ID: 1146500504

View in Genome Browser
Species Human (GRCh38)
Location 17:33360468-33360490
Sequence AAGGGTATTCAGAGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146500504_1146500509 13 Left 1146500504 17:33360468-33360490 CCAGCTTCTCTCTGAATACCCTT 0: 1
1: 0
2: 1
3: 19
4: 270
Right 1146500509 17:33360504-33360526 GCCCACCTCCTCCCTGCCTCTGG 0: 1
1: 1
2: 13
3: 113
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146500504 Original CRISPR AAGGGTATTCAGAGAGAAGC TGG (reversed) Intronic
900757945 1:4450407-4450429 ATGTGTATTCAGGGAGAAACAGG - Intergenic
901344512 1:8527888-8527910 AAGTGTCTTCAGAGTGGAGCTGG - Intronic
902112700 1:14096242-14096264 AAGTGGATTCAGAGAGAGGCAGG + Intergenic
904420863 1:30390339-30390361 AAGGGGAAGCAGAGAGAAACTGG + Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
905984465 1:42266447-42266469 AAGGCTATTCAATGAGAAACTGG + Intronic
906003944 1:42452829-42452851 AAATGTATTCAGAGAAAAGAAGG + Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
909472082 1:76040352-76040374 AAGGGTTTTTATAGACAAGCTGG + Intergenic
910768986 1:90811808-90811830 ATGGGTTTTCAGTGAGATGCTGG - Intergenic
911035060 1:93533831-93533853 AAGGGTAATTAGAGAGAAGAGGG - Intronic
913529099 1:119720781-119720803 TAGGGTATACAGAGAGGAACAGG + Intronic
917915636 1:179698492-179698514 AAGGGTATTCAGATAGGAAGAGG + Intergenic
919054327 1:192550782-192550804 AAGGTCATCCAGAGAGATGCAGG + Intergenic
920825297 1:209419347-209419369 AAGGAAATCCAGAGAGAAGGTGG - Intergenic
922073527 1:222219981-222220003 AAGTGTGTTGAGAGAGAAGGTGG - Intergenic
922806719 1:228394147-228394169 AAGAGTCTTCAGAGAGATGATGG - Exonic
923241190 1:232087246-232087268 GAGGGTATTCAGAGGAAAGGAGG + Intergenic
923642210 1:235775667-235775689 AAGGCTACACAGAGAGAAGATGG + Intronic
924217836 1:241842817-241842839 AAGCGGAAGCAGAGAGAAGCAGG - Intergenic
1063643346 10:7854073-7854095 AAGTGTATTGAGAGATATGCTGG - Intronic
1064021934 10:11815994-11816016 AAGGGTTCTGAAAGAGAAGCAGG - Intergenic
1065162645 10:22938861-22938883 AAGTGTATCCAGAGAGATGGAGG + Intronic
1067380719 10:45770771-45770793 AAGGTTATTCAGACAGGAACTGG - Intronic
1067888417 10:50111429-50111451 AAGGTTATTCAGACAGGAACTGG - Intronic
1070388550 10:75948966-75948988 AAGTGTATGCAGGGAAAAGCAGG - Intronic
1070678424 10:78432004-78432026 AAGGATATTAAGAGAAAAACTGG - Intergenic
1070950246 10:80425466-80425488 TAGGATATGCACAGAGAAGCAGG + Intronic
1072934193 10:99696223-99696245 AGGGGTAGTCAGAAAGAAGGAGG - Intronic
1074295393 10:112183338-112183360 AGGGGTACTCTGAGAGCAGCCGG - Intronic
1074927538 10:118088553-118088575 AAGGGTCCTCAAAGCGAAGCAGG + Intergenic
1075171277 10:120117663-120117685 AAGACAATTCAGAGAGAAGGAGG - Intergenic
1075174006 10:120142839-120142861 AAGGGAAGGCAGGGAGAAGCAGG - Intergenic
1076429118 10:130389221-130389243 AGGGCTATGCAGAGAGGAGCTGG + Intergenic
1076509681 10:131003906-131003928 ACGGGGCTGCAGAGAGAAGCAGG - Intergenic
1077497918 11:2895526-2895548 TAGGGAATCCAGAAAGAAGCAGG - Intronic
1079486467 11:20940599-20940621 AAGCTTATTCTGGGAGAAGCTGG - Intronic
1079614995 11:22481210-22481232 AGGTGTATTGAGAGAGAAGAGGG - Intergenic
1079745454 11:24122721-24122743 AAGGGGATTCAGAGAGAAAAAGG - Intergenic
1080820248 11:35799078-35799100 AAGGGAATTCTGAGAGCAGATGG + Intronic
1081437181 11:43040225-43040247 AAGAGTATTCAGAGAAGAGGTGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1084039410 11:66532665-66532687 AAGGTTGTTCAGGGAGAAGGGGG + Exonic
1084311174 11:68317169-68317191 AAGAGAATGCAGAGAGCAGCCGG - Intronic
1084395598 11:68907656-68907678 GAGGGTATTGAGAGAGGAGAGGG + Intronic
1085676610 11:78526067-78526089 AAGGGTATTGATGGAAAAGCTGG + Intronic
1085715048 11:78864968-78864990 AAGGATCTTCAGAGAGATGAAGG + Intronic
1085907553 11:80782499-80782521 ATGGAAATTCAGAGAGCAGCAGG + Intergenic
1087115480 11:94520258-94520280 AAGTGTTTTTAGAGAGAAGGAGG - Intergenic
1088321173 11:108555961-108555983 AAGGGGAGCCAGAGTGAAGCAGG - Intronic
1089080655 11:115773790-115773812 AAGTGAACTCAGAGAGAAGGAGG - Intergenic
1089577884 11:119459671-119459693 AAAGGAATACAGGGAGAAGCAGG + Intergenic
1089933410 11:122338018-122338040 AAGGGTATTTTGACAGAACCAGG - Intergenic
1089942494 11:122433434-122433456 ATGGGAATACAGAGAGAAGAGGG + Intergenic
1090462697 11:126906122-126906144 GAGGGAATTCAGAGAGGGGCAGG - Intronic
1090476400 11:127025510-127025532 AATTGAATTCAGAGGGAAGCAGG + Intergenic
1090794973 11:130127291-130127313 AAGGGTTATAAGAGAGCAGCAGG + Intronic
1092041047 12:5384672-5384694 CATGGGATACAGAGAGAAGCAGG - Intergenic
1094133014 12:27095041-27095063 AGGGGTATCCATAGAGAAGAGGG + Intergenic
1095440561 12:42235556-42235578 AAGAGAATTCAGAGAGAGGAAGG + Intronic
1095710630 12:45284447-45284469 AAGGGGATTGAGAGATACGCGGG + Intronic
1099197622 12:79637370-79637392 AAGGGTATTACCAGAGAAGGAGG - Intronic
1099680515 12:85822267-85822289 AAATGTATTCCGAGATAAGCTGG + Intronic
1101669731 12:106857296-106857318 AAGGATTTTCACAGAGAAGGGGG + Intronic
1101777821 12:107809595-107809617 AAGGGTCTCCAGACAAAAGCAGG + Intergenic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1105667735 13:22578850-22578872 AAGGGTATTCAAATAGAAAGAGG + Intergenic
1106058095 13:26257577-26257599 AAGAGTACTCAGTGGGAAGCAGG + Intronic
1106202817 13:27555868-27555890 AAGGGGACTCAGAGAGGAGGTGG - Intronic
1106360784 13:29028642-29028664 AAAGGGATTCAGAGAGAAGATGG - Intronic
1108412009 13:50159119-50159141 AAGGGTCTTAACAGAGAACCAGG + Intronic
1108729571 13:53220271-53220293 AAGGCTATTCAGAGATTAGCAGG - Intergenic
1111329992 13:86752931-86752953 AAGGGGACTCAGAGAGAATCTGG + Intergenic
1111606329 13:90544980-90545002 AAGAGAATTCAGAGAGAATGTGG + Intergenic
1113617850 13:111693829-111693851 TAGGGAATTTAGAGAGAGGCAGG - Intergenic
1113623383 13:111779090-111779112 TAGGGAATTTAGAGAGAGGCAGG - Intergenic
1113671906 13:112181354-112181376 AAGGAAATTCAGGGAGAAGAGGG + Intergenic
1114189743 14:20431326-20431348 AGGGTTATGCAGAGAAAAGCTGG - Intronic
1117069157 14:52041063-52041085 AAGCTTGTTCAAAGAGAAGCTGG - Intronic
1117165369 14:53027715-53027737 GAGAGTATTGAAAGAGAAGCGGG - Intergenic
1118899614 14:69975472-69975494 AAGAGGAATAAGAGAGAAGCAGG + Intronic
1119330829 14:73792308-73792330 AAGGGTAAGGAGAGAGAAGAGGG + Intergenic
1120039678 14:79738451-79738473 TAGGGTCTTCAGAGAGAATGTGG + Intronic
1120308086 14:82795970-82795992 CAGGATATTCAGAGAGATTCCGG + Intergenic
1120943229 14:89969274-89969296 AAGGGGATGCAGGGAGAAGGAGG - Intronic
1120975022 14:90240834-90240856 AAGGAAGTTCAGAGAGAAGAGGG - Intergenic
1121837970 14:97108937-97108959 AAGGGTCTTTGGAGAGAGGCAGG + Intergenic
1121926001 14:97927944-97927966 AAGAGTGTTCAGTGAGAGGCTGG + Intronic
1122102546 14:99424826-99424848 CAGGGAAGTGAGAGAGAAGCCGG + Intronic
1122682511 14:103476726-103476748 AAGGGCTTTCAGAGAGCAACAGG - Intronic
1126160742 15:45611287-45611309 AAGGGCAATCAAAGAGAAGGTGG + Intronic
1126299872 15:47183995-47184017 AAGGGTTTTCAGAGCGGAGGTGG + Intergenic
1126757379 15:51937680-51937702 AAGGGGGTTGAGAGAGCAGCAGG + Intronic
1127661156 15:61101576-61101598 AAGGATACTCAGAGAAAAGAAGG - Intronic
1128455890 15:67831147-67831169 AAGGCTATTCAGACAGACCCGGG - Intronic
1130288308 15:82573407-82573429 AAGGGTGAACATAGAGAAGCAGG - Intronic
1130829696 15:87586818-87586840 AATGGTATTTAGAGTGAAACAGG - Intergenic
1131670458 15:94614396-94614418 AATGGGGTTCAGAGAGAAGCGGG + Intergenic
1132256836 15:100383563-100383585 AAAGGAATTCAGTGATAAGCAGG - Intergenic
1132738417 16:1398772-1398794 AAGGGGCTTCAGAGGCAAGCAGG + Exonic
1133749494 16:8713497-8713519 AAGGGTTTTCAGACAGAAACAGG - Exonic
1134314663 16:13107601-13107623 AAGGCTCTTCAGGGGGAAGCAGG + Intronic
1136141344 16:28290939-28290961 GATGATATTCAAAGAGAAGCAGG - Intergenic
1137891107 16:52162795-52162817 GCTGTTATTCAGAGAGAAGCAGG - Intergenic
1139030596 16:62876075-62876097 AAGGCAATTCAGAGATAAACAGG - Intergenic
1140224670 16:73067771-73067793 AGGGGTCTGCAGAGAGACGCTGG + Intergenic
1146500504 17:33360468-33360490 AAGGGTATTCAGAGAGAAGCTGG - Intronic
1147419604 17:40315937-40315959 AAGGGTACCCAGGGAGCAGCAGG - Intronic
1148293495 17:46478137-46478159 AAGGTTAATCAAAGAGAAGGTGG - Intergenic
1148315681 17:46695839-46695861 AAGGTTAATCAAAGAGAAGGTGG - Intronic
1148865370 17:50625635-50625657 AAGGGTATTCAGAGCCAAAGGGG + Intronic
1150010420 17:61497608-61497630 AAGTCTTTTCAGAAAGAAGCTGG + Intergenic
1150229173 17:63540672-63540694 AAGGGTATTCACAAAGGAGGGGG - Intronic
1150828951 17:68501363-68501385 CAGGCTATTGAGAGAGAAGTGGG - Intergenic
1153367409 18:4273015-4273037 AAGGGCCTTCAGAGAGAGGAAGG + Intronic
1153960492 18:10136033-10136055 GAGTGTATGCATAGAGAAGCCGG + Intergenic
1155979596 18:32166557-32166579 AGGCGTATTGAGGGAGAAGCTGG - Intronic
1156179345 18:34584794-34584816 AAGTGTTTTCAGAGAGAAGAAGG + Intronic
1158718923 18:59906146-59906168 AAGGGTTTGCAAAAAGAAGCAGG + Intergenic
1159494252 18:69180155-69180177 AATGTCACTCAGAGAGAAGCAGG - Intergenic
1159644661 18:70903287-70903309 CAGGGTAGTCAGATAGAAGGAGG + Intergenic
1159680724 18:71348531-71348553 AGAGGAATTCAGAGAGAAACAGG - Intergenic
1160932296 19:1576508-1576530 AGGGGTATTCAGAGAAGACCAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1162470608 19:10870618-10870640 AGGGGGATGCAGAGAGAAGACGG + Intergenic
1164623617 19:29712659-29712681 AAGGGTTTTTATAGAAAAGCTGG - Intronic
1164802692 19:31090752-31090774 AAGGGGAGACAGAGAGAAGGAGG + Intergenic
1166198667 19:41222349-41222371 AATTCTATTCAGAGAGAGGCCGG - Intronic
1167713157 19:51124667-51124689 AAGGGCATTGAGAGGGAGGCAGG + Intergenic
1168579001 19:57537624-57537646 AAGAGTATGCACATAGAAGCAGG + Exonic
924964300 2:60911-60933 AAGGGAACTCAGTGAGATGCAGG + Intergenic
926756446 2:16240183-16240205 CAGGTTATTCAGAAAGAAGCGGG - Intergenic
927143289 2:20144212-20144234 AATGGCAATCAGAGAGAAACTGG + Intergenic
927727351 2:25436445-25436467 AAGAGTGTACAGAGTGAAGCAGG - Intronic
928405054 2:31008444-31008466 AAGGGACCTCAGAGAGAATCTGG - Intronic
930981415 2:57530143-57530165 AAGGATATTCAGATAGAAAGGGG + Intergenic
931443878 2:62310434-62310456 AAGCGTATTCACAGAGACTCCGG + Intergenic
931473571 2:62564897-62564919 AAGGATGTTCTGAGAGGAGCTGG + Intergenic
931800682 2:65755340-65755362 AAGGGGAGCAAGAGAGAAGCAGG + Intergenic
932284265 2:70519143-70519165 GTGGGTATTCAGAGGGCAGCAGG + Intronic
934026517 2:88005839-88005861 GATGGTAGTCAGAGAGAAACTGG - Intergenic
937514692 2:122640112-122640134 AAATGTATTAAGAGAGAAGATGG - Intergenic
939692298 2:145279308-145279330 GAGGGATTTCTGAGAGAAGCTGG - Intergenic
940629634 2:156221414-156221436 AAGGGAAGCCAGAGAGAAGAAGG + Intergenic
940636372 2:156302427-156302449 ATGGGTATGGAGACAGAAGCAGG - Intergenic
941244078 2:163075053-163075075 CAGGGAGTTCAGAGAGAAGCTGG - Intergenic
943440908 2:187926851-187926873 CAAGTTATTCAAAGAGAAGCTGG - Intergenic
943812728 2:192209579-192209601 AAGGGGATCCAGAGAGGAGATGG + Intergenic
946583546 2:221158123-221158145 AAGAGTGTTCCCAGAGAAGCTGG - Intergenic
947041356 2:225924656-225924678 GAGGGAAATCAGAGATAAGCAGG - Intergenic
947182450 2:227423564-227423586 AAGGGCATTCTGAAAGAAACAGG + Intergenic
948554931 2:238802561-238802583 AAGGGTATACAGTGAGATGGTGG + Intergenic
948740075 2:240040824-240040846 AAGGGTATGGACAGAGAAGATGG + Intergenic
948937098 2:241173666-241173688 CTGGGTTTTCAGAGAGAAACCGG - Intronic
1169547869 20:6669334-6669356 GAGGCTATGCAGAGAGAAGAGGG - Intergenic
1169856163 20:10105633-10105655 AAGGGACTTAAGAGAGAAGATGG + Intergenic
1170494461 20:16911838-16911860 AAGGGTAGCCAGAGAGAAAAAGG - Intergenic
1172013617 20:31860799-31860821 AAGGGGGTTCCGAGAGAAGGAGG + Intronic
1174251483 20:49223077-49223099 AAGGGCTTCCAGAGAGATGCTGG - Intronic
1174336828 20:49868381-49868403 CAGGGTTTTCAGAGAGGGGCAGG + Intronic
1174840214 20:53894265-53894287 AAGGGTATTCAGAGAGCTATCGG - Intergenic
1175881977 20:62264694-62264716 ATGGTTATTCCGAGAGATGCCGG - Intronic
1177042297 21:16129168-16129190 AAGGATATTCAGATAGGAGGAGG - Intergenic
1177072096 21:16523182-16523204 GATGGGATTGAGAGAGAAGCAGG - Intergenic
1177771080 21:25516437-25516459 AATGGTATCTAGAGAGAAACTGG + Intergenic
1181810469 22:25400877-25400899 AAGAGAATGCAGAGAGCAGCTGG + Intronic
1183942993 22:41306856-41306878 GAGGTTATTCAGACAGCAGCGGG + Intronic
1184038802 22:41931518-41931540 TGGGGTCTTCAGAGAGAAGGGGG + Intergenic
1185182404 22:49371034-49371056 GGTGGTTTTCAGAGAGAAGCAGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951752915 3:26057081-26057103 ATGGGTCTTCAGGGAGAGGCAGG - Intergenic
952046773 3:29331177-29331199 AAAGGTATTCAGAGAGATATGGG - Intronic
952054867 3:29432154-29432176 ATGGGAATTCAGAGAAAAGGAGG + Intronic
953758377 3:45666881-45666903 AAGGGAAGGCAGGGAGAAGCTGG - Intronic
954335643 3:49915658-49915680 AAGGATATTTAGAGAAAAGCAGG - Intronic
955308319 3:57857549-57857571 AAGGGAAACCAGAGATAAGCGGG + Intronic
956066121 3:65399261-65399283 GAGGGAATTCACAGGGAAGCTGG - Intronic
956178089 3:66493096-66493118 AAGGTTTTCCAAAGAGAAGCGGG + Intronic
958414545 3:93858365-93858387 AAAGGAATTCTGAGAGAGGCAGG + Intergenic
958878394 3:99641165-99641187 AAGGGACTTGAAAGAGAAGCTGG + Intronic
959111695 3:102130497-102130519 AAGGTTATCCAGAGAGATGCAGG + Intronic
960155344 3:114292738-114292760 TTGGGTAGGCAGAGAGAAGCTGG + Intronic
961426480 3:126852243-126852265 ACAGCTATTCAGAGAGTAGCTGG - Intronic
962374781 3:134850773-134850795 CAGGGTATGGAGAGTGAAGCGGG - Intronic
962710184 3:138079682-138079704 AAGGGTATGCAGTGAGAAGCAGG - Intronic
962960967 3:140310451-140310473 AAGGGTTGTCTGTGAGAAGCGGG - Intronic
964044642 3:152308509-152308531 CAGGGTATGCAGTGAGGAGCTGG + Intronic
964163537 3:153673879-153673901 AAGGGTATTAAGAGAGATTTGGG + Intergenic
965043546 3:163544272-163544294 AAGGGTATCCAGGCACAAGCTGG - Intergenic
967269263 3:187719490-187719512 AGGGGTAATCCCAGAGAAGCGGG - Intronic
968975421 4:3819874-3819896 AAGGGAATTCAGAGATCATCTGG - Intergenic
970032327 4:11690621-11690643 AATGGTTTGCAGAAAGAAGCAGG + Intergenic
970998008 4:22290257-22290279 AAGGGTATTCAAATAAAAACAGG - Intergenic
971504872 4:27355654-27355676 CAGGGTAATCAAAGAGAAACGGG - Intergenic
973535604 4:51879006-51879028 AGGGGTTTTCAGATTGAAGCTGG + Intronic
975363642 4:73502431-73502453 AAGGGTAGTCAGGGAGAAAAGGG + Intronic
976131882 4:81893179-81893201 ATGGGTCACCAGAGAGAAGCCGG + Intronic
976997688 4:91455934-91455956 AGGGGAATTCAGAGACAAGGAGG + Intronic
977174040 4:93797799-93797821 AAAGATATTAAGAGAGAAGAAGG + Intergenic
979450954 4:120870517-120870539 TTGGGTATTCAGAGAATAGCAGG + Intronic
979752334 4:124294675-124294697 AAGGTGATTCAGAGATAATCAGG + Intergenic
981650835 4:147056523-147056545 AAGGGTATAAAGACAGAAGATGG + Intergenic
981715135 4:147745081-147745103 AAGAGTGTTCAGAGAGCAGGAGG + Intronic
982567142 4:156999290-156999312 AGTGGTATTCACAGAGGAGCAGG + Intergenic
982576029 4:157111202-157111224 AAGTGTTCTCAGGGAGAAGCTGG + Intronic
982981204 4:162137986-162138008 AAGGGTACTCAGAGAGCTGGTGG + Intronic
983872083 4:172834406-172834428 ATGGGCAATCAGGGAGAAGCTGG + Intronic
985182372 4:187279425-187279447 AACGGGCTTCAGAGAGAGGCTGG - Intergenic
985505329 5:276444-276466 AAAGAAATTCAGAGAGAAGAAGG - Intronic
985951769 5:3227488-3227510 AAGGGTATTCGCAGAGCAGTTGG + Intergenic
987690936 5:21265898-21265920 AGGGGTATTGAGAGAAAAGGAGG + Intergenic
988709605 5:33760486-33760508 ATGGGCATTCTGAAAGAAGCTGG + Intronic
988998298 5:36735400-36735422 AAGGGGGTTCAGAGAGGACCAGG - Intergenic
989642592 5:43597695-43597717 AAGGGTATTCAGCCAGACTCAGG + Intergenic
990619156 5:57541360-57541382 AAGAGCATTCTGAGAGGAGCTGG - Intergenic
994979916 5:106860820-106860842 AAGAGTATTCAGAGAGAGAAGGG - Intergenic
995416636 5:111920626-111920648 AAGGGTTTTTATAGACAAGCTGG + Intronic
995446933 5:112254930-112254952 CAGGGTCTTCAGAGAGAGCCAGG - Intronic
995685114 5:114764420-114764442 AAGGGAAAGCAGAGAAAAGCAGG - Intergenic
996071808 5:119139443-119139465 AATGGAAATCAGAAAGAAGCCGG + Intronic
996569346 5:124915349-124915371 AAGGGTATTCAGATAGGAAGAGG + Intergenic
998033446 5:138893124-138893146 AAGGGCATTCAGAGGAGAGCTGG - Intronic
998721499 5:144956455-144956477 AACAGTATTAAGAAAGAAGCAGG - Intergenic
999928406 5:156404615-156404637 AAGTGTTTTGAGACAGAAGCTGG - Intronic
1003827014 6:9964346-9964368 AAGGGTAATCAAAGGGAAACTGG - Intronic
1005274586 6:24202654-24202676 AAGGGTATTCAAATAGAAATAGG + Intronic
1011300160 6:85865248-85865270 AAGGGAAATCAGAAAGAAACAGG - Intergenic
1012558894 6:100553748-100553770 AAAAGTATTCAGAGAACAGCAGG - Intronic
1012588706 6:100952894-100952916 AACTGTATTTAGAGAGAAGCTGG - Intergenic
1014204383 6:118641188-118641210 TAAGATATTAAGAGAGAAGCTGG - Intronic
1014457353 6:121651252-121651274 AAGGGAACTCAGAAATAAGCAGG + Intergenic
1014545867 6:122734580-122734602 ATGGGTATTTTGAGAGAAGCAGG + Intergenic
1014801015 6:125778009-125778031 AAGAGTAGTCAGAGAGGGGCCGG - Intergenic
1016301469 6:142636373-142636395 AAGTGAATTCAGAGATAGGCAGG - Intergenic
1016523315 6:144971205-144971227 CAGGCTAATGAGAGAGAAGCTGG + Intergenic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1017721269 6:157244927-157244949 AAGGGTGTTTGCAGAGAAGCAGG + Intergenic
1018394810 6:163370061-163370083 AAGGGAATCCACAGAGCAGCAGG - Intergenic
1018903954 6:168064495-168064517 CAGGATACTTAGAGAGAAGCAGG + Intronic
1019870930 7:3760365-3760387 AACTGTATTCAGAAAGAAACAGG - Intronic
1019877697 7:3829346-3829368 AAGGGCATACAGAGAGGAGAAGG + Intronic
1020009682 7:4801294-4801316 AGGGGTCTTCAGGGAGAAGGTGG - Intronic
1020962015 7:14816863-14816885 AATGTTATTCAGGGATAAGCTGG + Intronic
1023382464 7:39623126-39623148 GGGGGTATTCAGAGCGGAGCTGG - Intergenic
1023813041 7:43926875-43926897 AAGGGTATCCAGGAAGAAGCTGG + Intronic
1024568594 7:50705377-50705399 AAGGGGAAAAAGAGAGAAGCTGG - Intronic
1026067440 7:67087684-67087706 AAGGGTTTTCAGAGTGGAACTGG + Intronic
1026709481 7:72724643-72724665 AAGGGTTTTCAGAGTGGAACTGG - Intronic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1031949447 7:127877073-127877095 AGTGGTATTCAGAGAGGAGCTGG + Intronic
1032506986 7:132442999-132443021 AGGGGTGTTCAGATGGAAGCTGG - Intronic
1032593732 7:133218024-133218046 AATGGCAGTGAGAGAGAAGCCGG - Intergenic
1032668946 7:134065973-134065995 AAGGGGATTCAGTGGGCAGCTGG + Intronic
1036812867 8:11879734-11879756 GAGGGTCTTCAGAGAGGATCAGG + Intergenic
1037105944 8:15108356-15108378 CAGGACATTCAGCGAGAAGCAGG - Intronic
1037541872 8:19879918-19879940 ATGAGAATACAGAGAGAAGCTGG + Intergenic
1040860186 8:51990911-51990933 AACAGCATTCAGATAGAAGCTGG - Intergenic
1042542516 8:69921345-69921367 GAGAGTATTCATGGAGAAGCTGG + Intergenic
1045784414 8:105903743-105903765 AAGGACAGACAGAGAGAAGCAGG + Intergenic
1045902476 8:107300601-107300623 ATGGCTTTTCAGAGAGAAGAAGG - Intronic
1046770337 8:118111593-118111615 AAGGGAATAAAGAGAGATGCAGG - Exonic
1047001340 8:120575867-120575889 AAGGGTTTTCAGAGATCATCTGG - Intronic
1047824893 8:128562652-128562674 AAGGGCATTCTGAGTGAATCTGG + Intergenic
1048978818 8:139691965-139691987 AAGGTTCTTTAGAAAGAAGCAGG + Intronic
1050520365 9:6491456-6491478 AAGGGTGTTATGAGAGAAGTTGG + Intronic
1051858189 9:21593779-21593801 ACAGTTATTCAGAGAAAAGCAGG + Intergenic
1052986897 9:34494434-34494456 AAGGGTCTGCACAGAGTAGCAGG - Intronic
1053398266 9:37795286-37795308 AATGGAAGTCAGGGAGAAGCAGG - Intronic
1054767255 9:69052501-69052523 AAGGGGTTACAGAAAGAAGCAGG - Intronic
1057565329 9:96161558-96161580 AAGGGCATTCACAGGGAAGGCGG - Intergenic
1059256245 9:112934011-112934033 AAGAGTCTTCAGTTAGAAGCAGG - Intergenic
1062133141 9:134911026-134911048 AATGGGATTCAGAGAGAGGAGGG + Intronic
1186075541 X:5874555-5874577 AAAGCTATGCAGAGAGAAGAAGG - Intronic
1187462846 X:19503050-19503072 CAGGGCATATAGAGAGAAGCGGG + Intronic
1188360786 X:29250676-29250698 AAGGGTATTTAGATAAAACCAGG + Intronic
1189069639 X:37849715-37849737 AAGGGTCTTGAGAGGGAAACAGG - Intronic
1189183878 X:39034230-39034252 AAGTGAATTCAGAGAGGAGTGGG - Intergenic
1189240862 X:39523278-39523300 AAGGGTATACTCAGAGAAGGTGG + Intergenic
1190044148 X:47099071-47099093 GAGGGTATTGAGAGAGCAACAGG + Intergenic
1191684042 X:63870664-63870686 AAAGGTATTAAGAGAGAAGATGG + Intergenic
1194202154 X:90965625-90965647 ATGGGGATTCACAGAAAAGCTGG - Intergenic
1195548645 X:106140945-106140967 AAGGGAAATCAGAAAAAAGCAGG + Intergenic
1197130170 X:122996324-122996346 AAGGGCATTGAGAGAGAAAGCGG + Intergenic
1197562864 X:128046548-128046570 AAGGATATTCACAGAGATTCAGG - Intergenic
1197725093 X:129771001-129771023 AAGGGGATTCAGAGATGAGGTGG - Intergenic
1198024573 X:132692679-132692701 GTGGGTTTTCAAAGAGAAGCAGG - Intronic
1198429792 X:136553852-136553874 AAGGGTAGTCAGAGAGACCTTGG + Intronic
1200234351 X:154461014-154461036 AGGGGGATGCAGAGGGAAGCTGG + Intronic
1200547991 Y:4541079-4541101 ATGGGGATTCACAGAAAAGCTGG - Intergenic
1202333472 Y:23779960-23779982 AAGGGCAGCCAGAGAGAAGGTGG - Intergenic
1202537297 Y:25890103-25890125 AAGGGCAGCCAGAGAGAAGGTGG + Intergenic