ID: 1146511768

View in Genome Browser
Species Human (GRCh38)
Location 17:33455763-33455785
Sequence CTCAAAAGCCCCAGATAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146511762_1146511768 27 Left 1146511762 17:33455713-33455735 CCAAAGGCTAAAGAACAGTGAAA 0: 1
1: 0
2: 0
3: 30
4: 280
Right 1146511768 17:33455763-33455785 CTCAAAAGCCCCAGATAGCCGGG 0: 1
1: 0
2: 0
3: 12
4: 147
1146511761_1146511768 28 Left 1146511761 17:33455712-33455734 CCCAAAGGCTAAAGAACAGTGAA 0: 1
1: 0
2: 1
3: 21
4: 284
Right 1146511768 17:33455763-33455785 CTCAAAAGCCCCAGATAGCCGGG 0: 1
1: 0
2: 0
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146511768 Original CRISPR CTCAAAAGCCCCAGATAGCC GGG Intronic
900986085 1:6073472-6073494 TTCAAAAGCCCCAGACCTCCTGG + Intronic
902612230 1:17603888-17603910 CCCAACAGCCCCAGAAAGCCTGG - Intronic
904084555 1:27895810-27895832 CTCCAAAGCCCCATATAATCTGG + Intronic
905772178 1:40645526-40645548 CTCAAAGGGCCCAGAGACCCAGG - Intronic
906492888 1:46281781-46281803 GTCAAGAGTCCCAGCTAGCCGGG + Intronic
913371442 1:118103994-118104016 CTCCAAAGCCCTGGATGGCCTGG - Intronic
914087369 1:144465258-144465280 CTCAAGACCCACAGAAAGCCAGG + Intergenic
914193148 1:145428230-145428252 CTCAAGACCCACAGAAAGCCAGG + Intergenic
914311242 1:146468945-146468967 CTCAAGACCCACAGAAAGCCAGG - Intergenic
915956972 1:160229002-160229024 CTCAAAATCTTCACATAGCCAGG + Intronic
922552068 1:226502422-226502444 TTCAAAAGTCCCAGATATTCTGG + Intergenic
923997601 1:239512869-239512891 CCCAAAACCCACAGATAACCTGG - Intronic
924071286 1:240282660-240282682 CTCAAAGGCCCCAGGTTTCCAGG + Intronic
1063251282 10:4278071-4278093 ATCAAAAGCCCCAGAAAGACTGG + Intergenic
1068454314 10:57235409-57235431 ATCAAAAGACCAAGATAACCAGG - Intergenic
1068912638 10:62395194-62395216 CTCTATAGCCACAGATACCCTGG + Intronic
1069551506 10:69367480-69367502 CTCCAAAGCCTCAGAGAACCAGG - Intronic
1071482119 10:86072627-86072649 CTCAAAAGCCCAAGGGAGCTCGG + Intronic
1071946893 10:90656034-90656056 ATCAGAAGCCCAATATAGCCAGG + Intergenic
1072328388 10:94321335-94321357 CTCAAAATCCACAGCTAGGCGGG + Intronic
1073516408 10:104079305-104079327 AACAAAAGCCCCAGATAGGTAGG - Intronic
1074389939 10:113048710-113048732 CACAAAAGCTCCAGAAAGTCAGG + Intronic
1074452711 10:113572095-113572117 CTCAGTGGCCCCAGGTAGCCAGG - Intronic
1074832820 10:117261737-117261759 CTAAAAAGTCCCAAATGGCCGGG + Intronic
1076884451 10:133255374-133255396 CTCAGCAGCCCCAGTTAGGCTGG + Intergenic
1079064813 11:17280448-17280470 TTCAAAGGCCACAGATAACCTGG - Intronic
1081582224 11:44360206-44360228 CCCAAAAGGCCCAGATACCTCGG + Intergenic
1082611641 11:55306002-55306024 CACATAAGCCTCAGCTAGCCAGG - Intergenic
1083710224 11:64543431-64543453 TTCAAAAGCCCCATCTAACCGGG - Intergenic
1084145791 11:67264731-67264753 CTCAGTAGCCCCAGAAGGCCTGG + Intergenic
1089247752 11:117134879-117134901 CTCAAAAGAAGCATATAGCCAGG - Intergenic
1089258963 11:117209682-117209704 CTCAAAAGAAGCATATAGCCAGG + Intronic
1091120837 11:133056094-133056116 CTCAAAAGGCCCAGTTATCATGG + Intronic
1091940092 12:4471689-4471711 CACAGAAGCCCCAGGTAGGCTGG - Intergenic
1093261941 12:16949804-16949826 CACAAAAGCCCCATAAAGACAGG + Intergenic
1095966137 12:47868360-47868382 CTAAGGAGCCCCTGATAGCCTGG - Intronic
1096769420 12:53925061-53925083 CTCAAAAGTGCCAGAGAGGCTGG + Intergenic
1098865855 12:75762516-75762538 CTCAAAAGGCCAAGCCAGCCTGG + Intergenic
1100009962 12:89941073-89941095 CTAGAAAGCCCCAGATGACCAGG - Intergenic
1101181245 12:102220369-102220391 CTCTGAAGCCCCAAATAGTCCGG - Intergenic
1101648131 12:106650435-106650457 CTCAAAAGTCAAAGATGGCCAGG + Intronic
1108427975 13:50324580-50324602 CTCCAAAGCCCTACATAGTCTGG + Intronic
1111574150 13:90128275-90128297 CTCAATATTCCCAGATAACCTGG + Intergenic
1112191209 13:97179656-97179678 CGCAAAAGGCCCAGAGAGTCAGG - Intergenic
1117499733 14:56339771-56339793 CTCATAAGCCCCACATAGAAGGG - Intergenic
1124596775 15:31097783-31097805 CGCAACAGCCCCAGGTAGCCAGG - Intronic
1124961989 15:34405546-34405568 TTATAAAGCCCCAGATAGGCTGG - Intronic
1124978612 15:34551767-34551789 TTATAAAGCCCCAGATAGGCTGG - Intronic
1125350943 15:38767025-38767047 TTCAAAAGCCAAAGATAGCAGGG + Intergenic
1125625806 15:41108291-41108313 TTGAAAAGCCACAGATAGGCCGG + Intronic
1126757348 15:51937504-51937526 GTCAAAAGCCACAGATCACCAGG + Intronic
1126807857 15:52370815-52370837 CTCAAAATCCCAAGTTGGCCAGG + Intronic
1129275993 15:74445748-74445770 CTCCAAAGCCCCAGAGAGTCTGG + Intergenic
1130159641 15:81385715-81385737 CTCACAGGCCCCCGACAGCCGGG - Intergenic
1130540927 15:84820315-84820337 CCTAAAAGCCCTAGACAGCCTGG - Intronic
1133028014 16:2997049-2997071 TTCATAACCCCCAAATAGCCTGG - Intergenic
1133641358 16:7720497-7720519 CTCAAAAGCCACATCTGGCCAGG + Intergenic
1134740706 16:16541328-16541350 CTCTGAAGCACCAGATAGTCAGG - Intergenic
1134926797 16:18170852-18170874 CTCTGAAGCACCAGATAGTCAGG + Intergenic
1135157670 16:20067310-20067332 CTCAAAGGCCCAGGAGAGCCAGG - Intronic
1136420886 16:30132160-30132182 CTTAAATGCCACAGATGGCCTGG + Intergenic
1140160434 16:72485689-72485711 CTCAAAAGCACCCCTTAGCCTGG - Intergenic
1140846169 16:78890422-78890444 CTCAGAAGGCCCAGATAGGGTGG - Intronic
1141334494 16:83141992-83142014 CTGAAAAGCCCCAGAAAGTGGGG + Intronic
1141474295 16:84262059-84262081 CTTAAAAGTCACAGAGAGCCCGG - Intergenic
1141477150 16:84281630-84281652 CACAAAAGCCTAAGAAAGCCTGG - Intergenic
1141509160 16:84501485-84501507 CTCACCAACCCCAGACAGCCGGG + Intronic
1142643715 17:1299319-1299341 CGCAAACGCCCCTGACAGCCTGG - Exonic
1143749378 17:9017306-9017328 CTCCACAACCCCAGACAGCCTGG + Intergenic
1144723609 17:17489297-17489319 CTGAAAACCCCCAAATAGCAAGG - Intronic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1146511768 17:33455763-33455785 CTCAAAAGCCCCAGATAGCCGGG + Intronic
1148656119 17:49285130-49285152 CTCAAAAGCCTATGATAACCGGG + Intergenic
1149237795 17:54613070-54613092 CCCAACAGCCCCAGAAATCCAGG + Intergenic
1149258030 17:54849280-54849302 CTCTAAAGCCCCATCTACCCAGG + Intergenic
1151237032 17:72728149-72728171 CTGAAAAGGGTCAGATAGCCAGG + Intronic
1152015777 17:77749450-77749472 AGGAAAAGCCCCAGATGGCCTGG - Intergenic
1155174922 18:23293547-23293569 CTCCAAAGCCATAGATGGCCAGG + Intronic
1156630228 18:38958762-38958784 CTCAAAAGCCACAAAAAGACGGG - Intergenic
1158964589 18:62611663-62611685 CTCTAAAGCCACAGAGACCCGGG + Intergenic
1160511451 18:79455678-79455700 CTGAGAAACCCCAGACAGCCAGG + Intronic
1161436349 19:4265892-4265914 GTCAAAAGGCACAGATGGCCAGG - Intronic
1163448290 19:17360595-17360617 CTCCACAGACCCAGCTAGCCTGG - Exonic
925015849 2:523651-523673 CTCAACAGCCCCAGAGACCAGGG + Intergenic
925190231 2:1876489-1876511 CTCAGGAGCCCCAGATGGACGGG - Intronic
925487498 2:4351880-4351902 ATCAACAGCCCCAGATAACGTGG - Intergenic
926052740 2:9755182-9755204 CTCAGAAGCACCAGGGAGCCTGG - Intergenic
929163490 2:38857119-38857141 CTCAATAGCCACATGTAGCCAGG - Intronic
935302743 2:101707511-101707533 CTCAAAAGACACAGACAGACAGG - Intronic
936374650 2:111930196-111930218 TTAAAAAGCCCCACATGGCCAGG - Intronic
937048301 2:118864858-118864880 CTCAACAGCCCCAGATAGTGAGG - Intergenic
937584425 2:123529154-123529176 CTCAAAGGTCACAGAAAGCCAGG - Intergenic
939143232 2:138379748-138379770 CCAAACAGCCCCAGATAGGCGGG + Intergenic
941079117 2:161040153-161040175 CTAAAAACCTCCAGATAGACAGG - Intergenic
945949799 2:216028217-216028239 CTCAAAATACCCAGATAGGCCGG + Intronic
946981487 2:225220948-225220970 CTCAAAAGGCACAGTTATCCTGG + Intergenic
947534467 2:230932026-230932048 CTCACCATCCCCAGACAGCCTGG + Intronic
948629293 2:239291828-239291850 CTCAAGAGTCCCAGCTAGCTGGG + Intronic
1168995558 20:2130232-2130254 CTCAGAAGACCCAGATAAACGGG - Intronic
1175366940 20:58461999-58462021 CTAAAAAGCCCTAGAAAGCCGGG + Intronic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1178186197 21:30224001-30224023 CTCAAAAGCTCCAGGAAGTCAGG + Intergenic
1181562109 22:23711267-23711289 CTCAAAAGTCCCAGCTACTCGGG + Intergenic
1181628053 22:24134660-24134682 CTCCAAAGCCCCAGGTATTCTGG + Intronic
1183455681 22:37921992-37922014 CTCATAAGCCCCAGGGAGCAGGG - Exonic
1183955208 22:41375926-41375948 CGCAAAAGACACAGATAACCGGG + Intronic
951503022 3:23411501-23411523 CTCAATAACCCAAGATAGACAGG - Intronic
954090632 3:48281235-48281257 CTCAAAAGCCCCACTTGGCTGGG + Intronic
955908320 3:63831254-63831276 CTCAGAAGCATCAGAGAGCCAGG + Intronic
958143841 3:89598754-89598776 ATAAGAAGCCCCAGATAGGCAGG + Intergenic
960922090 3:122757384-122757406 CTCAAAAGACCCAGATGGGAAGG - Intronic
960949988 3:122993008-122993030 CTCATCAGCCCCAGGAAGCCCGG - Intronic
961226476 3:125253224-125253246 CTTAAAAGGATCAGATAGCCAGG - Intronic
964931646 3:162032070-162032092 TTCAAATGCCCCAGTTTGCCAGG + Intergenic
968423995 4:509203-509225 CTCAACAGTTCCAGATATCCAGG - Intronic
968967322 4:3775719-3775741 CCCAAAAGCTCCAGCTGGCCTGG + Intergenic
972350614 4:38232950-38232972 TGCAAAAACCCCAGATACCCAGG - Intergenic
978582750 4:110248449-110248471 GTCAAAACCCCTAGATAGGCCGG - Intergenic
990982818 5:61617046-61617068 CCCCAAAGCCCCAGCTATCCAGG + Intergenic
996155113 5:120089712-120089734 ATCAAAAGCCCCAAATGGCTTGG + Intergenic
996190227 5:120531399-120531421 CTGCAAAGCCCCAGACAGCCAGG + Intronic
997010850 5:129875546-129875568 CCCAAAAGTCCTAGAGAGCCAGG - Intergenic
999473317 5:151875467-151875489 ATCAAAAGCCCCTTATAGCCAGG - Intronic
999725369 5:154432559-154432581 CTCAAAAGTGCCATATAGCAGGG + Intergenic
999851053 5:155539662-155539684 CTCAAGAGCCACACATAACCAGG - Intergenic
1000193448 5:158935963-158935985 CTCAATAGCCCAAGATAGACTGG + Intronic
1000234831 5:159347718-159347740 CTCAGAAGTTCCAAATAGCCTGG - Intergenic
1004322686 6:14644973-14644995 CTTAAAAGTCCCAGATACTCTGG - Intergenic
1007781856 6:44258965-44258987 CCCCAAAGCCCCAGGTATCCTGG - Exonic
1008133102 6:47740429-47740451 CTCAAAAGCCCCAAACTGCAAGG - Intergenic
1009460670 6:63909067-63909089 CTGAAAAGGCCCATAGAGCCAGG + Intronic
1013192985 6:107819569-107819591 CTCAAAAGGCTAAGACAGCCTGG + Intronic
1014169605 6:118264373-118264395 CTCAAATGCCCCAGAAACACTGG + Intronic
1021614867 7:22492023-22492045 CTCAAAAGCCATAGGTAGGCCGG + Intronic
1023375832 7:39554034-39554056 CTCAAAAGCCTCAGGCTGCCAGG + Intergenic
1023820791 7:43979510-43979532 CTCACAGGCCCCAGAGAACCTGG + Intergenic
1024188225 7:46976591-46976613 CTCAATAGCCCCAGGTGGCCAGG - Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1026923514 7:74173749-74173771 CTCAAAACCCCCCAATACCCAGG + Intergenic
1028379508 7:90182988-90183010 CTCAAAAGCCATAGGTAGGCCGG - Intronic
1028699868 7:93765050-93765072 GTCAGAAGTTCCAGATAGCCTGG + Intronic
1030237579 7:107282806-107282828 CTAAAAAGCCACAGGTGGCCAGG - Intronic
1034393831 7:150804965-150804987 TTCAACAGCCCCAGTTATCCTGG + Exonic
1036424617 8:8632263-8632285 GTCAAAACCTCCAGATAACCTGG + Intergenic
1037493782 8:19419884-19419906 CCCATAATCCCCAGATATCCTGG + Intronic
1039810819 8:41046906-41046928 GTTAAAATCCCCAGATACCCAGG - Intergenic
1040574701 8:48641649-48641671 GTTAAAAGCCCCAGATTCCCAGG + Intergenic
1040875747 8:52150028-52150050 CTTAAAAGCCCCACATGGCTAGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042924452 8:73953006-73953028 ATCAAAACCACCAGATAGGCTGG + Intronic
1044297115 8:90541637-90541659 ATAAAAAGCCCGAGAAAGCCTGG + Intergenic
1045095634 8:98794904-98794926 CTAAAAAACCCAAGTTAGCCAGG + Intronic
1049535103 8:143176155-143176177 ATAAAATGCCCCAGATAGGCTGG - Intergenic
1049981099 9:904647-904669 CTCAAAAGACCCATGTGGCCGGG + Intronic
1057777352 9:98021752-98021774 CGCATTAGCCCCAGACAGCCTGG + Intergenic
1060096358 9:120793831-120793853 CGCAAAAGCCCCTGACCGCCTGG + Intergenic
1062652601 9:137585926-137585948 CCCAAAAGCCCCAGGGCGCCAGG + Intronic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1192205004 X:69089753-69089775 CTCTAAAGCCACAGACAGGCTGG + Intergenic
1194989976 X:100536926-100536948 CTCATTAGCCCCAGATAGCTAGG + Intergenic