ID: 1146502044

View in Genome Browser
Species Human (GRCh38)
Location 17:33372722-33372744
Sequence GCAGCCCATAGCCCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 188}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146502032_1146502044 12 Left 1146502032 17:33372687-33372709 CCACCCCATTGGAACCGCTGGCC 0: 1
1: 0
2: 1
3: 5
4: 75
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502040_1146502044 -2 Left 1146502040 17:33372701-33372723 CCGCTGGCCATTGGGATCTGGGC 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502031_1146502044 13 Left 1146502031 17:33372686-33372708 CCCACCCCATTGGAACCGCTGGC 0: 1
1: 0
2: 1
3: 7
4: 63
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502034_1146502044 8 Left 1146502034 17:33372691-33372713 CCCATTGGAACCGCTGGCCATTG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502041_1146502044 -9 Left 1146502041 17:33372708-33372730 CCATTGGGATCTGGGCAGCCCAT 0: 1
1: 0
2: 1
3: 16
4: 156
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502029_1146502044 20 Left 1146502029 17:33372679-33372701 CCACATTCCCACCCCATTGGAAC 0: 1
1: 0
2: 1
3: 24
4: 238
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502025_1146502044 26 Left 1146502025 17:33372673-33372695 CCCCAGCCACATTCCCACCCCAT 0: 1
1: 0
2: 2
3: 61
4: 608
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502033_1146502044 9 Left 1146502033 17:33372690-33372712 CCCCATTGGAACCGCTGGCCATT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502027_1146502044 24 Left 1146502027 17:33372675-33372697 CCAGCCACATTCCCACCCCATTG 0: 1
1: 0
2: 2
3: 21
4: 279
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502035_1146502044 7 Left 1146502035 17:33372692-33372714 CCATTGGAACCGCTGGCCATTGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188
1146502026_1146502044 25 Left 1146502026 17:33372674-33372696 CCCAGCCACATTCCCACCCCATT 0: 1
1: 0
2: 0
3: 41
4: 278
Right 1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146502044 Original CRISPR GCAGCCCATAGCCCCCTGGG AGG Intronic
900754119 1:4421747-4421769 GCAGTTCTGAGCCCCCTGGGAGG - Intergenic
900896136 1:5484199-5484221 GCAGCCCGCACCCCACTGGGTGG + Intergenic
900998707 1:6136659-6136681 GCCGCCCAGAGCCCCCTGACAGG - Intronic
901180172 1:7336321-7336343 GCAGCCCAGAGCTGCCTGGTAGG + Intronic
901647256 1:10723347-10723369 ACACCCCAGAGCCCCCTAGGAGG - Intronic
902581252 1:17409180-17409202 GTAGCCCATGGCGACCTGGGGGG + Exonic
903353111 1:22730139-22730161 GCTGTGCACAGCCCCCTGGGAGG + Intronic
903778813 1:25809087-25809109 GCAGGCCACAGCTCCCTGAGGGG - Exonic
903809688 1:26028499-26028521 GCAGGCAATGGTCCCCTGGGTGG + Intronic
904068477 1:27773550-27773572 GCAGCCCACCGCCCCCAGGGTGG - Intronic
904143185 1:28369718-28369740 GGAGCCCTTGGCCCCCGGGGAGG - Intronic
904456479 1:30651284-30651306 GCATCCCATAGCACACAGGGTGG - Intergenic
906241790 1:44246697-44246719 ACAGCCCTTAGTACCCTGGGTGG + Intronic
906500750 1:46340545-46340567 GAAGCCCCTAGCCCACTTGGGGG - Exonic
910730596 1:90391817-90391839 GCAGCCCAGAGGCCCCAGGTTGG + Intergenic
912697478 1:111852323-111852345 GCAGCCCTCAGCCCTCTGTGGGG + Intronic
912707700 1:111927222-111927244 GCACCCCATAGCCCCCACTGGGG - Intronic
913244691 1:116861331-116861353 GAAGCCCAGTGCCCCCTAGGAGG + Intergenic
915528243 1:156489161-156489183 GCAGCCCGGAGCAGCCTGGGAGG - Intronic
915529615 1:156495874-156495896 AGAGCCCAGAGCCTCCTGGGAGG + Intronic
916817388 1:168367203-168367225 GAAGGCCAAAGCCCCCTGGGTGG + Intergenic
919701192 1:200632785-200632807 GCAGCCCACAGACCCATTGGCGG - Intronic
923673907 1:236064562-236064584 GCAGCCCACAGCCGCCGGGGAGG + Intronic
1063428145 10:5965597-5965619 GCTGCCCAAGGCCTCCTGGGTGG + Intronic
1063463699 10:6229965-6229987 CCAGTCCATAGCCCACTGAGAGG - Intronic
1066795238 10:39112756-39112778 GCAGCCCATTGAGGCCTGGGGGG + Intergenic
1067170492 10:43902292-43902314 GCCGCCCACAGGCCACTGGGCGG - Intergenic
1067838019 10:49653532-49653554 GCAGCCCAGTGTCCCCTGCGGGG + Intronic
1069438525 10:68407293-68407315 GCAGCCCACAGCGCCCCCGGCGG + Intronic
1070458700 10:76643529-76643551 GCAGACCAAAGGCTCCTGGGAGG + Intergenic
1074577524 10:114684450-114684472 TCAGCCCACAGACTCCTGGGAGG - Intronic
1075709394 10:124522564-124522586 GCCGCCCCCAGTCCCCTGGGCGG + Intronic
1077145136 11:1041237-1041259 GCTGCCCACAGCCCACTGTGTGG + Intergenic
1077289349 11:1781770-1781792 GCAGCTGACAGCCCCCTGGGAGG - Intergenic
1080407869 11:31995847-31995869 GCTGCCCAGAGCTCCTTGGGAGG - Intronic
1081270777 11:41079682-41079704 TCAGCCCATAGGCCACTGGTTGG - Intronic
1083630448 11:64092437-64092459 GCGGCACATAGGCCCCTGGGAGG - Intronic
1083720913 11:64603129-64603151 GCAGCCCCTGGGCCTCTGGGGGG + Intergenic
1083792820 11:64996887-64996909 GCAGCCCATTGCCCCCACAGAGG + Exonic
1084149767 11:67282624-67282646 GGAGCCCATAGCTGCCTTGGTGG + Intronic
1084150464 11:67285746-67285768 GCAGCCCACAGAGCCCAGGGTGG - Exonic
1085521955 11:77144326-77144348 CCTGCCCAGAGCCCCCAGGGTGG + Intronic
1086011059 11:82103987-82104009 GCAGCTCATATCACCCTAGGTGG - Intergenic
1088645613 11:111913932-111913954 GCTGCCCATATCACCTTGGGAGG - Exonic
1090256474 11:125287951-125287973 GCAACCCTCTGCCCCCTGGGTGG - Intronic
1090631610 11:128653970-128653992 GCAGCGCACTGCCTCCTGGGAGG + Intergenic
1092057459 12:5519961-5519983 CCAGCACCAAGCCCCCTGGGCGG + Intronic
1092064104 12:5575248-5575270 CCAGACCATAGCCCCCTTGATGG + Intronic
1095964299 12:47856835-47856857 TCAGCCCATGGCCCCCTCCGTGG - Intronic
1096578686 12:52570618-52570640 GCAGCCCTTCGCTTCCTGGGAGG - Intronic
1100982516 12:100172823-100172845 TCAGCCCAAAGACCCCAGGGAGG + Intergenic
1101993160 12:109504305-109504327 TCAGCCAAATGCCCCCTGGGAGG + Intronic
1102955118 12:117054144-117054166 GCAGCTCTGAGCCACCTGGGAGG - Intronic
1103699817 12:122843221-122843243 GCAGCCCAGGGCCGCCTGGGAGG + Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1105304784 13:19160851-19160873 GCATCCCAGAGCCCCACGGGAGG + Intergenic
1106200208 13:27529743-27529765 GCAGGCCACAGTCCCCAGGGAGG - Intergenic
1111889003 13:94058519-94058541 CCACACCATAGCCCCCTAGGTGG + Intronic
1114657209 14:24323270-24323292 CAAGCCCACAGCCCCCTGAGTGG - Intronic
1116866792 14:50037962-50037984 GCAGCCCAAATGCCCATGGGAGG + Intergenic
1118758744 14:68864676-68864698 GCAGCCCTCAGCCCTCAGGGTGG - Intergenic
1119613333 14:76082183-76082205 CCAGCCCACAGCCCCATGGCTGG + Intronic
1119857566 14:77912272-77912294 GTGGCCCATAGCCCACTGTGGGG - Intronic
1121756585 14:96408103-96408125 ACAGCCCACAGCCCCAGGGGTGG + Intronic
1126139324 15:45424512-45424534 GGAGCCCATAATCCCTTGGGGGG - Intergenic
1127384500 15:58456521-58456543 GCAGCCCAGAGGCCCCTGGAGGG + Intronic
1128061671 15:64739348-64739370 GCAGCCCATAGACTACAGGGTGG + Intergenic
1128358309 15:66943578-66943600 GGAGCCCAGGGCCCCCTGCGGGG + Intergenic
1128799470 15:70488451-70488473 GAATCCCACAGCCACCTGGGAGG + Intergenic
1128898230 15:71395266-71395288 GTAGCCAAGAGCCCTCTGGGAGG + Intronic
1129911560 15:79232010-79232032 TCGGCCCACAGTCCCCTGGGAGG - Intergenic
1130247590 15:82266235-82266257 GCAGCCCATAGGCCGCAGGTTGG + Intronic
1130650748 15:85760770-85760792 GCAGTCCATGCCCCTCTGGGAGG + Exonic
1132615861 16:840824-840846 GCAGCCCCCAGCCCCCTATGCGG - Intergenic
1133540347 16:6746554-6746576 GCAGTCCCTAGCTACCTGGGAGG + Intronic
1136012221 16:27371310-27371332 GCAGCCCGTACCCCCCTGCTCGG + Intergenic
1138443012 16:57046473-57046495 CCAGCCCATATACCCCTAGGAGG - Intronic
1139558391 16:67726961-67726983 CTAGCCCATAGCTACCTGGGTGG - Intronic
1140470053 16:75208909-75208931 GCAGTCCAGAGCACCCTCGGAGG + Intergenic
1141684722 16:85563695-85563717 GCAGCCAAATGCCCACTGGGCGG - Intergenic
1143021667 17:3919877-3919899 ATAGCCCATAGCTGCCTGGGAGG + Intergenic
1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG + Intronic
1147560842 17:41507944-41507966 GAATCCCAGAGCCCTCTGGGAGG + Intergenic
1148086701 17:44997951-44997973 GCAGCCCAGAGGCCCCTGCAGGG + Intergenic
1149895663 17:60426617-60426639 GTGGCCCATATTCCCCTGGGTGG + Intronic
1150425623 17:65074802-65074824 GCAGCTTAGAGCCCCCTGGCTGG + Intergenic
1151946610 17:77323180-77323202 GAAGGCCACAGCCCCCAGGGAGG - Intronic
1152253084 17:79221793-79221815 GCCGCCCATAGCTCTCTGGCTGG + Intronic
1156376399 18:36518972-36518994 GCAGCCTGTAACTCCCTGGGAGG + Intronic
1159917685 18:74201039-74201061 GCTGCCCTAAGCCGCCTGGGAGG + Intergenic
1160750163 19:730195-730217 CCAGCCCACAGCCGCCTGGAGGG - Intronic
1160873729 19:1287926-1287948 GCAGCCCACAGCCCTGTGGCAGG - Intronic
1160938502 19:1609128-1609150 GGAGCCCATGGCTCCCAGGGCGG - Intergenic
1161348121 19:3778031-3778053 GCCGCCCAGAGCCCCCTACGTGG + Exonic
1161816550 19:6502757-6502779 GGAGCCCCCAGCCCACTGGGAGG - Intronic
1162452187 19:10761881-10761903 GCAGCCCATTGGCCCATCGGTGG - Intronic
1162573971 19:11487889-11487911 CCAGCCCATTGCCCACTGTGGGG + Exonic
1164669631 19:30065067-30065089 GCTGCCCACGGCCCCCTGGAGGG - Intergenic
1166046331 19:40233041-40233063 CCAGCCCATAGCCCCCAGTGGGG + Exonic
1167591092 19:50404842-50404864 ACACCCCAGCGCCCCCTGGGAGG - Intronic
925147160 2:1588922-1588944 GCAGCCCACAGCCCACAGAGAGG + Intergenic
925546764 2:5024734-5024756 GCAGCCCTCAGCACCCTGTGAGG - Intergenic
927911947 2:26905907-26905929 GCAGCCCATTGACACCTGGATGG - Intronic
928149251 2:28811136-28811158 TCAGCCCAGAGCCCGCTGCGGGG - Intronic
928167416 2:28981248-28981270 GGAGCCCATAGCTCCCTGCGCGG - Intronic
930095141 2:47561000-47561022 GCAGCAAATAGCCCCATGTGTGG - Intronic
932538046 2:72620142-72620164 GCTGCCCATATCCCTTTGGGAGG - Intronic
937248669 2:120510173-120510195 CCAGCCCACAGCCCCCATGGAGG - Intergenic
937747175 2:125428233-125428255 GGAGCCCATAGCCTCCTCAGTGG + Intergenic
938193012 2:129300133-129300155 GCAGCCCAGATCCCTGTGGGAGG - Intergenic
938343262 2:130549272-130549294 ACAGCCCATGGCCCCCTGTCAGG + Intronic
938346571 2:130571450-130571472 ACAGCCCATGGCCCCCTGTCAGG - Intronic
947590825 2:231384183-231384205 CCAGGCCAGAGCCCCCTGGGTGG - Intergenic
947644232 2:231726494-231726516 ACAGCCCATGCCCACCTGGGTGG + Intergenic
947794534 2:232885692-232885714 TCTCCCCACAGCCCCCTGGGTGG + Intronic
948316269 2:237030613-237030635 GCAGCCCATGGCCCCAAGCGGGG + Intergenic
948613057 2:239181637-239181659 GCGGCCCATAGCACGCTGGCTGG + Intronic
1170571883 20:17637243-17637265 GGAGCCGATGTCCCCCTGGGTGG - Intronic
1172274805 20:33673757-33673779 GCCACCCATGGCCCCATGGGAGG + Intronic
1173181923 20:40812435-40812457 GCAGCTCACTGACCCCTGGGAGG - Intergenic
1173792068 20:45834193-45834215 GGAGGCCATGGCACCCTGGGGGG - Exonic
1174403130 20:50286703-50286725 GCAGCCCTCAGCCCCCTGGCTGG - Intergenic
1176521360 21:7826916-7826938 ACACCCCACATCCCCCTGGGAGG - Intronic
1178655380 21:34456928-34456950 ACACCCCACATCCCCCTGGGAGG - Intergenic
1178950438 21:36981023-36981045 GCAGGCCATACCTCCCTGGGAGG - Intronic
1179112285 21:38457716-38457738 GCAGCACAGAGCCACCTGTGGGG + Intronic
1179637553 21:42723113-42723135 GCAGCCCATAGGCCCCTCCTTGG + Intronic
1179791332 21:43757491-43757513 GGAGCCCATACCCTCCTGTGAGG + Exonic
1179892830 21:44345550-44345572 GGAGCCCAGAGCCTCCAGGGTGG - Intergenic
1179909162 21:44438843-44438865 GCAGCCCAGTGCCCCCTGCTCGG + Intronic
1179994152 21:44966275-44966297 GCAGACCTGTGCCCCCTGGGGGG - Intronic
1180120048 21:45739770-45739792 CCTGCCCATGGCCCTCTGGGTGG + Intronic
1181644666 22:24224918-24224940 GCTGCTCAAAGCCACCTGGGAGG - Intronic
1182246128 22:28959203-28959225 GCAGCCCATGGCTCCCTTTGTGG + Intronic
1182357485 22:29728872-29728894 GGAGCCCATGGCCCTCTGAGAGG - Intronic
1182519538 22:30877648-30877670 GCAGTCCTGAGCCCCCTAGGTGG + Intronic
1183304464 22:37075049-37075071 GCTGCCCACAGCCCCCTTGGTGG + Intronic
1184415386 22:44349176-44349198 ACTGCCCATCGCTCCCTGGGGGG + Intergenic
1184656468 22:45944379-45944401 GCAGCTCACAGGCTCCTGGGAGG - Intronic
1184726570 22:46350787-46350809 GCAGCCCCGAGACCCCTGGAGGG + Intronic
1185008733 22:48301115-48301137 GCCTCCCAGAGCCCCCAGGGTGG + Intergenic
1185314545 22:50173384-50173406 CCAGCCCATAGGCTCCTGGGAGG - Intronic
949406388 3:3719025-3719047 TCTCCACATAGCCCCCTGGGAGG - Intronic
954364596 3:50139295-50139317 GCAGCCCCAAGCCCCCCAGGTGG + Intergenic
954750402 3:52810329-52810351 GCATCCTGTAGCCACCTGGGGGG - Intergenic
955131971 3:56179152-56179174 GCAGCCCATAGACCACTGACTGG + Intronic
958868384 3:99527950-99527972 GAAGCCTATAGCCCCCCTGGAGG + Intergenic
959895913 3:111605743-111605765 ATAGCACATAGCCCCGTGGGAGG - Intronic
960963425 3:123088558-123088580 TCAGTCGAGAGCCCCCTGGGAGG - Intronic
961061328 3:123831656-123831678 GCAGCCGGGAGCCACCTGGGTGG + Exonic
961380271 3:126492307-126492329 GCACCCCACAGCCTTCTGGGTGG - Intronic
961477795 3:127159418-127159440 CCAGCCCATAGGCCACAGGGAGG - Intergenic
961828189 3:129609566-129609588 GCAGCCCCTATACCCCTGGCTGG + Intergenic
963309469 3:143692909-143692931 GCAGCCCATGGACCACTGGTTGG + Intronic
967873592 3:194251633-194251655 CCAGCCCAAGGCCTCCTGGGCGG - Intergenic
967948452 3:194822520-194822542 TCAGGTCCTAGCCCCCTGGGGGG + Intergenic
973888451 4:55346330-55346352 GCGGGCCATGGCTCCCTGGGCGG + Exonic
973980785 4:56306647-56306669 GTTGCCCAAAGTCCCCTGGGGGG - Intronic
980863829 4:138530172-138530194 CCAGACCTTAGGCCCCTGGGTGG - Intergenic
985659803 5:1151441-1151463 GCAGCCCAGAACACTCTGGGAGG - Intergenic
987129254 5:14845648-14845670 GCACCGCCTAGCACCCTGGGTGG - Intronic
988166061 5:27590816-27590838 GCTCCCCATATCCCTCTGGGAGG - Intergenic
995188908 5:109299668-109299690 GCAGCCCAGAGTGCCCTGAGAGG - Intergenic
997199995 5:132004128-132004150 GCAGCCCAGAGCCCCATGTGCGG + Intronic
998392419 5:141795761-141795783 CCAGCCCATGGCCCCCTAGCAGG + Intergenic
999285658 5:150392813-150392835 GCAGCCCATAGGCCTTAGGGTGG + Intronic
1000572751 5:162935580-162935602 GCAGTCCATAGGCCACTGGATGG + Intergenic
1001568201 5:172713996-172714018 GCTGCCCAGAGCCCCCTGGGTGG + Intergenic
1002460669 5:179372048-179372070 CCAGCCCATACCAGCCTGGGTGG - Intergenic
1003505985 6:6740769-6740791 GGAGGCCAGAGCCGCCTGGGTGG - Intergenic
1005999784 6:30955860-30955882 CCAGCCCCCAGCCCCCAGGGAGG + Intergenic
1007203492 6:40130814-40130836 GCAGCCCACAGCCACCTGTTGGG - Intergenic
1012082146 6:94773521-94773543 GCAGTCCATAGCCTCCTGATAGG + Intergenic
1013307482 6:108862976-108862998 GCAGCCCATTGCCCGCTGGAGGG - Intronic
1013463818 6:110400041-110400063 GCAGCCCCAAGCCCCCTGGCTGG + Intronic
1015444951 6:133293024-133293046 GCAAGCCAGAGACCCCTGGGGGG - Intronic
1018101498 6:160445045-160445067 GCAGCCCACAGCCCAGTGGCAGG + Intronic
1019163607 6:170084989-170085011 GCATCCCATGGCCACCTGGAAGG + Intergenic
1019365380 7:630062-630084 GCAGCCCACAGAGCCCTGGGAGG - Intronic
1019509623 7:1411252-1411274 CCTCCCCACAGCCCCCTGGGGGG + Intergenic
1022469690 7:30674641-30674663 GCAGCCCCTTGCCCCCCTGGAGG - Intronic
1024156994 7:46636218-46636240 GCAGCCCATAGCCCACTGCTGGG + Intergenic
1024338066 7:48229462-48229484 GCAGCCCTTTGCACCCTGGCTGG + Intronic
1024342564 7:48282388-48282410 GCTGCCCAGAGCCCCCTCAGTGG + Intronic
1029111431 7:98214739-98214761 GCAGCCCAGGGCTTCCTGGGGGG + Exonic
1033318250 7:140316176-140316198 GCAGCCCATAGGGCCCAGGGAGG + Intronic
1033653228 7:143357320-143357342 GCAGCCCAATGGCTCCTGGGTGG + Exonic
1033707307 7:143902119-143902141 GCTGCCCTTTGCCTCCTGGGCGG - Exonic
1034522799 7:151632986-151633008 GCAGCCGCTAGCCTCCTGGAAGG + Intronic
1035460594 7:159036317-159036339 GTAGCCGATAGCTCCGTGGGTGG - Intronic
1035972847 8:4270771-4270793 GGAAGCCACAGCCCCCTGGGGGG - Intronic
1036210010 8:6834346-6834368 GCAGCCCTTAGCGCCCAGGCTGG + Intronic
1036453503 8:8890169-8890191 GCAAGCCATAACCCCCTTGGTGG - Exonic
1042849640 8:73203712-73203734 GCAGCTGAAAGCTCCCTGGGTGG - Intergenic
1043499642 8:80839802-80839824 GCAGCCCAGAGCCCACAGGCAGG - Intronic
1047658943 8:127011390-127011412 GCAGCCCATACCTGCCTGGCAGG + Intergenic
1047686558 8:127310997-127311019 GCAGCTCATAGTCTGCTGGGAGG - Intergenic
1049502341 8:142974186-142974208 GCAGCCCACAGGCAGCTGGGAGG + Intergenic
1049581470 8:143413075-143413097 GCAGCCCATAGTCCCCAGGCAGG + Intergenic
1049586759 8:143435951-143435973 GAAGCACACAGCACCCTGGGGGG - Intergenic
1052807428 9:33025402-33025424 GCTGCCCCTAGTCCCCTGGCTGG + Intronic
1055799649 9:80021132-80021154 GCAGCCCATAGTTCCCTGGCAGG - Intergenic
1057429558 9:94981060-94981082 GCAGCCATTAGCCCCTAGGGAGG + Intronic
1058803046 9:108563425-108563447 GCATCCCACAGTCTCCTGGGAGG - Intergenic
1059402128 9:114077120-114077142 GCAGCCCACAGCCCCATGTTAGG + Intronic
1060074467 9:120579466-120579488 GCACTCCATTGCCTCCTGGGTGG + Intronic
1060588298 9:124800395-124800417 GAACCCCATAGTCACCTGGGAGG + Intronic
1060643848 9:125261732-125261754 GGAGCCCCTAGCCGCCCGGGCGG + Intergenic
1061001166 9:127903807-127903829 GCAGCCCCCAGCGCCCTGGGTGG - Intronic
1062264886 9:135682417-135682439 GCAGCCCCCAGTCCCCTGAGGGG + Intergenic
1186026968 X:5323885-5323907 GCAGCCCTGAGCCCCCAGGTAGG - Intergenic
1186435500 X:9539574-9539596 GTAGCCCAAAGCCATCTGGGTGG - Intronic
1197728457 X:129791867-129791889 GCAGGGCATAGCTTCCTGGGTGG + Intronic