ID: 1146512337

View in Genome Browser
Species Human (GRCh38)
Location 17:33460912-33460934
Sequence GAGCCAATGACTCTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146512334_1146512337 26 Left 1146512334 17:33460863-33460885 CCATCCTGTGCAACTGTAGTATT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1146512337 17:33460912-33460934 GAGCCAATGACTCTTCCCACTGG 0: 1
1: 0
2: 0
3: 9
4: 111
1146512335_1146512337 22 Left 1146512335 17:33460867-33460889 CCTGTGCAACTGTAGTATTCTAC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1146512337 17:33460912-33460934 GAGCCAATGACTCTTCCCACTGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146512337 Original CRISPR GAGCCAATGACTCTTCCCAC TGG Intronic
901059885 1:6467102-6467124 AAGCAAAGGACTCTTCCCAGTGG + Exonic
902604144 1:17559509-17559531 GACCCAGTGACTCCTCCCAGCGG - Intronic
903349294 1:22708653-22708675 GAGCTCAGGGCTCTTCCCACAGG - Intergenic
905805963 1:40877850-40877872 GGGCACATGACTCTCCCCACAGG - Intergenic
906637433 1:47418524-47418546 GGATTAATGACTCTTCCCACTGG - Intergenic
912697783 1:111854574-111854596 GAGACACTGACCCTTGCCACTGG + Intronic
923462966 1:234223057-234223079 GAGGCGCTGACTCTTCCCCCAGG + Intronic
1066628858 10:37438599-37438621 GAGGAAATGAATCTTCACACTGG - Intergenic
1067456279 10:46421452-46421474 GAGCAAATGCCTATTCTCACTGG - Intergenic
1067630920 10:47963187-47963209 GAGCAAATGCCTATTCTCACTGG + Intergenic
1069279751 10:66640332-66640354 AAGGCAATGTCTCTTCCCAGGGG + Intronic
1070005528 10:72420580-72420602 CAGCCCAGTACTCTTCCCACTGG - Intronic
1073512190 10:104049605-104049627 GAGCCCATGCCACTTCCCAGGGG - Intronic
1074153106 10:110776068-110776090 GAGCCAATCACTGTTGCCAGAGG + Intronic
1074754678 10:116615604-116615626 CAGCAAATGAGTTTTCCCACAGG + Intergenic
1076576543 10:131473653-131473675 GAGCCAGGAAGTCTTCCCACCGG + Intergenic
1078427753 11:11265519-11265541 GAGCCACTGATTCAGCCCACAGG - Intergenic
1079373802 11:19873808-19873830 CTGCCAATCACTCTACCCACAGG - Intronic
1079547061 11:21645318-21645340 GAGCCAATGATTCTTCCTCTTGG - Intergenic
1080062580 11:27972570-27972592 GAGTCAACCACTCTTACCACGGG + Intergenic
1084730512 11:71070369-71070391 GAGCCTATGACCCTGCCCACTGG + Intronic
1085767222 11:79293793-79293815 GAGCCAATGACTGCAGCCACAGG + Intronic
1088359731 11:108977826-108977848 GAGCCACTGGCTATTCACACGGG - Intergenic
1088724706 11:112623792-112623814 GAGCTAATGTCTCTTCCCCCAGG + Intergenic
1088835389 11:113574348-113574370 GGGCCCAAGTCTCTTCCCACAGG + Intergenic
1090823982 11:130370667-130370689 GAGCCAATCACGTTGCCCACGGG + Intergenic
1091494172 12:957976-957998 AAGCCACTGGCTCTTGCCACAGG - Intronic
1092762295 12:11821027-11821049 GAGCCAATAACACTTACCAATGG + Intronic
1097226694 12:57480863-57480885 GAGCGAATGACCCTCCCCACTGG + Intronic
1099346783 12:81510263-81510285 GCTCCAATCACACTTCCCACAGG + Intronic
1102551803 12:113696748-113696770 GAGCAAATCACTGTCCCCACTGG - Intergenic
1102737370 12:115174721-115174743 GAGCCCATGTGTCTGCCCACAGG + Intergenic
1102856979 12:116302617-116302639 GAGCCACAGACCCTTCCCAAAGG + Intergenic
1107198905 13:37689737-37689759 CAGCCAATGACTGTTTTCACTGG + Intronic
1116384196 14:44310636-44310658 GTGCCCATGACCCTTTCCACAGG - Intergenic
1121199495 14:92105977-92105999 GAGCCAAGGTCTCCTCCCTCGGG + Intronic
1127343611 15:58070992-58071014 GCGCCAATGCCTTTTCCCTCAGG - Intronic
1127643215 15:60934622-60934644 GAGTCAATGAGTCATCACACTGG + Intronic
1130399255 15:83533859-83533881 GAGCCAATTTGTCTTCCCTCTGG + Intronic
1141175786 16:81718153-81718175 AAGCCCATCACACTTCCCACTGG - Intergenic
1142964376 17:3571688-3571710 GGGCCAAGGGCTCTGCCCACAGG + Intronic
1144301058 17:13923309-13923331 GAGCCAGGGGCTCTTCCCCCAGG + Intergenic
1144782491 17:17815047-17815069 GTGCCACTGTCTCCTCCCACAGG + Intronic
1146165807 17:30587440-30587462 GAGCCAATGACTCATTTCAAAGG - Intergenic
1146512337 17:33460912-33460934 GAGCCAATGACTCTTCCCACTGG + Intronic
1147382724 17:40065116-40065138 GAGCCCATGACTCGGCCCTCTGG - Intronic
1156537201 18:37875475-37875497 AAGCCTGTGACCCTTCCCACAGG + Intergenic
1158767381 18:60470237-60470259 GAGGCATTGCCTTTTCCCACTGG - Intergenic
1163981429 19:20904022-20904044 GAGCCACTCACTCTTCACAGTGG + Intergenic
1165905870 19:39194344-39194366 GAGCCCATGTTTCTTCCCAGGGG + Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1167511054 19:49895574-49895596 GAGCCAGTGAGACTTCCCTCTGG + Intronic
926276498 2:11407204-11407226 GAGCCAATCACTGTGCCCAGGGG - Intergenic
927847306 2:26478155-26478177 GAGCCACTCCCTCTTCCCCCAGG - Intronic
931890159 2:66662339-66662361 GAGCAAATGGCTCTCACCACAGG - Intergenic
933747464 2:85581528-85581550 GACCCAGTGGCTCCTCCCACTGG - Intronic
934199996 2:89876654-89876676 GAACCAAAGGCTCTGCCCACAGG - Intergenic
935596453 2:104882031-104882053 GAGTCAATAACTCTACCAACTGG - Intergenic
937754273 2:125516536-125516558 CAGACAATGACTCTTCCCATAGG + Intergenic
937996176 2:127696663-127696685 GAACCAATGACTCCTCCCCTCGG + Intergenic
939409752 2:141809142-141809164 GAGCCGATCACTTTTTCCACAGG - Intronic
941880294 2:170474312-170474334 GAGCCAATTACTGTGCCCAGGGG + Intronic
947810563 2:233001388-233001410 GAGCCTGTGAGTCTCCCCACGGG + Intronic
947822662 2:233082931-233082953 GAGCCCAGGACTCTGCCCAGAGG + Intronic
1170804475 20:19617663-19617685 GAGCCAGGGACTGTTCCCAGTGG + Intronic
1170818494 20:19735622-19735644 GAGCAGATGACTCAGCCCACAGG + Intergenic
1172232197 20:33344313-33344335 GAGCCACTGACTCTGGGCACTGG - Intergenic
1176231481 20:64035414-64035436 GAGTCACTGACTTTTCCCCCTGG + Intronic
1179345065 21:40548314-40548336 GAGCCATCGACTCCTCCCAAGGG + Intronic
1179606937 21:42522766-42522788 GTGGCAGTGACTCTTCCCAAAGG + Intronic
1179908110 21:44434610-44434632 GAGCCACAGACGCTTCCCATGGG - Intronic
1182025286 22:27113325-27113347 GAATCAGTGACTCATCCCACTGG + Intergenic
1182066039 22:27432373-27432395 GACACCATCACTCTTCCCACTGG + Intergenic
1183625620 22:38999669-38999691 TAGCCAAGGACTCTCCCCACCGG - Intergenic
952038925 3:29238133-29238155 GACCCAATGATTCTACTCACAGG - Intergenic
954053739 3:48004894-48004916 GAGGCCATGACTCTTGCCTCAGG - Intronic
954944411 3:54407098-54407120 GAGGAAATGACTATTCTCACTGG + Intronic
954985523 3:54787781-54787803 GAGGCAATAACTCTTATCACTGG - Intronic
960139301 3:114136993-114137015 GAGCCAATGACTCTTGCACACGG - Intronic
962271265 3:133979618-133979640 GGGCCCATCACTCTTCCCCCAGG - Exonic
967941573 3:194770538-194770560 GAACCAATGACTCTTTCCTTTGG - Intergenic
969342339 4:6550072-6550094 CAGCCAATGGCTCATCCCACGGG + Intronic
970291829 4:14581544-14581566 GAGCCTCTGAGTCTTCCCACTGG + Intergenic
972028016 4:34411878-34411900 GAGCCACTCACTCTTGCCATAGG - Intergenic
972378421 4:38495586-38495608 GAGGCAATGATTCTCCCCTCTGG - Intergenic
974026064 4:56734238-56734260 TAGCCACTGCCTCTGCCCACAGG - Intergenic
975089184 4:70380713-70380735 GAGCTAATGTCTCTGGCCACAGG - Intronic
978898143 4:113915232-113915254 GAGCCAATAACCCTTACCATTGG - Intronic
981526871 4:145715441-145715463 CAGCCCACGATTCTTCCCACGGG - Intronic
982515569 4:156344169-156344191 AAGCAAATCACTCTTCCCAGAGG - Intergenic
983410097 4:167385730-167385752 TGGCCAATGATTCCTCCCACAGG + Intergenic
986196060 5:5537156-5537178 GAGCCAAGGGCTCTTCCCCAGGG + Intergenic
986952720 5:13110520-13110542 GACCTAATGACTTTTCCCATCGG - Intergenic
987783484 5:22468124-22468146 GAACCAAAGACTCTTCTCCCTGG - Intronic
988675005 5:33424065-33424087 GAGCCAGTCACTGTGCCCACTGG - Intergenic
990811337 5:59727481-59727503 CATCCAATTACTCTTTCCACAGG + Intronic
992703919 5:79368680-79368702 GAGCCAAGCTCTCTTCCCTCTGG + Intergenic
996568833 5:124910363-124910385 GAGACAATGTCACATCCCACAGG - Intergenic
998779147 5:145637079-145637101 GACCCAAAGACTCTTCCAACTGG + Intronic
1000561741 5:162798150-162798172 AGGCCTCTGACTCTTCCCACAGG + Intergenic
1000652989 5:163840474-163840496 TAACCACTGACTCTTCCAACTGG - Intergenic
1001203918 5:169744681-169744703 GAGCTCATGACCCTTCCCCCTGG + Intronic
1004501752 6:16216312-16216334 GACCTAATGACTCCTCCCAGGGG + Intergenic
1006042084 6:31264886-31264908 CAGCCCATGACACTTCCCTCAGG + Intergenic
1007644329 6:43369062-43369084 GGGCCGACGACTCTTCCCGCCGG - Exonic
1019199819 6:170305561-170305583 GAGCTAATGAGTCTTCCATCAGG - Intronic
1024237368 7:47408487-47408509 CAGCCACTGCCTCTTCCCTCTGG - Intronic
1035449094 7:158963918-158963940 GAGCCAACGCCTCCTCCCAGCGG + Intergenic
1038041629 8:23728258-23728280 GAGACAATGCCTTATCCCACAGG + Intergenic
1039624284 8:39032065-39032087 GGGCCAATGACACCTCACACAGG - Intronic
1042421731 8:68598461-68598483 GTGCCACGGCCTCTTCCCACTGG - Intronic
1045373341 8:101547410-101547432 GAGTCCATGACTGTCCCCACAGG - Intronic
1047295651 8:123568519-123568541 GAGCCAGGGACCCTACCCACAGG + Intergenic
1057777780 9:98024852-98024874 GAATCAATGACTCTTCCCCAAGG - Intergenic
1058935512 9:109766234-109766256 GAGTCAATGACCCTGCCCAGTGG + Intronic
1061886200 9:133592188-133592210 CAGCCAGTGACTCGGCCCACAGG - Intergenic
1061961343 9:133990806-133990828 GAGCCAGCGCCTCTTCCCGCAGG - Intronic
1187093321 X:16120422-16120444 GAGACAAAGCCTCTTCCCACTGG - Intergenic
1189238626 X:39508218-39508240 GAGCAAATGCCACTTTCCACTGG + Intergenic
1190047614 X:47125303-47125325 GAGACATTGCCTCATCCCACAGG + Intergenic
1195067408 X:101250298-101250320 GAGCTAATGACTTTTCAAACTGG - Intronic