310 7:133955452-133955474 TGCTTAAGTCTGGCTGAGTCTGG + Intronic
1033278599 7:139990468-139990490 TGCTCGAGGCTGGCTGGCTCTGG - Intronic
1039893804 8:41702001-41702023 TGCGCCAGGCTGAGTGTGTCTGG + Intronic
1040491744 8:47929582-47929604 TGCTCAAGGCTGCCGGTCCTGGG + Intronic
1041086961 8:54265553-54265575 TGCTCAACATTGCCTGTGTGAGG - Intergenic
1043195536 8:77287595-77287617 TACTCAAGTCTGGCTGAGTCTGG - Intergenic
1046195733 8:110860646-110860668 TGCCCAAGTCTGGCTGAGTCTGG - Intergenic
1049064451 8:140301874-140301896 TGCTCCAGGCCGCATCTGTCTGG - Intronic
1051147298 9:14041106-14041128 TGCACAAGGTTGCCTGTGCTGGG - Intergenic
1057516708 9:95728554-95728576 TGCTCAAGGTTTACAGTGTCAGG - Intergenic
1057706804 9:97400379-97400401 TGCTCAAGGGGCCCTGTGTCTGG + Intergenic
1061610819 9:131744491-131744513 TCCTGAGGGCTGCCTGTGGCTGG + Intergenic
1186434268 X:9529537-9529559 TGCTGAAGGCTGCTTGGGCCTGG - Intronic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic
1189674824 X:43451211-43451233 TGGTAGGGGCTGCCTGTGTCAGG - Intergenic
1189674975 X:43452376-43452398 TGGTAGGGGCTGCCTGTGTCAGG + Intergenic
1190297125 X:49034238-49034260 TGCCCCCAGCTGCCTGTGTCAGG - Exonic
1191924654 X:66296475-66296497 TGCACCAGGCTGCCACTGTCAGG + Intergenic
1195880268 X:109586204-109586226 TGTTCAAGTCTGGCTGAGTCTGG + Intergenic
1199704115 X:150409327-150409349 TGAATAAGGCTGCCTGTGGCAGG + Intronic