ID: 1146512008

View in Genome Browser
Species Human (GRCh38)
Location 17:33458020-33458042
Sequence AAGGGGATTCTGATTCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146512008 Original CRISPR AAGGGGATTCTGATTCTGAC AGG Intronic
903828411 1:26161000-26161022 AAGGGGAATATGTTTCTGAGTGG + Intronic
905241168 1:36582493-36582515 AAGGGGCTGCTGCTTCTGCCAGG + Intergenic
910678041 1:89834681-89834703 AAGGAGAGACTGATTTTGACTGG + Intronic
913672426 1:121110231-121110253 AATGGGATTGTGTTTATGACAGG - Intergenic
914662682 1:149805622-149805644 AATGGGATTGTGTTTATGACAGG - Intronic
919248465 1:195019947-195019969 AAGGGGGTTCTGATGGTGGCAGG + Intergenic
921715141 1:218410031-218410053 AAGGGGATTCTGATTTTCCCTGG + Intronic
922480428 1:225936896-225936918 ACCTGGATTCTGGTTCTGACAGG - Exonic
1063665210 10:8056516-8056538 AATGGAATTCTGATGCTGAAGGG + Intronic
1065445027 10:25789275-25789297 AAGAGGAGACTGACTCTGACTGG + Intergenic
1066317341 10:34260909-34260931 AACCGGATTCTGATTTTAACGGG + Intronic
1066591305 10:36997671-36997693 AAGGGTATTCTGACGCTGAGTGG + Intergenic
1067658089 10:48212363-48212385 AAGGCTTTTCTGATTCTCACAGG + Intronic
1070697980 10:78577185-78577207 ATGGGGATTCTAATTCCTACTGG - Intergenic
1071851957 10:89581742-89581764 AACAGGATACTGACTCTGACAGG - Exonic
1071953291 10:90729088-90729110 ACTGGGATTCTGTTTCTTACAGG - Intergenic
1075594756 10:123720874-123720896 AAGGCGATTCTGAAACGGACAGG + Intronic
1076020216 10:127066238-127066260 AAGGGAATTCCGAGGCTGACTGG - Intronic
1077796966 11:5502370-5502392 AAGAGAATCCTGATTTTGACTGG - Intronic
1081655637 11:44855721-44855743 GGGGGGATACTGAGTCTGACAGG - Intronic
1081742566 11:45450741-45450763 GAGTGGATTCTGATCATGACAGG - Intergenic
1084988153 11:72896274-72896296 AAGTGTATTCTCATTCCGACTGG + Intronic
1086893719 11:92288471-92288493 AAGGGGACTCAGGTACTGACTGG - Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1095264092 12:40133264-40133286 AAGGGGATTCTGTAACTGACTGG + Intergenic
1096439523 12:51628539-51628561 AAGAGGATTCTTATTCTGTAGGG + Intronic
1096866162 12:54564751-54564773 AAGGTGATTCTGATGCTGGTGGG + Intronic
1101061422 12:100976526-100976548 AAGGTGATTCTGATGCTGGCTGG - Intronic
1102204545 12:111081595-111081617 AAGGAGATTCTGATTCTGACTGG + Intronic
1102657370 12:114493830-114493852 AAGGGAGTTCTGAATCAGACTGG - Intergenic
1105223579 13:18357304-18357326 AAGGGCCTTCTGATTCCCACAGG - Intergenic
1105580506 13:21691588-21691610 GAGGGGCTGCTGATGCTGACAGG - Intronic
1112185163 13:97120981-97121003 ACTGGGATTCTGATTCTCTCTGG - Intergenic
1117194669 14:53327878-53327900 AGGCTGATTCTGATTCTGGCTGG + Intergenic
1120908814 14:89646231-89646253 AAAGGGATTCTGACTCTGTCAGG - Intergenic
1123100122 14:105791963-105791985 AAGGGGATGCTGATGCTAAGTGG + Intergenic
1124601647 15:31137539-31137561 AATGGGATTATTATTCTAACAGG + Intronic
1125153312 15:36558766-36558788 AAGGGGATTGGGTTTCTAACTGG + Intergenic
1125929280 15:43589006-43589028 AAGGGCAGTCTTACTCTGACAGG + Intronic
1125942447 15:43688838-43688860 AAGGGCAGTCTTACTCTGACAGG + Intergenic
1126186913 15:45839638-45839660 AATGGGATTCTCAGTCTGAAAGG - Intergenic
1128896594 15:71379278-71379300 AAGGGGATTCTGGTTCTCTTAGG + Intronic
1130103562 15:80912320-80912342 AAGGGTCTTCTGGTTCTGAGAGG - Intronic
1134588926 16:15435821-15435843 AACTGTGTTCTGATTCTGACGGG + Intronic
1141213637 16:82004207-82004229 GTGGGGAGACTGATTCTGACAGG + Intronic
1142270468 16:89086481-89086503 AAGGCCATTCTGATTCTTGCGGG - Intergenic
1146512008 17:33458020-33458042 AAGGGGATTCTGATTCTGACAGG + Intronic
1146695074 17:34902781-34902803 AAGGGAATTCTGATTCTGCTTGG - Intergenic
1146704647 17:34992117-34992139 AGGGGGATTCAAATCCTGACTGG - Intronic
1148744011 17:49908415-49908437 AAGGGGCTTGTGATTCTGCAGGG + Intergenic
1150864837 17:68838885-68838907 AATGGGATTCTGATTAGGAAAGG - Intergenic
1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG + Intronic
1154327230 18:13400373-13400395 AAGGGATTTCTGTTTCTGGCAGG + Intronic
1158039926 18:53080777-53080799 AAGGAGCTTTTGATGCTGACTGG + Intronic
1158873133 18:61708273-61708295 AAGGGAATTCAAATTTTGACAGG + Intergenic
1160565720 18:79785640-79785662 AAGGAGAATGTGATCCTGACAGG - Intergenic
1162832651 19:13296491-13296513 AAGAGGATGCTGGTTCTGAATGG + Intronic
1165531934 19:36410269-36410291 TGGATGATTCTGATTCTGACTGG - Intronic
1165996246 19:39846135-39846157 AGGGGGATTCTGATTCCAGCAGG - Intronic
1166234750 19:41447446-41447468 AAGGCGATGTTGCTTCTGACTGG - Intergenic
1166793870 19:45414586-45414608 ACGGGGCTTCTGAGCCTGACGGG + Intronic
1167886120 19:52501361-52501383 GCAGGGATTCTTATTCTGACGGG + Intronic
1167888100 19:52518459-52518481 GCAGGGATTCTTATTCTGACGGG + Intergenic
1167912608 19:52716355-52716377 GCAGGGATTCTTATTCTGACGGG - Intronic
1167922320 19:52792019-52792041 GCAGGGATTCTTATTCTGACGGG - Intronic
931217292 2:60258062-60258084 AATGTGATACTGATTCTGATAGG - Intergenic
933761971 2:85678789-85678811 AAAGAGAAGCTGATTCTGACTGG + Intergenic
934564366 2:95330226-95330248 CAGGGGAGGCTGATTCTGAATGG + Intronic
935194879 2:100807335-100807357 CAGGTGATTCTGGTGCTGACCGG + Intergenic
936237364 2:110754467-110754489 ATGGGGATTCTGATTCTGAAGGG - Intronic
936348359 2:111692248-111692270 AAGGGGACTCTGGCTCTGGCAGG - Intergenic
936382178 2:111995981-111996003 AATGAGATTCTGATTCTAAAGGG + Intronic
936825482 2:116576701-116576723 AGGGGCCTTATGATTCTGACAGG + Intergenic
939952867 2:148496215-148496237 AAGGAGATTCTGGTGCTGACAGG - Intronic
943024392 2:182609745-182609767 AATGGGAATCTGATTGTGTCTGG - Intergenic
943904318 2:193478220-193478242 AACGGTATTCTGATTCTTAATGG + Intergenic
948134274 2:235624639-235624661 GAGGAGATTCTGATTTTGCCAGG + Intronic
1169501821 20:6167979-6168001 AGGAGGTTTCTGATTCTGAAAGG - Intergenic
1170635738 20:18102604-18102626 GAGGGGATTGTGATTCTAAGGGG + Intergenic
1173319416 20:41974203-41974225 CAGGGGATTCTGGTTTTGTCTGG - Intergenic
1175740197 20:61414713-61414735 ATCGGAATTCTGATTCTGAGAGG - Intronic
1176732121 21:10509684-10509706 AAGGGCCTTCTGATTCCCACAGG - Intergenic
1178451181 21:32702389-32702411 TAGGGAAATCTGATTCTGAAAGG + Intronic
1184306055 22:43602645-43602667 CAGGGGTTCCTCATTCTGACAGG + Intronic
950950477 3:16993075-16993097 AGGGGTATTCTCATCCTGACTGG - Intronic
951254642 3:20433907-20433929 AATGGGATTGTGTTCCTGACTGG + Intergenic
951527263 3:23665372-23665394 AAGGGGATTCTGATGCAGGTAGG + Intergenic
951656256 3:25011956-25011978 AAAGGGATTCTGATATTAACAGG + Intergenic
956239514 3:67114052-67114074 AAGCTGAGCCTGATTCTGACAGG + Intergenic
958856837 3:99395472-99395494 AAGGGAATTCTAATCCTGAAAGG - Intergenic
961957571 3:130819585-130819607 AAGTGGATCCTGATTCTTACAGG - Intergenic
962107219 3:132403495-132403517 TAGAGGTTTCTGATCCTGACTGG + Intergenic
963332885 3:143935503-143935525 AAGTGGCTTCTGATGATGACTGG - Intergenic
963806389 3:149727185-149727207 AAGAGCAATCTTATTCTGACTGG - Intronic
968657942 4:1786700-1786722 AGGTGGCTTCTGTTTCTGACAGG + Intergenic
969921011 4:10539828-10539850 AAGGGGATTCAGATTATTCCAGG - Intronic
973064472 4:45771241-45771263 AATGTGATTCTGAATCTGGCAGG - Intergenic
973698760 4:53516478-53516500 AAGGGGCTACTGATTCTGCTTGG + Intronic
976280453 4:83321724-83321746 CAGGGGATTCTGATATTGAAAGG - Intronic
976906288 4:90240317-90240339 GAGGGAATTCTGACTCTGATGGG + Intronic
989332869 5:40280525-40280547 AAGAAGATTCTGATTCTTAAAGG - Intergenic
991339107 5:65585996-65586018 AAGGGCTTTATGATTCAGACTGG + Exonic
1001451329 5:171826938-171826960 ATGGGGATTCAGAGTCTGAGTGG + Intergenic
1004428558 6:15523182-15523204 GAGGGTAATCTCATTCTGACAGG + Exonic
1006633450 6:35445832-35445854 GAGAGGCTTCTAATTCTGACTGG + Intergenic
1008020900 6:46576005-46576027 TAGTGGCTTCTGATTCTGATGGG + Intronic
1009961118 6:70522384-70522406 AAGGGAAGTTTAATTCTGACGGG + Intronic
1010205384 6:73318010-73318032 AAGAGAATTCAGACTCTGACAGG + Intergenic
1011940246 6:92834045-92834067 AAGAGCATTCTTATGCTGACAGG - Intergenic
1012880602 6:104783353-104783375 AAGAGGATTCTAATTCAGTCTGG - Intronic
1015009303 6:128324816-128324838 AAGGGAATTTTGTTTCAGACAGG - Intronic
1015707522 6:136104194-136104216 AGGGGCATTCTGATTTTGAAAGG - Intronic
1016851053 6:148619513-148619535 AAAGGGATTTTTATTCTGATGGG - Intergenic
1021159568 7:17255325-17255347 GAGGGGATTCTGGATCTGAGGGG + Intergenic
1023966443 7:44965357-44965379 AAGGGGATTCTGCATCTGAGCGG - Intronic
1024687034 7:51757375-51757397 CAGGGGATTCTGATGCTTGCTGG - Intergenic
1028450149 7:90973113-90973135 AAGCTGTTTCTGATTCTGACAGG - Intronic
1028460668 7:91088259-91088281 AAGGGGATTCTGAAAGTAACTGG + Intronic
1034597462 7:152211719-152211741 AAGGGCCTTCTGATTCCCACAGG + Intronic
1037768620 8:21786520-21786542 AAGTGGACTCTCATTCTGAAGGG - Intronic
1043476240 8:80608621-80608643 CAGGTGATGCTGATACTGACAGG + Intergenic
1043724327 8:83590601-83590623 AAGGGCCTCCTGACTCTGACTGG + Intergenic
1046069242 8:109230675-109230697 AAGGGTTTTCTGTTTCTGAAAGG + Intergenic
1050189032 9:3005884-3005906 AAGGGAGTTCTGATGCTGAGAGG - Intergenic
1050339101 9:4617994-4618016 AAGGGGATGCTGATTTCCACGGG - Exonic
1052323008 9:27188637-27188659 TAGGGGATACTGCTTCTTACTGG + Intronic
1055133316 9:72800800-72800822 AAAGGGGTTGTGGTTCTGACTGG + Intronic
1055304342 9:74913572-74913594 AAAGGAATTCTTATTCTTACTGG + Intergenic
1056530960 9:87487264-87487286 AAGGGTGTTCTGAATCTGGCAGG - Intergenic
1057591294 9:96375719-96375741 AAGAGTCTTCTGATTCTGGCTGG + Intronic
1057878801 9:98777776-98777798 AAGGAGATTCCCATACTGACTGG - Intronic
1057899353 9:98936094-98936116 AAAGGGATTCTGTGACTGACTGG - Intergenic
1057994490 9:99808473-99808495 AAGTGGATGCAGATTCTAACTGG - Intergenic
1189726707 X:43974785-43974807 AGGTGGATTCTGTTTGTGACTGG - Intergenic
1193893429 X:87080574-87080596 GAGGGGATTCTGATTTTCACTGG + Intergenic
1194361067 X:92950823-92950845 GAGGGCCTTATGATTCTGACTGG + Intergenic
1195101638 X:101560773-101560795 AAGGTGATTCTGGGTGTGACTGG + Intergenic
1197873681 X:131083197-131083219 AAGTGGTTTCTGATTTTGAGAGG + Exonic