ID: 1146498910

View in Genome Browser
Species Human (GRCh38)
Location 17:33347665-33347687
Sequence CATCGAAGGAGGGTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146498901_1146498910 11 Left 1146498901 17:33347631-33347653 CCCGGATGAGGTCTCAGAATTGC 0: 1
1: 1
2: 0
3: 16
4: 254
Right 1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG 0: 1
1: 0
2: 2
3: 31
4: 320
1146498902_1146498910 10 Left 1146498902 17:33347632-33347654 CCGGATGAGGTCTCAGAATTGCT 0: 1
1: 0
2: 0
3: 23
4: 195
Right 1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG 0: 1
1: 0
2: 2
3: 31
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146498910 Original CRISPR CATCGAAGGAGGGTGGGGGC TGG Intronic
900306377 1:2010874-2010896 CAGCCAAGGAGGGTGGGGACAGG - Intergenic
900313876 1:2047749-2047771 CAGCGAGGGAAGGTGGGGGGCGG - Intergenic
900372304 1:2337401-2337423 CATCAGAGGCGGGTGTGGGCGGG + Intronic
900698452 1:4027653-4027675 CACCGTGGGAGGGTGGGGGCGGG + Intergenic
900708204 1:4093939-4093961 CAGAGAAGGAAGGTGGGTGCTGG - Intergenic
901193741 1:7428119-7428141 TCTGGAGGGAGGGTGGGGGCAGG + Intronic
901326008 1:8365640-8365662 CATAGACCGATGGTGGGGGCGGG - Intronic
902048235 1:13541963-13541985 CTTGGGAGGAGGGTGGGTGCTGG - Intergenic
902077676 1:13800783-13800805 CACTGAAGGAGGGTTGGGGGGGG + Intronic
902929843 1:19723350-19723372 CATCGAAGGAGAAAGGAGGCAGG - Intronic
902985498 1:20152040-20152062 CTTCTCGGGAGGGTGGGGGCGGG - Intergenic
904094904 1:27968981-27969003 CAGAGATGAAGGGTGGGGGCAGG + Intergenic
904293125 1:29500301-29500323 CCACGCAGGAGGGTGGGGCCTGG + Intergenic
904449619 1:30602398-30602420 CATGGAAGGAGAATGGGGGAGGG - Intergenic
904517139 1:31065400-31065422 TATCAAAGGAGGGAGGGGGTGGG - Intronic
904703275 1:32371747-32371769 CATAGAAGGAATGTGGGAGCGGG - Intronic
904813045 1:33176347-33176369 CACCCAAGGAGGGAGGGGGCTGG - Intronic
905037034 1:34925185-34925207 CATAGAGGGAAGGTGGGGGGGGG - Intronic
905271350 1:36789720-36789742 CATTGAAGGAGTGAGGGAGCTGG - Intergenic
912740638 1:112192035-112192057 AACCAAAGGAGGGTGGGGGTGGG + Intergenic
912770923 1:112463770-112463792 CATGGAAGCAGGATGGGAGCAGG - Intergenic
915455357 1:156036938-156036960 CATCGAGGGAGGGGAGAGGCAGG + Exonic
915963061 1:160283279-160283301 CATTGAAGGAGGGTATGGGATGG + Intronic
916585993 1:166150796-166150818 CATAGAAGCAGGCTGGGTGCAGG + Intronic
917149892 1:171932044-171932066 AATGGAGGGAGGGTGGGGGATGG - Intronic
917472348 1:175336640-175336662 CATGGGAGGAGGGTGGTGACAGG + Intronic
917963486 1:180164421-180164443 CCTCGAAGGAGGGAGGTGGGTGG - Intronic
918194640 1:182209885-182209907 CCTCGCAGGATGGTGGGGGGGGG + Intergenic
919518724 1:198560262-198560284 CATCGTAGGAGGGTGGTGTAAGG - Intergenic
919724154 1:200871345-200871367 CAGGGTAGGAAGGTGGGGGCAGG - Intergenic
920206536 1:204296425-204296447 CATTGGAGGAGGGTAGGGGAAGG - Intronic
920912553 1:210232562-210232584 CAGGGAAGGAGGCAGGGGGCGGG + Intergenic
921120077 1:212128491-212128513 CATCGGTGGAGAGTGGGGGGTGG - Intergenic
923449462 1:234103242-234103264 CATTGAGAGAGGGTGGGGGTGGG - Intronic
923749061 1:236729583-236729605 CATGGAGGCAGGCTGGGGGCAGG - Intronic
923789741 1:237101866-237101888 CATCTAAGCAAGGTGGGGGAGGG + Intronic
924091686 1:240507778-240507800 CAGAGAAGGAGGGTGGGGGTGGG + Intronic
924824566 1:247525754-247525776 CCTCCATGGAGGTTGGGGGCTGG + Intronic
1063341085 10:5263516-5263538 CCAAGAAGCAGGGTGGGGGCAGG - Intergenic
1064354460 10:14604495-14604517 CGTGGAAGGAAGGCGGGGGCGGG - Intronic
1065109559 10:22426319-22426341 CATCCAAGGCGGGGGGGGGGGGG + Intronic
1065123157 10:22547450-22547472 CATCAAACTAGGGTAGGGGCAGG + Intronic
1065214006 10:23432347-23432369 TATAGAAGGAGGGTGGGGTGTGG + Intergenic
1065916755 10:30359548-30359570 AAAGGAAGGATGGTGGGGGCTGG - Intronic
1066023030 10:31320475-31320497 GGTGGAAGGAGGGTGGGGGAGGG + Intronic
1066780843 10:38943074-38943096 AAAAGAAGGAGGGTGGTGGCGGG + Intergenic
1067659754 10:48225567-48225589 CATCCCAGGAGGCTGGGGGAAGG - Intronic
1068610643 10:59056571-59056593 CATGGACGGGGGGTGGGGGCGGG - Intergenic
1069640026 10:69948819-69948841 GACAGAGGGAGGGTGGGGGCTGG + Intronic
1070756062 10:78993993-78994015 AATCAAAGGGGGTTGGGGGCAGG - Intergenic
1072190738 10:93074521-93074543 CAGCGCAAGAAGGTGGGGGCAGG + Exonic
1072565384 10:96612709-96612731 CATCAAAGGCTGATGGGGGCTGG + Intronic
1073441779 10:103556495-103556517 GAAGGAAGGAGGGTGGTGGCAGG + Intronic
1074278285 10:112025499-112025521 CATGGAAGGAAGGTGAGGACTGG + Intergenic
1074681320 10:115910476-115910498 CATGTAAGGAGGGTGGGGGGTGG - Intronic
1075462511 10:122626959-122626981 CTTTGAAGGAGGGTGGGGTGCGG + Intronic
1075908280 10:126101986-126102008 CACCCAAAGATGGTGGGGGCAGG - Intronic
1076097568 10:127744506-127744528 CATCATAGGAGTCTGGGGGCTGG - Intergenic
1076102927 10:127797488-127797510 GATGAATGGAGGGTGGGGGCTGG - Intergenic
1076103011 10:127797776-127797798 GATGGAGGGAGGGTGGGGGATGG - Intergenic
1077228859 11:1449848-1449870 CATCCGAGCTGGGTGGGGGCGGG - Intronic
1077366479 11:2163341-2163363 CAGCGAGGCAGGATGGGGGCTGG - Intergenic
1078136858 11:8658789-8658811 CACTGAAGGAGGGTGTGGGGGGG + Intronic
1078840566 11:15073111-15073133 CAGGGAAGGAGGGGGGGGGAGGG - Intronic
1079931462 11:26568008-26568030 CATGGAAGGAGGTTGTGTGCTGG + Intronic
1080829639 11:35879614-35879636 CATCCAAGGAGGACGGGGGATGG - Intergenic
1081683583 11:45025949-45025971 CATGGCAGGAGGCGGGGGGCAGG + Intergenic
1081870922 11:46382146-46382168 GATCGAAGGAGGGCTGGGGACGG + Intronic
1083292031 11:61695815-61695837 CCTGGAAGGAGGGCAGGGGCAGG + Intronic
1083292954 11:61699912-61699934 CCTGGAAGGAGGGTGGGGCTGGG + Intronic
1083696979 11:64449594-64449616 CAGCGAAGGAGGCAGGGAGCCGG - Exonic
1083746806 11:64741551-64741573 CGTGGAGGGAGGCTGGGGGCGGG + Intronic
1084084752 11:66849899-66849921 CATGGTGTGAGGGTGGGGGCTGG - Intronic
1084759055 11:71256712-71256734 CATCCAGGGAGGGATGGGGCCGG + Intergenic
1085226625 11:74927235-74927257 CCTCCAGGGAGGGTGGGGGTGGG - Intronic
1085244003 11:75083076-75083098 CAAAAAAGGAGGGTGGGGGAGGG + Intergenic
1085409832 11:76284402-76284424 CTTTGAAGGAGGCTGAGGGCAGG - Intergenic
1089700354 11:120240573-120240595 AAAAGAATGAGGGTGGGGGCTGG + Intronic
1089733187 11:120532293-120532315 GATCAAAGGAAGCTGGGGGCGGG - Intronic
1090367904 11:126223152-126223174 CAGCGAGTGAGGGAGGGGGCTGG + Intronic
1090680254 11:129048072-129048094 CATACAAGGAGAGTGGGGGGTGG - Intronic
1090875635 11:130786451-130786473 CACAGCAGGAAGGTGGGGGCAGG - Intergenic
1091106617 11:132925831-132925853 CATGTAAGGAGCTTGGGGGCTGG - Intronic
1091550385 12:1531269-1531291 CCTCGGCGGAGGGTCGGGGCTGG - Intronic
1093401499 12:18752621-18752643 CCTCCAGGGAGGGTGGGGGGTGG - Intergenic
1093942415 12:25068956-25068978 CACCGAAGGAGGATGAGGGCAGG - Intronic
1100323982 12:93523903-93523925 CTACTAAGGAGGCTGGGGGCAGG - Intergenic
1101640796 12:106584613-106584635 TATGGAAGTGGGGTGGGGGCTGG + Intronic
1101725605 12:107385844-107385866 GATGGCAGGAGGGTGGGGGCAGG - Intronic
1102414687 12:112750463-112750485 CATCTAAGGAGTGAGGGAGCTGG + Intronic
1104885027 12:132102156-132102178 CATGGTAGGAAGGTGGGAGCTGG + Intronic
1104899073 12:132178517-132178539 CATGTAAGGGGAGTGGGGGCGGG - Intergenic
1106028483 13:25977032-25977054 CAGGGAAGGGGGGTGGGGGTGGG - Intronic
1107080557 13:36370151-36370173 CACAGACGGAAGGTGGGGGCTGG + Intronic
1107941495 13:45381623-45381645 CATCGCAGGAGGGGAGGGGGAGG - Intergenic
1110254977 13:73423349-73423371 CATCCAAGGAGGCCAGGGGCTGG + Intergenic
1110606322 13:77437114-77437136 GATTGTCGGAGGGTGGGGGCTGG + Intergenic
1111167479 13:84479026-84479048 CAACCAAGGAGGGTGGGAGCTGG + Intergenic
1112715883 13:102184297-102184319 CATGGAAGAAAGGTGGGGGAGGG + Intronic
1113868316 13:113543308-113543330 CACAGAGGGAGGGCGGGGGCAGG - Intronic
1117070180 14:52049059-52049081 CACAGCAGGAGGGTGGAGGCTGG + Intronic
1117240053 14:53822171-53822193 CAATGATGGAGGGTGGGGACTGG - Intergenic
1117665674 14:58053470-58053492 GATCTATGAAGGGTGGGGGCAGG - Intronic
1119620931 14:76131349-76131371 CCTCGGAGGAGGGAGGGGGCGGG + Intergenic
1119739195 14:77003155-77003177 CAGCAGAGGATGGTGGGGGCTGG + Intergenic
1121340216 14:93100501-93100523 CAGGGAAGCAGGGAGGGGGCCGG + Intronic
1122408497 14:101514162-101514184 CATCTGAGGAGGGTGGGGGCTGG - Intergenic
1127917503 15:63467195-63467217 GGTGGAAGGAGGGTGGGTGCTGG - Intergenic
1128452162 15:67811943-67811965 CATAGAGGGAGGATGGGGGGAGG + Intergenic
1128753194 15:70163517-70163539 GATTGAAGGAGAGTGGGTGCTGG + Intergenic
1128944413 15:71811282-71811304 CAAGGAATGGGGGTGGGGGCTGG + Intronic
1129892869 15:79083168-79083190 CAGTGAAGGAGGCTGGAGGCTGG + Intronic
1130921322 15:88347538-88347560 CATGGGCTGAGGGTGGGGGCAGG - Intergenic
1130957628 15:88638769-88638791 CATCTGAGGAGGGGGAGGGCCGG + Exonic
1131067204 15:89442180-89442202 TGTCCCAGGAGGGTGGGGGCTGG - Intergenic
1132375176 15:101324047-101324069 TGTCCCAGGAGGGTGGGGGCTGG - Intronic
1132508422 16:324326-324348 CCTGGGAGGAGGCTGGGGGCCGG + Intronic
1132710199 16:1263014-1263036 CATTGCAGGAGGGTGGGGCCCGG - Intergenic
1132727825 16:1346354-1346376 CCTCTAAGGTGGGTGGGGCCTGG + Exonic
1132868134 16:2103932-2103954 GGTAGAGGGAGGGTGGGGGCAGG + Intronic
1132902634 16:2266671-2266693 ATTCGAAGGCGGGTGGGTGCAGG - Intronic
1133036909 16:3038645-3038667 AATAGGAGGAGGGTGGGGGCTGG + Intergenic
1133272406 16:4616629-4616651 CAACGAAGGAGGCTGGGGCCAGG - Intronic
1133539034 16:6730859-6730881 CAAGGAAGCAGGGTGGGGTCTGG - Intronic
1134186032 16:12085621-12085643 TAGAGAAGTAGGGTGGGGGCTGG - Intronic
1134397601 16:13879385-13879407 TGTCGAGGGAGGGTGGAGGCAGG - Intergenic
1140741862 16:77948583-77948605 CAGGGAAGGAGTATGGGGGCAGG - Intronic
1141187096 16:81795859-81795881 AATAGAAGGTGGGAGGGGGCCGG - Intronic
1141336087 16:83156733-83156755 TATGGAAGGAGGCTGGGGGAGGG - Intronic
1141517779 16:84557770-84557792 CATCTGAGGAGGCTGGGGGATGG + Intergenic
1141626285 16:85263038-85263060 GATCGCGGGAGGGCGGGGGCCGG + Intergenic
1142751601 17:1991980-1992002 CAAGGAAGGAGGGTGGGCGTGGG - Intronic
1143097219 17:4484745-4484767 GATGGAAGGAGGGAGGGGGAGGG - Intronic
1143411342 17:6711229-6711251 CGGCCATGGAGGGTGGGGGCAGG + Intronic
1143477431 17:7210937-7210959 CATGGAGGGAGGGTGGTGTCTGG + Intronic
1144786816 17:17836712-17836734 CATCGAAGGTGCGTCAGGGCGGG - Exonic
1145974445 17:28976186-28976208 CATCAAAGGAGGTGGGAGGCAGG + Intronic
1146064695 17:29625028-29625050 AAGAGAAGGAGGGTGGGGGTAGG - Intergenic
1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG + Intronic
1147316198 17:39621614-39621636 CAGGGCAGGTGGGTGGGGGCAGG - Intergenic
1147791053 17:43014502-43014524 CATGGAAAGAGGCAGGGGGCAGG + Intergenic
1147891930 17:43723364-43723386 CAGGGAATGAGGGTGGGGGTGGG + Intergenic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148746011 17:49918831-49918853 CAGCCAAGGAGTGTGGGGGTAGG + Intergenic
1148839875 17:50488160-50488182 CATGCCAGGAGGCTGGGGGCAGG + Intergenic
1151500640 17:74486100-74486122 CATAGCAGGAGGGAGCGGGCTGG + Intergenic
1151683286 17:75633104-75633126 CATTGGAGCAGAGTGGGGGCAGG - Intronic
1151758148 17:76086425-76086447 CACCCAGGGTGGGTGGGGGCAGG - Intronic
1151786679 17:76278619-76278641 CAACGAAGGAGGCTGGCGGTGGG - Intronic
1151874550 17:76859519-76859541 CAGCAATGGAGGGTGAGGGCAGG + Intergenic
1152237267 17:79145041-79145063 AATCGCAGCAAGGTGGGGGCGGG + Intronic
1152335961 17:79700419-79700441 CATCAGGGAAGGGTGGGGGCGGG - Intergenic
1153337195 18:3936877-3936899 AATCCAAGGAGGGTGGGTGGAGG + Intronic
1153919788 18:9778276-9778298 CATGGAGGGAGGGTCGGGGATGG + Intronic
1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG + Intergenic
1156455356 18:37290179-37290201 CAGGGAAGGAGAGTTGGGGCTGG - Intronic
1156465539 18:37346113-37346135 CATAGAAGGAGGCTGCAGGCTGG - Intronic
1156563445 18:38156371-38156393 GATCTAATGAGGGTGGGGGAAGG - Intergenic
1157416481 18:47507663-47507685 TATAGAAGGAGGGTGGGGAGGGG + Intergenic
1157496833 18:48162208-48162230 CAGGGAAGGAGGCTGGGGCCAGG - Intronic
1157867360 18:51197767-51197789 GCCCGAAGGAGGGTGGGGGGTGG - Intronic
1158488617 18:57890391-57890413 CATCGAATGAAGGTTGGGGCAGG - Intergenic
1159189722 18:65026040-65026062 CATCGCTGGGGGGTGGGGGGTGG - Intergenic
1160072698 18:75642485-75642507 CATACAGGGAGGGTGGAGGCAGG + Intergenic
1161356788 19:3823511-3823533 CATCACAGGAGGGAGGGGGATGG - Intronic
1161648221 19:5467511-5467533 CATCTGAGGAGGGTGGGGACGGG - Intergenic
1163104016 19:15113344-15113366 CATCAAAGATGGGTAGGGGCAGG - Intronic
1164677005 19:30107595-30107617 CAGGGAAGGAGGCGGGGGGCGGG - Intergenic
1165766160 19:38352488-38352510 CACTGAAGGTGGCTGGGGGCTGG + Intronic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166529248 19:43532933-43532955 CTTCGAGAGAGGGCGGGGGCGGG - Intronic
1166568229 19:43777979-43778001 CATAGAAGGTGGGGGAGGGCTGG - Intronic
1166770745 19:45280567-45280589 TCTCGCAGGAGGGTGGGGACCGG + Exonic
1167353905 19:48992095-48992117 GATGGGAGGAGGCTGGGGGCTGG - Intronic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
925020448 2:563883-563905 CCTCGAAGGAGCTTGGAGGCAGG - Intergenic
925466725 2:4112521-4112543 CATGGCAGGAGGGAGAGGGCAGG - Intergenic
925959652 2:9003442-9003464 CCCGGGAGGAGGGTGGGGGCTGG - Intronic
929782767 2:44967891-44967913 CATACAGTGAGGGTGGGGGCAGG + Intergenic
929869473 2:45746115-45746137 CAACGAAGGAGGGAAGGGGCAGG - Intronic
932455667 2:71848259-71848281 GAGAGAAGGGGGGTGGGGGCGGG + Intergenic
935152374 2:100449542-100449564 CATCGAAGCTGGGTGGGGCCTGG - Intergenic
935165003 2:100562750-100562772 CAGCGGAGGAGGGGTGGGGCTGG - Exonic
937296984 2:120815459-120815481 TATCGGTGGAGGGAGGGGGCTGG - Intronic
938230305 2:129653350-129653372 CCCAGATGGAGGGTGGGGGCAGG + Intergenic
939415720 2:141894366-141894388 AATGGAAGGAGGGAGGGGGTAGG - Intronic
940739496 2:157490876-157490898 TATTGAAGCTGGGTGGGGGCAGG - Intergenic
942799626 2:179861020-179861042 CTGCGGAGGAGGGCGGGGGCCGG + Intronic
944187544 2:196966203-196966225 TATAGAAAGAGTGTGGGGGCTGG + Intergenic
946250325 2:218407424-218407446 CATGGAAGGCGGGTGAGGACAGG + Intergenic
946254156 2:218430945-218430967 CAGGGAAGGAGGGTGGGTGGTGG - Intronic
947435283 2:230067925-230067947 CACCGAGCGCGGGTGGGGGCGGG - Intronic
947620596 2:231588184-231588206 GAAGGAAGGAGGGTGGGGGAAGG + Intergenic
948942004 2:241201413-241201435 CATCCATGGAGGCTGGGGGCTGG - Intronic
949080102 2:242089288-242089310 CGGCCCAGGAGGGTGGGGGCGGG - Intergenic
1168793492 20:595918-595940 CAGGGAAGGTGGGTGGGGGTGGG + Intergenic
1169427712 20:5509652-5509674 CATCAAGGGAGGCTGGAGGCAGG + Intergenic
1170458068 20:16551925-16551947 CAAAGAAGGAGGGTGGGCGTGGG + Intronic
1172028869 20:31968001-31968023 CAGCTCAGGCGGGTGGGGGCGGG + Exonic
1172301314 20:33852468-33852490 GAGAGATGGAGGGTGGGGGCGGG + Intronic
1172768227 20:37362516-37362538 CCTGGAATGAGGGTGTGGGCTGG - Intronic
1173268307 20:41507527-41507549 CATCGAAGTAGGAAGGGAGCTGG + Intronic
1174049617 20:47758603-47758625 CAGCGAAGGTGGGTGCGGGGAGG + Intronic
1174134857 20:48372502-48372524 CATCGGGGGATTGTGGGGGCTGG - Intergenic
1174296507 20:49548982-49549004 CATGGAAGGTGGGTGGGTGGTGG + Intronic
1175329921 20:58156436-58156458 CTTGGGTGGAGGGTGGGGGCAGG + Intronic
1176097350 20:63350183-63350205 CACAGAAGGACGGTGAGGGCGGG + Exonic
1176119277 20:63446719-63446741 CCCCGAGGGAGGGCGGGGGCTGG - Intronic
1176389110 21:6154584-6154606 GAAAGAAGGAGGCTGGGGGCTGG - Intergenic
1178879891 21:36441054-36441076 CATGGCAGGGGGGTGGGGGCGGG - Intergenic
1179168213 21:38951967-38951989 CATCGAAGGAGAGAGAGGACAGG + Intergenic
1179624124 21:42638691-42638713 CGGCGAGGGAGGGTGGGGGAGGG - Intergenic
1179734362 21:43383664-43383686 GAAAGAAGGAGGCTGGGGGCTGG + Intergenic
1181533011 22:23527747-23527769 AAGCCAAGGAGGGTGAGGGCAGG + Intergenic
1181849826 22:25742107-25742129 CCCAGAAGGAGGGTGGGGGGAGG + Intergenic
1182037690 22:27212258-27212280 CATCGGAGGATGCTGGGGGAAGG + Intergenic
1183413117 22:37666839-37666861 CAGTGATGGTGGGTGGGGGCTGG + Exonic
1183646675 22:39131270-39131292 CATTCAAAGCGGGTGGGGGCTGG + Exonic
1184034537 22:41912224-41912246 CATCACAGCTGGGTGGGGGCTGG - Intronic
1184099850 22:42336340-42336362 CATCCAAGGGGAGAGGGGGCGGG - Intronic
1184468680 22:44683563-44683585 CCCCGAAGGAGGGCAGGGGCTGG + Intronic
1184678315 22:46055219-46055241 CATGGAAGGCGGGTGTGGCCTGG + Intronic
949098174 3:111572-111594 CATAGAAGGAGGGCAGGGGAAGG + Intergenic
949549906 3:5104157-5104179 CATCGAAGGAGGAAGAGGACTGG - Intergenic
949845669 3:8367806-8367828 CATCTAGGCAGGTTGGGGGCTGG + Intergenic
949868972 3:8570823-8570845 GAAGGAAGGAGGGTTGGGGCAGG - Intergenic
950397362 3:12743926-12743948 CATCGACGGAGCCTGGGGGCTGG - Exonic
952972270 3:38659131-38659153 CATCAGAGCAGTGTGGGGGCTGG - Intergenic
953459929 3:43073934-43073956 CGTAGAAGGAGGGTGGGTGGAGG - Intergenic
953853127 3:46480980-46481002 CAGTGGAGGAGGGTGGAGGCTGG - Intronic
954073157 3:48157996-48158018 CAGGGAAGGGGGGTGGGGGTAGG - Exonic
954463219 3:50639377-50639399 CATGGAATGAGGGTGGAGGCTGG + Intronic
954602045 3:51877734-51877756 CCTAGAAGCAGGGTGGGTGCTGG + Intergenic
954817185 3:53292044-53292066 AATGGCAGGAGGGTGGGGGTGGG - Intronic
956706728 3:72005577-72005599 GATCGTAGGAGGGTGAGGGGAGG - Intergenic
956964521 3:74443458-74443480 CACTGAAGGAGGGGAGGGGCAGG - Intronic
957417837 3:79929304-79929326 CATGGAAGGAGGCTGAGGGGTGG + Intergenic
958903850 3:99920656-99920678 CACTGAGGGTGGGTGGGGGCAGG - Intronic
959556576 3:107726301-107726323 CATCAAGGGAGGGTGGAGGTGGG - Intronic
959847105 3:111046126-111046148 CAGGGAAGGAGGGTGGGAGAAGG - Intergenic
959847131 3:111046302-111046324 CAGGGAAGGAGGGTGGGAGAAGG - Intergenic
960036913 3:113111093-113111115 CAGGGCAGCAGGGTGGGGGCAGG + Intergenic
960778870 3:121294579-121294601 CCTAGAAGAAGGGTGGGGGAAGG + Intronic
961520255 3:127463313-127463335 CATTGGTGGTGGGTGGGGGCTGG - Intergenic
963732263 3:148985821-148985843 CATCGAGGGAGGGGAGAGGCAGG + Intergenic
967094644 3:186167123-186167145 CATGGTGGGTGGGTGGGGGCAGG + Intronic
967223187 3:187266572-187266594 CATAGATGGAGGGTAGGGGGTGG + Intronic
968944193 4:3654991-3655013 CATTCCAGGATGGTGGGGGCAGG + Intergenic
969370912 4:6731142-6731164 CATCAGATGGGGGTGGGGGCGGG + Intergenic
971332812 4:25696363-25696385 CATAGAAGGAGGATGAGGGGAGG + Intergenic
971484086 4:27141681-27141703 CCTGAAAGGAGGGTGGGGGTGGG + Intergenic
972284852 4:37638208-37638230 CACCTTGGGAGGGTGGGGGCAGG + Intronic
976205174 4:82617406-82617428 CATGGGAGGGGAGTGGGGGCGGG + Intergenic
979587364 4:122436700-122436722 CATTGAAGGAAGCTGGGTGCTGG - Intergenic
979724346 4:123942550-123942572 CAGCAAATGGGGGTGGGGGCGGG - Intergenic
983093618 4:163536851-163536873 TATTGAAGGATGGTGTGGGCAGG - Intronic
984002848 4:174271635-174271657 AATATAAGGAGGGTGGTGGCAGG - Intronic
984364934 4:178786280-178786302 CATGGATGGGGGGTGGGGGTAGG + Intergenic
984935963 4:184889652-184889674 CAGCCAGGGAGTGTGGGGGCTGG + Intergenic
986210943 5:5671768-5671790 CCTGGGAGGAGGGTGGGGGCAGG - Intergenic
986387727 5:7251825-7251847 CATGGGAGGAGAGTGGTGGCGGG - Intergenic
986576996 5:9222468-9222490 CAGGGAAGGAGTGTGGGGGAGGG + Intronic
987374154 5:17218263-17218285 CAAAGATGGAGGGTGGGGGTGGG + Intronic
987380033 5:17276097-17276119 CATCAAGGGAGGGAGGGGGTGGG + Exonic
987447425 5:18037536-18037558 CACCGTAGGAGGTGGGGGGCAGG + Intergenic
990545209 5:56815521-56815543 CTGCGAGGGAGGGAGGGGGCGGG - Intergenic
990577278 5:57135565-57135587 CATCAAAGGAGGGTAGAGCCTGG + Intergenic
994054381 5:95399481-95399503 CATCACAGGTGGGTGGGGGGGGG - Intronic
996088340 5:119326462-119326484 CAGTGAAGCACGGTGGGGGCAGG + Intronic
997216361 5:132114381-132114403 CATTGAGAGAGGGTGGGGGTGGG + Intergenic
998256705 5:140594043-140594065 CATGGAAGGTGGGAAGGGGCCGG - Intergenic
998407407 5:141881963-141881985 CATCGGGAGAGGGTGAGGGCTGG + Intergenic
999477345 5:151912671-151912693 AATAGAAGGAGGATGGGAGCAGG + Intronic
1002487867 5:179551667-179551689 TATGGGAGGGGGGTGGGGGCGGG - Intronic
1003179958 6:3782881-3782903 CCTGGGAGGAGGGTGGGGGTGGG - Intergenic
1003342944 6:5239487-5239509 CATCTAGGGAGGGTGTGGGAAGG + Intronic
1004051883 6:12090519-12090541 CATGGAAGGAGCGTGGGGTGAGG - Intronic
1005140465 6:22626181-22626203 CAGGAAAGGAGGGTGGGGGCTGG - Intergenic
1005347918 6:24908741-24908763 AAGCCAAGGAGGCTGGGGGCGGG - Intronic
1005587041 6:27286989-27287011 CATCTCGGGGGGGTGGGGGCAGG + Intronic
1006918854 6:37614552-37614574 CATAGAAGGAGGGAGGGAGAAGG - Intergenic
1007764439 6:44152514-44152536 CAGGGAAGGAGGGAGGGGGAAGG - Intronic
1009269557 6:61600686-61600708 CATGGAGTGAGGGTGAGGGCAGG - Intergenic
1011406855 6:87024712-87024734 CAGAGAATAAGGGTGGGGGCAGG - Intergenic
1012527183 6:100192149-100192171 CTTGGAAGTAGAGTGGGGGCAGG + Intergenic
1016779056 6:147938538-147938560 CAGCGAATGAGGATGGGTGCTGG - Intergenic
1016783923 6:147989384-147989406 CCTAGAATGAGGTTGGGGGCTGG - Intergenic
1017527012 6:155250197-155250219 CATCCATGGAGGGTGAGAGCTGG + Intronic
1019415635 7:925480-925502 CCTGGAAGGCGGGTGGGGGTTGG - Intronic
1019514027 7:1431947-1431969 CATCTAGGGTGGGTGGGGCCCGG + Intronic
1020085375 7:5307561-5307583 CATCCTGAGAGGGTGGGGGCAGG + Exonic
1022629820 7:32074745-32074767 CATGAAAGGTGGGTGGAGGCAGG + Intronic
1023878700 7:44306776-44306798 CAGGGGAGGAGGGTGTGGGCAGG + Intronic
1027174451 7:75894258-75894280 CATCTAAGGGGGGAGGGTGCAGG + Intergenic
1028634338 7:92970571-92970593 TTTGGCAGGAGGGTGGGGGCTGG + Intergenic
1029349359 7:100002186-100002208 CAACTAAGAAAGGTGGGGGCGGG - Intergenic
1030817085 7:114051517-114051539 CCAAGAAGGTGGGTGGGGGCGGG + Intronic
1035013274 7:155739905-155739927 CATCAAAGGAGGGGGCGGGACGG - Exonic
1035168273 7:157004096-157004118 CATCGATGGGGGAAGGGGGCCGG + Intronic
1035286009 7:157807613-157807635 CATCACAGGAGGGTGAGGGCAGG + Intronic
1035538145 8:407551-407573 CGGCCCAGGAGGGTGGGGGCGGG - Intronic
1035769721 8:2137437-2137459 CAGGGAAGCAGGGTGGGGCCAGG + Intronic
1037603590 8:20419318-20419340 CATGGATGGGGGGTGGGGGATGG + Intergenic
1037705893 8:21314709-21314731 AATGGCAGGAGGCTGGGGGCGGG + Intergenic
1037815591 8:22110045-22110067 GCTGGAAGGAGGGAGGGGGCAGG + Intergenic
1037866907 8:22451430-22451452 TATTAAAGGAGGCTGGGGGCCGG - Intronic
1038395157 8:27241149-27241171 CATCAAAGGAGGGTGGCTTCAGG + Exonic
1038476435 8:27871779-27871801 CATCCCAGGACCGTGGGGGCCGG - Exonic
1038741488 8:30220767-30220789 CACCGAAGGAGGCTGTGGGCAGG - Intergenic
1039607927 8:38898415-38898437 CATGAGAGGAGGGTGGGGGTGGG + Intergenic
1046230837 8:111354917-111354939 CATTGAGGGAATGTGGGGGCTGG + Intergenic
1047262229 8:123273895-123273917 CACCGAAAGAGCTTGGGGGCGGG - Intronic
1048167837 8:132079399-132079421 CATTGAAGGAGGCTGGGTGAAGG + Intronic
1048518585 8:135133409-135133431 CACAGAAGGAAGGTGGGGTCAGG - Intergenic
1049355091 8:142183653-142183675 CGTGAAAGGAGAGTGGGGGCCGG - Intergenic
1049384400 8:142333885-142333907 CATCGAGGGGTGGTGGGTGCTGG - Intronic
1049555453 8:143279239-143279261 AATCGAAGGAGGATGGGGAGAGG - Intergenic
1049584999 8:143428956-143428978 GAACGAAGGAGGGCGGGGGCAGG + Exonic
1050650547 9:7771242-7771264 CATAGAATGACGGTGGGGGTTGG + Intergenic
1051524769 9:18031634-18031656 CTTGGAGGGTGGGTGGGGGCAGG - Intergenic
1054985003 9:71251840-71251862 GATGGTGGGAGGGTGGGGGCAGG - Intronic
1055442133 9:76346927-76346949 CATGGAAGGAGGGGTGGAGCAGG + Intronic
1059324755 9:113497441-113497463 CAGGAAAGGAGGGAGGGGGCAGG - Intronic
1059493137 9:114685921-114685943 CATTGGAGGAGGCTGGGGGATGG - Intergenic
1061561514 9:131407223-131407245 CATGGTTGGAGGGTGGGGGAAGG + Intronic
1061893189 9:133633456-133633478 CCTCTGAGGAGGGTGAGGGCAGG + Intergenic
1061944656 9:133901871-133901893 CATCGGAGGGGGCTGGGGGTGGG + Intronic
1061996710 9:134189884-134189906 GATGGAAGGAGGGAGGGAGCAGG - Intergenic
1062395229 9:136350129-136350151 CAACAAAGGAGGGTGGGGGCTGG - Intronic
1062475674 9:136725788-136725810 CATCCCAGGGGGGCGGGGGCGGG - Intergenic
1062649703 9:137569315-137569337 GATGGAAGGTGGGTGGGGGGTGG - Intronic
1187701504 X:21968124-21968146 GCTCGAAGTAGGGTGGGTGCAGG + Intronic
1189322693 X:40096283-40096305 CGTGGAGGGAGGGCGGGGGCGGG - Intronic
1189446759 X:41086627-41086649 TATCGCGGGAGGGTGGGGGGAGG - Intronic
1190690784 X:52911397-52911419 CATGGAAGGTGGGTGGGTGGAGG + Intergenic
1190695199 X:52944395-52944417 CATGGAAGGTGGGTGGGTGGAGG - Intronic
1191598580 X:62975347-62975369 CATCTAAGATGGATGGGGGCAGG + Intergenic
1191930541 X:66366754-66366776 CATCCAAGGAGAGTGCAGGCAGG + Intergenic
1191937359 X:66439844-66439866 CATGGAAGGAGGGAGGGAGGAGG + Intergenic
1192232930 X:69278285-69278307 CATGGGAGCAGGGTGGGGGTGGG + Intergenic
1192283275 X:69706620-69706642 ACTCGAAGAAGGGTGGGGGTGGG + Intronic
1192935135 X:75850933-75850955 CATGGCAGGAGGGTGTGGGCAGG + Intergenic
1195100787 X:101552240-101552262 CATCGAAGGAGGAAGAGGGAGGG + Intronic
1195240773 X:102949802-102949824 CATCTAGGGAGGGTGAGGGATGG - Intergenic
1196211002 X:112995813-112995835 CATGGAAGGAGGATGGGGTGTGG + Intergenic
1196257749 X:113542076-113542098 AATCTAATGAGGGTGGGGGTAGG - Intergenic
1196324701 X:114389457-114389479 CATGGAAGAAGGCTGTGGGCAGG + Intergenic
1198112284 X:133512594-133512616 GAACCAAGGAGGGTGGGGGCGGG - Intergenic
1198322459 X:135532019-135532041 GAAGGAAGGAGGGTGGGAGCTGG + Intronic
1200069361 X:153520069-153520091 GATCCAGGGAGGGTGGGGGTGGG + Intronic
1200223666 X:154404789-154404811 CAGCGCAGCAGGGTGGGGGGCGG - Intronic
1200256744 X:154586335-154586357 CAGCGTGGCAGGGTGGGGGCTGG + Intronic
1200261025 X:154618068-154618090 CAGCGTGGCAGGGTGGGGGCTGG - Intronic