ID: 1146515561

View in Genome Browser
Species Human (GRCh38)
Location 17:33486561-33486583
Sequence GGGGATTCCCCTACAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146515553_1146515561 17 Left 1146515553 17:33486521-33486543 CCCTGGCTCCAATGGTCAAGAGA 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1146515561 17:33486561-33486583 GGGGATTCCCCTACAGGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1146515554_1146515561 16 Left 1146515554 17:33486522-33486544 CCTGGCTCCAATGGTCAAGAGAC 0: 1
1: 0
2: 1
3: 3
4: 94
Right 1146515561 17:33486561-33486583 GGGGATTCCCCTACAGGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1146515555_1146515561 9 Left 1146515555 17:33486529-33486551 CCAATGGTCAAGAGACTTCATCA 0: 1
1: 0
2: 1
3: 10
4: 77
Right 1146515561 17:33486561-33486583 GGGGATTCCCCTACAGGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146515561 Original CRISPR GGGGATTCCCCTACAGGGAC AGG Intronic
900361665 1:2292182-2292204 GGGGACTCCTCTCCGGGGACTGG - Intronic
900941966 1:5804701-5804723 GGTGATTCTCTTACAAGGACTGG - Intergenic
901529963 1:9846663-9846685 TGGTATTCACCTGCAGGGACAGG + Intergenic
901768837 1:11520503-11520525 GGGGATGGTCCTACAGGGCCAGG - Intronic
902719070 1:18292140-18292162 GGGGATGTCCCTCCAGGGAATGG - Intronic
904405794 1:30287188-30287210 GGGGAGGCCCCTGCAGGGGCGGG - Intergenic
910391307 1:86747514-86747536 GAAGTTTCCCCTACATGGACAGG - Intronic
914665485 1:149829157-149829179 GGGGATTTCCCCACAGGGCCAGG - Intergenic
914670280 1:149864637-149864659 GGGGATTTCCCCACAGGGCCAGG + Intronic
917433815 1:174999346-174999368 TGGGCTTCCGCTACAGGGCCCGG + Intronic
919785904 1:201258744-201258766 GGGGATGTCCACACAGGGACGGG - Intergenic
920868509 1:209773303-209773325 GGGCCTTCCCCTACAGTGTCAGG - Intronic
923270976 1:232354725-232354747 GAGGATTCCCCTACTAAGACAGG - Intergenic
1067294568 10:44967872-44967894 GGGGCTGCCCCAACATGGACTGG + Intronic
1075341413 10:121649380-121649402 TGGGGTTCCCCTACAGTGCCGGG + Intergenic
1076132393 10:128022372-128022394 GGGATTCCCCCTTCAGGGACAGG - Intronic
1081626687 11:44660078-44660100 GGGGAATCAGCTACAGGGACAGG + Intergenic
1082874349 11:57972760-57972782 TGGGATTCCCCCAGAGGAACCGG + Intergenic
1085054943 11:73398011-73398033 TGGGATTCGCCTAAAGGGAGAGG + Intergenic
1085454818 11:76659876-76659898 GTGGATTCCCCTGCAGGTAGAGG + Exonic
1087672870 11:101127995-101128017 GGGAAGTCGCCTACAGCGACCGG + Exonic
1091713607 12:2760462-2760484 GTGGATTTCCCTGCTGGGACAGG - Intergenic
1101029617 12:100646231-100646253 GGGAATTCCCCTGAAAGGACAGG - Intergenic
1103012171 12:117465929-117465951 GGGGCTTCCCCAACATGGTCAGG + Exonic
1116548658 14:46205596-46205618 GGGTATGACCCTACAAGGACGGG + Intergenic
1121175679 14:91889158-91889180 GGGGTTTCCCCACCGGGGACAGG + Intronic
1121223427 14:92303628-92303650 CTGGATACTCCTACAGGGACTGG - Intergenic
1121345985 14:93136209-93136231 GGGGCTTCCACTGGAGGGACAGG - Intergenic
1124411184 15:29438604-29438626 GGGGATTCAGGTACAGGGGCCGG - Intronic
1124654725 15:31499014-31499036 GGGGCTTCCCTTAGAGGGAGAGG + Intronic
1125513758 15:40306813-40306835 GGAGATTCTCCTTCAGGGAGGGG - Intronic
1132699801 16:1217514-1217536 GGGGAGGGCCCTGCAGGGACTGG - Intronic
1133821775 16:9243519-9243541 GATGATTCCCCTACAGGAAATGG - Intergenic
1137774209 16:51041977-51041999 GGGGGTTCCCCTTCTAGGACAGG + Intergenic
1139551011 16:67673102-67673124 GGGGATTCCCTCAGAGGAACCGG + Intergenic
1141567943 16:84915893-84915915 GGGGATCTCCCCACAGGGAAAGG + Intronic
1143524271 17:7463216-7463238 GGGGGTCCCCCCACAGGGGCTGG - Exonic
1143700894 17:8659258-8659280 GGGGATTACCCTAAAGGAAAAGG + Intergenic
1144718632 17:17452061-17452083 GAAGTGTCCCCTACAGGGACAGG - Intergenic
1145314436 17:21721053-21721075 TGGGGTTCCCATACAGGGAGGGG - Intergenic
1146515561 17:33486561-33486583 GGGGATTCCCCTACAGGGACAGG + Intronic
1147452290 17:40513150-40513172 GGGGACTCCCCTAGAGTAACAGG + Intergenic
1149409952 17:56395014-56395036 GGGAAGTACCCTTCAGGGACTGG - Intronic
1150712903 17:67546765-67546787 GGGGCCTCCCCGGCAGGGACTGG - Intronic
1151566380 17:74900832-74900854 TGGGATTCCCCTCCAGGCCCTGG - Intergenic
1155292373 18:24355059-24355081 GGCAATTCCCCTTCAGGGTCTGG - Intronic
1157102636 18:44744291-44744313 GGGGAGGCCCCTGCAGGGAAGGG - Intronic
1160699162 19:497834-497856 GGGGCTTCACCTGGAGGGACTGG - Exonic
1162135785 19:8554553-8554575 GGGGATTCTCATACTGGGCCTGG + Exonic
1162931720 19:13960927-13960949 AGGGAGCACCCTACAGGGACAGG - Exonic
1163395533 19:17058234-17058256 TGGGACTCCCCTGCAGGGTCAGG - Intronic
1163847008 19:19643540-19643562 GGGGATCGCTCTGCAGGGACCGG + Exonic
1164745590 19:30610417-30610439 GGGGAGACCCCCACAAGGACTGG - Intronic
926528003 2:14006844-14006866 GGGGATTGCCATAAAGGGGCGGG + Intergenic
927146487 2:20169576-20169598 TGGTCTTCCCCCACAGGGACTGG + Intergenic
928612247 2:33002069-33002091 GAGGATTTCCCAACAGTGACTGG - Intronic
935590968 2:104845121-104845143 GGGGACTGCACTACAGGGACCGG - Intergenic
936580558 2:113696880-113696902 GGGCATTCCCCTCCAAGGATGGG + Intergenic
938789907 2:134667363-134667385 AGGGATTCCCTTACAGAGAGAGG + Intronic
943345533 2:186733792-186733814 GTGGCTTCCGCTACAGGCACTGG + Intronic
943676257 2:190718930-190718952 GGGGTTTCCCCTGAAGGGACTGG + Intergenic
946428312 2:219611664-219611686 GGGGAACCCCCAACAGGGAGCGG + Exonic
1169209039 20:3755459-3755481 GGGGACGCACCTTCAGGGACGGG + Exonic
1173844978 20:46182569-46182591 GGGGATTCCCCTTCATGGGGTGG - Intronic
1181057091 22:20265386-20265408 GAGGACACCCCTACAGGGGCTGG - Intronic
1181414016 22:22746448-22746470 GGGGATGCCCATCCAGGGCCAGG - Intronic
1181954917 22:26581247-26581269 GGGGATACTGGTACAGGGACAGG - Intronic
1182285635 22:29245367-29245389 GGGGATTCTCATGAAGGGACAGG - Intronic
1184032141 22:41901332-41901354 GTGGCAGCCCCTACAGGGACAGG + Intronic
1184483795 22:44764260-44764282 AGGGAAGCCCCTGCAGGGACTGG + Intronic
950604354 3:14064972-14064994 GGGAATTCTCCCACAGGGAGAGG + Exonic
952505023 3:33999549-33999571 GGGACATCCCCTTCAGGGACAGG - Intergenic
957405916 3:79775263-79775285 GGGAATTCCCCTGAAAGGACAGG + Intergenic
961463398 3:127067319-127067341 GGCGGGTCCCATACAGGGACAGG + Intergenic
966200059 3:177352812-177352834 GGGTTTTACCCTACAGGGAATGG - Intergenic
969636161 4:8370504-8370526 GGGGATTCCAGGACAGGGATGGG + Intronic
992208396 5:74453144-74453166 GGTGGTTTCCCTACTGGGACGGG - Intergenic
1004197258 6:13516220-13516242 GAGGAATCCCCTGGAGGGACAGG + Intergenic
1007666494 6:43516642-43516664 GGGGATTCCCCCTCTGGGCCTGG - Intronic
1011480572 6:87789559-87789581 GAGGAATCCTCTCCAGGGACAGG + Intergenic
1021912187 7:25397222-25397244 GTAGATTTCCTTACAGGGACTGG - Intergenic
1029205400 7:98866691-98866713 CTGGAGTCCCCCACAGGGACAGG - Intronic
1029613940 7:101644688-101644710 GGGGAAGCCCCTACAGAGATTGG + Intergenic
1030129877 7:106190137-106190159 GGTCATTCCCCTGCATGGACAGG + Intergenic
1035274192 7:157737637-157737659 GAGTGTTCCCCTACAGGGAGGGG + Intronic
1037911989 8:22748996-22749018 GGGGGTTCCACTGCTGGGACTGG + Intronic
1037998055 8:23367861-23367883 GGTGATGCCCATCCAGGGACTGG - Intronic
1041523609 8:58781446-58781468 GGGAATTCTCCTAGAAGGACAGG - Intergenic
1048314621 8:133352861-133352883 GGAGATACCCCTACAGGGAGTGG - Intergenic
1049158787 8:141084333-141084355 GCAGAGTCCCCTACAGGGTCAGG + Intergenic
1053067160 9:35076861-35076883 GTGGATTTCCCTAAAGGGATAGG + Exonic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1054814921 9:69465763-69465785 GGGGCTTCCCCTAAAAGAACTGG + Intronic
1055030845 9:71769918-71769940 GGGGATTCCCCTTCACTGCCGGG - Intronic
1056589948 9:87958841-87958863 GGGCCTCCCCCTACAGTGACAGG - Intergenic
1059399764 9:114061545-114061567 GGTCATTCCCATGCAGGGACCGG + Exonic
1061084838 9:128392861-128392883 GGGGATCCCCGCACAGGGTCAGG - Intergenic
1186410133 X:9339601-9339623 TGGGATTCCCCCAGAGGGAAAGG + Intergenic
1188506480 X:30889454-30889476 GAGGCTTCCCCCACAGGAACAGG + Intronic
1190426214 X:50336319-50336341 GGGAATTCCCCCAAAAGGACAGG - Intronic
1196919984 X:120575592-120575614 GGGGTTTCCCCTGCAGAGATTGG - Exonic
1197277124 X:124492778-124492800 AGGGCTTCATCTACAGGGACTGG + Intronic