ID: 1146509081

View in Genome Browser
Species Human (GRCh38)
Location 17:33430272-33430294
Sequence GGTTTTATGGGACCAGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 7, 3: 14, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146509074_1146509081 3 Left 1146509074 17:33430246-33430268 CCACAGGCAGTCTTAACACCTTC 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1146509081 17:33430272-33430294 GGTTTTATGGGACCAGGAGTTGG 0: 1
1: 0
2: 7
3: 14
4: 234
1146509072_1146509081 23 Left 1146509072 17:33430226-33430248 CCTTCTCTTATGAACTGCATCCA 0: 1
1: 0
2: 0
3: 16
4: 146
Right 1146509081 17:33430272-33430294 GGTTTTATGGGACCAGGAGTTGG 0: 1
1: 0
2: 7
3: 14
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146509081 Original CRISPR GGTTTTATGGGACCAGGAGT TGG Intronic
900660892 1:3782871-3782893 GGCTGCATGGGCCCAGGAGTTGG + Intronic
901226248 1:7614348-7614370 GGTTTTGTGTGAGCAGGAGATGG - Intronic
904050312 1:27634636-27634658 GGTCTGATGGGTCCAGGAGAGGG - Intronic
905401853 1:37709296-37709318 GGGTTCATGGGAACAGGGGTGGG + Exonic
906113132 1:43337884-43337906 GGTTTTGAGGGGCCAGGAGGAGG - Exonic
907675497 1:56514294-56514316 GGGTTTAAGGGGGCAGGAGTGGG + Intronic
908246194 1:62229299-62229321 GTTTTTATGGGCCCAGGTCTAGG + Intergenic
909441076 1:75696930-75696952 TGTTTTATGCGATCAGGAGTGGG + Intergenic
910380556 1:86622352-86622374 GGTTTTATGGGATCAAGGGAAGG + Intergenic
913097650 1:115534674-115534696 GTTTTTATGGGTACAGGATTAGG - Intergenic
913973228 1:143432665-143432687 GGTGTTATGGTACCAGGAGTGGG - Intergenic
914067612 1:144258272-144258294 GGTGTTATGGTACCAGGAGTGGG - Intergenic
914111541 1:144708082-144708104 GGTGTTATGGTACCAGGAGTGGG + Intergenic
914995944 1:152543470-152543492 GATTTTATGGGCCCAGGATGTGG - Intronic
915023483 1:152804683-152804705 GGGTTAATGGGGGCAGGAGTGGG - Intronic
915097521 1:153473900-153473922 GGTCTGGTGGGGCCAGGAGTGGG - Intergenic
915531282 1:156503552-156503574 GGTTTTAAAGGGCCAGGAGCAGG + Intergenic
917156626 1:172006820-172006842 GGTTTCTTGGAGCCAGGAGTTGG - Intronic
919315421 1:195966360-195966382 GGTTGTATGGGCCCAGGAGTGGG + Intergenic
920439617 1:205970865-205970887 GGTTATATGGGTTCAGGGGTGGG + Intergenic
921193376 1:212729502-212729524 GGGTGTATGGGACCTGGAGCAGG + Intronic
922076845 1:222253622-222253644 GGTTTTATGGGCACAGGATCAGG - Intergenic
922246051 1:223798628-223798650 GGTTTTGTAGGAACAGGAGGTGG + Exonic
923383833 1:233447283-233447305 GGTTTTATAGGCCCAGGATGGGG + Intergenic
1064288215 10:14011290-14011312 GCTTTGATGTCACCAGGAGTTGG + Intronic
1068067015 10:52144223-52144245 GGATTTATGGGACAAGGAACTGG + Intronic
1068208280 10:53886320-53886342 GGTTTTATTTAACCATGAGTGGG - Intronic
1068755583 10:60648881-60648903 GGTTTTGGGGGAGCAGGAGCAGG - Intronic
1068992743 10:63166479-63166501 GGCTTTAGGGGACCAGCAGGTGG + Intergenic
1069769904 10:70891592-70891614 GGTTTTATAGGCACAGGATTGGG + Intergenic
1074668857 10:115764474-115764496 GGGTTGGTGGGAGCAGGAGTGGG - Intronic
1076233103 10:128838337-128838359 GGTGTTATGGGGCCAGGAAGGGG - Intergenic
1077587145 11:3462458-3462480 GGTTTCTTGAGCCCAGGAGTTGG + Intergenic
1077885669 11:6385897-6385919 GGTTTTGTGGGAGCAAGGGTGGG - Intergenic
1078064930 11:8072109-8072131 GCTGTGATCGGACCAGGAGTCGG + Intronic
1079337989 11:19588219-19588241 GATTTTGTGGGAGCAGGAGGAGG - Intronic
1080239335 11:30108534-30108556 GATTTTATGGGCCCAGGACATGG - Intergenic
1081268893 11:41060288-41060310 GTTTGTATGATACCAGGAGTAGG - Intronic
1081699835 11:45146193-45146215 GGTTAAATGGGACCGGGAGGGGG + Intronic
1082059836 11:47850396-47850418 GGTTTCTTGAGCCCAGGAGTTGG + Intergenic
1083340423 11:61955488-61955510 GGATTTCTGGGACCAGCAGGGGG + Intronic
1084032229 11:66487771-66487793 GGTTGGCTGGGAGCAGGAGTGGG - Intronic
1084243136 11:67836470-67836492 GGTTTCTTGAGCCCAGGAGTTGG + Intergenic
1084829850 11:71760472-71760494 GGTTTCTTGAGCCCAGGAGTTGG - Intergenic
1086061140 11:82701025-82701047 GGGTTTATGGGAGCAGGTGGAGG - Intergenic
1087888777 11:103512446-103512468 GGTTTTCTGGGCCAAAGAGTGGG - Intergenic
1091387047 12:102282-102304 GGATTTCTGGGATCAGCAGTTGG + Intronic
1092095412 12:5838208-5838230 TTTTTACTGGGACCAGGAGTGGG + Intronic
1092413387 12:8271206-8271228 GGTTTCTTGAGCCCAGGAGTTGG + Intergenic
1092521272 12:9275793-9275815 GGTGTGATGGGACCAGCACTAGG + Intergenic
1093503225 12:19836122-19836144 GTTTTTATAGGACCAGGATGGGG - Intergenic
1098002791 12:65962665-65962687 GGGTGTGTGGGACCAGGATTTGG - Intronic
1100666598 12:96760444-96760466 GGTTTCATGGGACTAGGGGTGGG - Intronic
1101217373 12:102597461-102597483 GGTTTTATGGGCACAGGATTAGG + Intergenic
1101379880 12:104205291-104205313 GTTTTTATGGGCACAGGATTGGG + Intergenic
1102037564 12:109780942-109780964 GGTTGTTTGGGACAAGGAGGGGG - Intergenic
1103292393 12:119857522-119857544 GGCTTTATTGGCCCAGGAGCAGG - Exonic
1104844783 12:131841318-131841340 GGTTACATGGGGCCAGGTGTCGG - Intronic
1108005458 13:45941678-45941700 GAATTTATGCAACCAGGAGTAGG - Intergenic
1108903846 13:55446469-55446491 GGTTTTGTGGTTCCTGGAGTTGG + Intergenic
1109927695 13:69167836-69167858 GTTTTTATGGGAACAGGATATGG - Intergenic
1110175815 13:72554124-72554146 GGTTTTATGGGTACAGGACTGGG + Intergenic
1111035403 13:82666327-82666349 GGTCTTATGAGACCTGGAGCAGG - Intergenic
1112090538 13:96078570-96078592 GGTTTTGGGGGCTCAGGAGTCGG + Intergenic
1112929172 13:104713665-104713687 GGTGTTATGGGAGCAGGACAAGG + Intergenic
1115246167 14:31298203-31298225 GTTTCTATGGGTCCAGGATTAGG - Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1118917389 14:70119150-70119172 GGTTTTATGAAACCAGCATTTGG + Intronic
1118922337 14:70160797-70160819 TGTTTTATGGATCCTGGAGTTGG + Intronic
1119409034 14:74417422-74417444 TGGTGTATGTGACCAGGAGTTGG + Intronic
1121929082 14:97955999-97956021 GGTTTTGTGGTGACAGGAGTGGG + Intronic
1202884124 14_KI270722v1_random:88077-88099 GGTTCTCAGGGACCAGGACTGGG - Intergenic
1126302340 15:47211796-47211818 GGTTTTATGTGCCAAGGATTGGG + Intronic
1127631601 15:60832863-60832885 GGTTAGATGGGACGAGGAGAAGG - Intronic
1128888005 15:71305890-71305912 GATTTTCTGGGACCTGGAGTTGG + Intronic
1129056908 15:72826603-72826625 GCCTTTCTGGGAGCAGGAGTGGG + Intergenic
1129670712 15:77606274-77606296 GGATTTATGGGCCCAGGTATAGG + Intergenic
1130978380 15:88794747-88794769 GGTTTCTTGAGCCCAGGAGTTGG - Intergenic
1135096612 16:19569628-19569650 GGTTTTGTGGGTGCAGGAATGGG + Intronic
1137749941 16:50853629-50853651 GGTTTTATGGGCCCAGAGGCAGG + Intergenic
1138552121 16:57753800-57753822 GGGTTCCTGGGACCAGGAGCAGG + Intronic
1139868997 16:70088794-70088816 GCTTTCTTGAGACCAGGAGTTGG - Intergenic
1140805744 16:78530564-78530586 GTTTTTATGGGTACAGGATTGGG + Intronic
1143566116 17:7721797-7721819 GGTTTTATGGGAGTCAGAGTGGG + Intronic
1144498556 17:15765701-15765723 GGGTTGAGGGGACCAGGAGGTGG + Intergenic
1144646315 17:16976378-16976400 GGCCTCAAGGGACCAGGAGTAGG - Intergenic
1145161938 17:20580741-20580763 GGGTTGAGGGGACCAGGAGGTGG + Exonic
1146509081 17:33430272-33430294 GGTTTTATGGGACCAGGAGTTGG + Intronic
1148205787 17:45779012-45779034 GGTCTGATGGGAACAGGAGATGG - Intergenic
1150975481 17:70081308-70081330 GGCTTTATGGGAATAGGAGGTGG + Intronic
1151438318 17:74112269-74112291 AGTTTTATGAGAGCAAGAGTGGG - Intergenic
1154935719 18:21054412-21054434 GGTTTTATTAGAGCAGGAGTTGG - Intronic
1155223160 18:23703766-23703788 GGTTTCATGGCACCAGGGGGTGG - Intronic
1156189948 18:34707231-34707253 GCTTCTATGGGACTAGGATTTGG + Intronic
1156776314 18:40793091-40793113 GATTGCTTGGGACCAGGAGTTGG - Intergenic
1156811817 18:41262131-41262153 GTATTCATGGGACCAGGAGAAGG + Intergenic
1159591366 18:70338786-70338808 GATTTTATGAGACCAAGAGTTGG + Intronic
1159690063 18:71476645-71476667 GGTTTCATGGGTTCATGAGTGGG - Intergenic
1161089294 19:2352157-2352179 GATTTTTTGTGAACAGGAGTGGG + Intronic
1161654011 19:5502344-5502366 GGTTTTATGGGACAGGAATTTGG - Intergenic
1165022851 19:32937926-32937948 GATTTCATGAGCCCAGGAGTTGG - Intronic
1167802177 19:51751229-51751251 AGTTTTATGGGACCAGTAGAGGG - Intronic
1168012563 19:53545229-53545251 GAATTTATGGGTCCAGGAGGAGG - Intronic
1202659542 1_KI270708v1_random:55211-55233 GGTTCTCAGGGACCAGGACTGGG - Intergenic
925094855 2:1189420-1189442 GGTATTATTGAAGCAGGAGTTGG + Intronic
925924293 2:8659367-8659389 TGTTTTATCAGACCAGGAGATGG - Intergenic
926434958 2:12828064-12828086 GGTTTTATGGGCACAGGATGGGG + Intergenic
927674914 2:25098159-25098181 GGTTTTAGGAGTCCAGAAGTAGG - Intronic
928176104 2:29035387-29035409 GGTGGCATGGGACCAGAAGTGGG + Intronic
929790543 2:45019316-45019338 GGTCATATGGGAACTGGAGTAGG - Intergenic
934028435 2:88019433-88019455 GCTTTTATGGGCTCAGAAGTGGG + Intergenic
934177924 2:89593622-89593644 GGTGTTATGGTACCAGGAGTGGG - Intergenic
934288223 2:91667923-91667945 GGTGTTATGGTACCAGGAGTGGG - Intergenic
934992175 2:98929598-98929620 GGCATTCTGGGACCAGGTGTGGG - Intronic
936657598 2:114506180-114506202 GTTTTTATGGGCACAGGATTGGG - Intronic
937328000 2:121003695-121003717 AGATTTGGGGGACCAGGAGTGGG + Intergenic
938496901 2:131802488-131802510 GGTGATATGGGAGCAGGGGTCGG - Intergenic
939197213 2:138988095-138988117 GGTTTTATGGGATAAAGAGAAGG - Intergenic
939500242 2:142975170-142975192 GTTTTTATGGGTACAGGATTTGG - Intronic
940690455 2:156912732-156912754 GGTTTTCTGGGACTGGGGGTGGG - Intergenic
942931586 2:181500561-181500583 GGTACCATGGTACCAGGAGTGGG + Intronic
943137147 2:183928231-183928253 GGTTTTATGGGCAATGGAGTGGG - Intergenic
943532823 2:189107459-189107481 GTTTTTATGGGACCATGTTTTGG + Intronic
943662983 2:190578716-190578738 GGTTTTATTGGTATAGGAGTGGG + Intergenic
944446614 2:199798286-199798308 GGTTTTCTGAGACCAGGTATTGG + Intronic
944677929 2:202049594-202049616 GGTTTTGTGGGAGTGGGAGTGGG - Intergenic
947869762 2:233428100-233428122 GGTGTTAGGGGAACAGGAGTAGG + Intronic
1168895634 20:1321526-1321548 GGTGTTATGGCACCTGGAGAGGG - Intronic
1170464684 20:16611843-16611865 GTTTTTATGTTACCAGAAGTGGG + Intergenic
1172673060 20:36647624-36647646 AGTTGTATGGCAGCAGGAGTGGG - Intergenic
1174500121 20:50978184-50978206 GGTTTAATGGCACCAGAAGTGGG + Intergenic
1176645497 21:9345440-9345462 CGTTTTCAGGGACCAGGACTGGG - Intergenic
1176883651 21:14228853-14228875 AGTTATTTGGTACCAGGAGTGGG + Intergenic
1177255747 21:18660734-18660756 GGTTTTAAGCCACAAGGAGTGGG + Intergenic
1177355251 21:19998723-19998745 GGTGCTATGGGCTCAGGAGTGGG + Intergenic
1177703811 21:24674332-24674354 GGTTTTATGGGCACAGGATGGGG - Intergenic
1178005846 21:28218995-28219017 GGTTTCATGGGTCCAGCAATCGG - Intergenic
1178184779 21:30206983-30207005 GGTTTTAAGGAGCTAGGAGTGGG + Intergenic
1178447335 21:32658233-32658255 GTTTTTATGGGCACAGGATTGGG - Intronic
1180327010 22:11438772-11438794 GGTTCTCAGGGACCAGGACTGGG - Intergenic
1184430063 22:44437438-44437460 GGGCTTGTGGGAGCAGGAGTAGG + Intergenic
1184725549 22:46342997-46343019 GGGCTTATGGGGTCAGGAGTGGG - Intronic
1185112032 22:48905494-48905516 GGATGACTGGGACCAGGAGTGGG - Intergenic
951430558 3:22602200-22602222 GGTTATTTGGGGCCAGAAGTGGG + Intergenic
952082223 3:29773197-29773219 CGTTTCATGGGACAATGAGTAGG - Intronic
952812615 3:37418075-37418097 GGTTGCCTGGGATCAGGAGTGGG - Intronic
953020383 3:39109300-39109322 GTTTTTATGGGACCATAACTAGG - Intronic
957696882 3:83650283-83650305 GGTTGTATGGGCTCATGAGTGGG + Intergenic
957702925 3:83741349-83741371 GGTTATTTGAGTCCAGGAGTTGG + Intergenic
957831519 3:85527297-85527319 GCTTATTTGAGACCAGGAGTTGG + Intronic
961157076 3:124689024-124689046 GGTTTTATTTGACCAGCAGAGGG - Intronic
961890942 3:130129857-130129879 GGTTTCTTGAGCCCAGGAGTTGG + Intergenic
963240796 3:143000640-143000662 CGTTTTATTAGACCAGGTGTGGG - Intronic
964782559 3:160356740-160356762 GGTTACTTGAGACCAGGAGTTGG - Intronic
964786564 3:160401429-160401451 GCTTTTGTGAGTCCAGGAGTTGG + Intronic
966095560 3:176196800-176196822 GTTTTTATGGGTACAGGATTGGG + Intergenic
966680587 3:182637956-182637978 GGGTTTATGGGTCAAGGTGTTGG - Intergenic
1202741391 3_GL000221v1_random:59628-59650 CGTTTTCAGGGACCAGGACTGGG + Intergenic
969751676 4:9116238-9116260 GGTTTCTTGAGCCCAGGAGTTGG - Intergenic
969811589 4:9652537-9652559 GGTTTCTTGAGTCCAGGAGTTGG - Intergenic
969831323 4:9799772-9799794 GGTGTTATGGTACCAGGAGTGGG + Intronic
970050544 4:11909517-11909539 GGTTATTTGAGCCCAGGAGTTGG - Intergenic
970509936 4:16771824-16771846 GGTTACAGGGGAACAGGAGTGGG - Intronic
970660933 4:18284959-18284981 GGCTTTCTGGGACCTGTAGTGGG + Intergenic
970665603 4:18333129-18333151 AGATTTGAGGGACCAGGAGTGGG - Intergenic
972050906 4:34732195-34732217 AGTTTTATGGACCCTGGAGTGGG + Intergenic
972940163 4:44186078-44186100 GTTTTTATAGGCCCAGGATTGGG - Intronic
973101350 4:46275150-46275172 GGTTTAATGAGACCAGAAATAGG - Intronic
973141071 4:46768444-46768466 GTTTTTATGGGAACAGGACAGGG + Intronic
973790343 4:54372395-54372417 GGTTGGAAGGGAGCAGGAGTGGG + Intergenic
974188501 4:58472075-58472097 GGGTTCCTGGGGCCAGGAGTGGG - Intergenic
975455943 4:74589790-74589812 GGCTACATGGGACCAGCAGTAGG - Intergenic
976883630 4:89960661-89960683 GTTTTTATGGGAACAGGATGGGG + Intergenic
979800568 4:124903742-124903764 GTTTTCATGTGGCCAGGAGTTGG - Intergenic
979860127 4:125683022-125683044 GTTTTTATAGGCCCAGGATTGGG + Intergenic
987118076 5:14742242-14742264 GGTCTGCTGGGACCAGGAGCGGG - Intronic
990463745 5:56053199-56053221 GTTTTTATGGGTACAGGATTGGG - Intergenic
992007872 5:72496283-72496305 GGTTTCCTGGGGCCAGGGGTGGG - Intronic
993036216 5:82760588-82760610 GTTTTTATGGGTACAGGATTGGG - Intergenic
996002193 5:118377583-118377605 GGTTTCTTGGAATCAGGAGTGGG - Intergenic
997695805 5:135859754-135859776 GGGTTTGTGGGTCCAGGAGCAGG + Intronic
998693307 5:144612066-144612088 GGTTTTAAAGGACTAGGAATTGG + Intergenic
998704450 5:144742910-144742932 GATTTTATTTTACCAGGAGTTGG - Intergenic
998870808 5:146549903-146549925 GCTTTTGTGGGACCTGGAGCAGG - Intergenic
999636607 5:153629485-153629507 GGTTTCAGGGGAGCAGGAGAAGG - Intronic
1000845941 5:166280403-166280425 GTTTTTATGGGTGCAGAAGTGGG - Intergenic
1001067092 5:168544154-168544176 GGTTGTGTGGGTCCAGGAGCTGG - Intergenic
1001452469 5:171837023-171837045 GATTGTCTGGGCCCAGGAGTTGG + Intergenic
1002475753 5:179464801-179464823 GTTTTTATGGGCCCAGGATGGGG + Intergenic
1006481288 6:34296485-34296507 GGTTGTTTGGGTCCAGGAGGTGG + Intronic
1007410574 6:41658946-41658968 GGATTTATGGGACCATTAGGGGG + Intergenic
1009524697 6:64729064-64729086 GTTTTTATGGGCACAGGATTGGG + Intronic
1010028424 6:71245969-71245991 GTTTTTATGGGCACAGGATTGGG + Intergenic
1011781643 6:90796369-90796391 GGCTTTGTGGGATCAGGAGTAGG + Intergenic
1012855679 6:104498486-104498508 GGTTATATGGCAGCAGGAATTGG - Intergenic
1012932853 6:105334817-105334839 GATCTTAGGGGCCCAGGAGTTGG - Intronic
1013035660 6:106379799-106379821 GATTTTTTGAGGCCAGGAGTTGG - Intergenic
1013561473 6:111309553-111309575 GTTTTTATAGGCCCAGGATTGGG + Intronic
1016569128 6:145492834-145492856 GATTTTATGGGCACAGGATTGGG + Intergenic
1017392943 6:153960662-153960684 GGTTTGATGGGTCCAGGAAAGGG + Intergenic
1018812568 6:167308438-167308460 GGTTTTCTGGGAGCAGCAGGTGG + Intronic
1019102597 6:169643197-169643219 GGTTTTATGGGATTAGAATTAGG + Intronic
1020822448 7:12987791-12987813 GGTTTTAGGAGTCCAGAAGTCGG + Intergenic
1020886436 7:13823954-13823976 GCATTTATGGGATCAGGGGTTGG - Intergenic
1024869658 7:53948392-53948414 GGTTCTCTGGGGACAGGAGTGGG + Intergenic
1026919530 7:74144931-74144953 GTTTTTATGGGCACAGGATTGGG - Intergenic
1030577421 7:111306392-111306414 GAATGTATGGGAACAGGAGTAGG + Intronic
1030912675 7:115271381-115271403 GATTTTATGGGCCCAGGTATGGG + Intergenic
1031258035 7:119481892-119481914 GGTTTTATGGGTACAGGCTTGGG - Intergenic
1033641794 7:143268726-143268748 GGTGTTCTGGCAGCAGGAGTTGG - Intronic
1034330962 7:150281942-150281964 GGTGATATGAGACCGGGAGTTGG - Intronic
1034667082 7:152827911-152827933 GGTGATATGAGACCGGGAGTTGG + Intronic
1035200155 7:157258166-157258188 GATTTCTTGGGCCCAGGAGTTGG - Intronic
1035902035 8:3467240-3467262 AGGTTTATGGTACCAGGAATAGG - Intronic
1036374888 8:8191669-8191691 GGTTTCTTGAGCCCAGGAGTTGG - Intergenic
1036686004 8:10910699-10910721 GGTTTAAAGGGCCCAGGAGGAGG + Intronic
1036854653 8:12231482-12231504 GGTTTCTTGAGCCCAGGAGTTGG + Intergenic
1036876014 8:12473975-12473997 GGTTTCTTGAGCCCAGGAGTTGG + Intergenic
1037366978 8:18133507-18133529 GTTTTTATGGGCACAGGATTGGG + Intergenic
1037427421 8:18771144-18771166 GCTTTTATGGGCACAGGAATGGG + Intronic
1037471696 8:19216777-19216799 AGTTTTCTGGGCCCAGGAGCTGG - Intergenic
1037580208 8:20240806-20240828 GGTTGCTTGAGACCAGGAGTTGG - Intergenic
1037878738 8:22562238-22562260 GGTCTTATGAGACCGGGAGTGGG + Intronic
1038516539 8:28192285-28192307 CGTTTTAGGGGAACAGGCGTTGG - Intergenic
1039144243 8:34427892-34427914 GGTTGTAGGGGAACAAGAGTAGG - Intergenic
1039390047 8:37172115-37172137 GGTTTTATAGGAACAGGATGGGG + Intergenic
1040831421 8:51681396-51681418 GATTCTGTGGGACCAGAAGTGGG - Intronic
1046870202 8:119197355-119197377 GTTTTTATAGGTCCAGGATTGGG + Intronic
1046955785 8:120061636-120061658 GGTTTTTTGGGTTCAGGAGTAGG - Intronic
1047202126 8:122776091-122776113 GTTTTTATAGGACCAGGATGAGG + Intergenic
1050534504 9:6619963-6619985 GATTTTATGGGACTGGAAGTGGG + Intronic
1051246560 9:15117786-15117808 GGTGTTATGGGGCAAAGAGTGGG - Intergenic
1052935219 9:34087401-34087423 GGTTTTAAGGGGCCTGGAGCTGG - Exonic
1053600070 9:39601871-39601893 GCTTTTATGGGCTCAGAAGTGGG - Intergenic
1053857721 9:42355727-42355749 GCTTTTATGGGCTCAGAAGTGGG - Intergenic
1054253455 9:62740513-62740535 GCTTTTATGGGCTCAGAAGTGGG + Intergenic
1054567573 9:66775012-66775034 GCTTTTATGGGCTCAGAAGTGGG + Intergenic
1055926298 9:81513707-81513729 GGTTTTATGGAACTCAGAGTTGG + Intergenic
1056149171 9:83767184-83767206 GGATATATGGGACCAGGAAGAGG - Intronic
1058609705 9:106762385-106762407 GGTTTCCTGGGCCCAAGAGTAGG + Intergenic
1058839054 9:108887940-108887962 GTCTTTATGGGGACAGGAGTAGG - Intronic
1059685717 9:116633750-116633772 GCTTCTATGGGACTATGAGTGGG + Intronic
1061008131 9:127939921-127939943 GGTTTAAAGGGGCCATGAGTCGG + Intergenic
1061205760 9:129162356-129162378 GGGTTGAAGGGACCAGGAGAAGG + Intergenic
1203710029 Un_KI270742v1:89552-89574 CGTTTTCAGGGACCAGGACTGGG + Intergenic
1187599123 X:20807178-20807200 GGTTTTAGGTAACAAGGAGTTGG - Intergenic
1188182377 X:27072410-27072432 GTTTTTATGGGCACAGGATTGGG - Intergenic
1189238775 X:39509328-39509350 TTTTTTTTGGTACCAGGAGTGGG + Intergenic
1190334229 X:49252818-49252840 TATTTTATGGGTCCAGGAGAGGG + Intronic
1191800915 X:65078158-65078180 GGTTTGATGGGACTAGGGCTGGG + Intergenic
1192291630 X:69802685-69802707 GCTTTTATGACACCAGAAGTTGG + Intronic
1196072263 X:111539105-111539127 GTTTTTATGGGCCCAGGATAGGG - Intergenic
1196369187 X:114956801-114956823 GGTTTTGTGGGAACATGAGGAGG - Intergenic
1196618021 X:117789906-117789928 GGTTTTGTTGTAGCAGGAGTTGG - Intergenic
1199371597 X:147056212-147056234 GGGATCATGGGACCAGGAGTTGG + Intergenic
1199554363 X:149090449-149090471 AGTTTTATGGGCCCTGGAATGGG + Intergenic