ID: 1146519071

View in Genome Browser
Species Human (GRCh38)
Location 17:33512175-33512197
Sequence GCTCAGTCTGACCAAGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146519067_1146519071 5 Left 1146519067 17:33512147-33512169 CCAAAGGGAGGTCTTAATGGTTC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1146519071 17:33512175-33512197 GCTCAGTCTGACCAAGATAAGGG 0: 1
1: 0
2: 1
3: 9
4: 107
1146519065_1146519071 8 Left 1146519065 17:33512144-33512166 CCTCCAAAGGGAGGTCTTAATGG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1146519071 17:33512175-33512197 GCTCAGTCTGACCAAGATAAGGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146519071 Original CRISPR GCTCAGTCTGACCAAGATAA GGG Intronic
901115693 1:6842007-6842029 GCTGAGTCTGGGCAAGATCATGG - Intronic
905903351 1:41596797-41596819 GGTCATTCTGACCAAGATCAGGG - Intronic
908433426 1:64081176-64081198 GCTCAGCCTGAAAAACATAAGGG - Intronic
917603482 1:176601564-176601586 GAACAGACTTACCAAGATAAAGG + Intronic
920277744 1:204820291-204820313 GCTGAGTCTGAATAAGAAAAGGG + Intergenic
923609496 1:235477450-235477472 TATAAGGCTGACCAAGATAATGG + Intronic
1064321000 10:14304600-14304622 GCTGAGTCTGGCCAAGCTCATGG + Intronic
1068768564 10:60794571-60794593 GCTAAGTCTTACAAAGATCAAGG + Exonic
1069638621 10:69940954-69940976 GCACAGTTTGACCAAAAGAAGGG - Intronic
1077419020 11:2440886-2440908 GCTGAGGCTGACCAAGGGAAGGG - Intergenic
1080419180 11:32094955-32094977 GCTCAGCCTGACAAATATTAGGG - Intronic
1082961945 11:58926860-58926882 TCTCAGGCTGACCAAGTTTATGG + Intronic
1084982048 11:72834780-72834802 GACCAGCCTGACCAACATAATGG - Intronic
1086221135 11:84444998-84445020 GATCAGCCTGGCCAACATAATGG - Intronic
1092367563 12:7889731-7889753 GACCAGCCTGACCAATATAATGG - Intronic
1092863166 12:12736945-12736967 GCTGAGTATGACAAAGAAAAGGG - Intronic
1095777067 12:46022126-46022148 ACTCAGTCAGAAAAAGATAAAGG - Intergenic
1096125209 12:49114103-49114125 GATCAGTCTGACCAACATGGAGG + Intergenic
1097222348 12:57458745-57458767 GCTCAGTCAGACCAGACTAATGG - Intronic
1098153188 12:67569527-67569549 GCTCAAGCAGACTAAGATAAAGG - Intergenic
1099270556 12:80503715-80503737 GATCAGAGTGGCCAAGATAATGG - Intronic
1104167115 12:126242854-126242876 GCTCAATCTTCCCAAGATAGTGG + Intergenic
1108086826 13:46802409-46802431 GCCCAGTATGACTAAGACAAAGG + Intergenic
1109452956 13:62542389-62542411 GCTCTGTATGACCTAGAGAAAGG + Intergenic
1114686632 14:24538208-24538230 ACTCAGTCAGACAAAAATAAAGG + Intergenic
1115106254 14:29764894-29764916 TCTCAGACTGACAAAGATTAGGG + Intronic
1116640059 14:47449787-47449809 GCACATTCTGACCAAGATTCTGG - Intronic
1118184554 14:63524922-63524944 GCACAGTATGACCAAGATTGCGG + Intronic
1123407627 15:20031010-20031032 ACTCAGTCAGACAAAAATAAAGG + Intergenic
1123516955 15:21037666-21037688 ACTCAGTCAGACAAAAATAAAGG + Intergenic
1135695923 16:24586321-24586343 GATCAGTCTGAACAATATAAGGG - Intergenic
1138412219 16:56849612-56849634 GCTAAGTCTGACCCGGATGAAGG - Intronic
1138676130 16:58652858-58652880 GCTCAGGCTGACAAAGGGAATGG - Intergenic
1140766666 16:78165835-78165857 GCTCAGTGAGCTCAAGATAAGGG - Intronic
1141357510 16:83362265-83362287 ACTCAGGCTGACAAAGGTAAAGG - Intronic
1145883961 17:28370133-28370155 GCTCTGGCTGACCAAGGTACAGG - Exonic
1146519071 17:33512175-33512197 GCTCAGTCTGACCAAGATAAGGG + Intronic
1149342045 17:55697547-55697569 GACCAGCCTGACCAACATAAAGG - Intergenic
1152990017 18:354864-354886 GGGCAGTCTCACCAAGATGAAGG - Intronic
1154150484 18:11902699-11902721 GCTCACTCTGATGAAGAGAAGGG - Intronic
1160891501 19:1381008-1381030 GCTCTGTGTGACCAACAGAATGG - Intergenic
1161274410 19:3407631-3407653 GCTCAGCCTGACCAACATGGCGG - Intronic
1164894573 19:31861164-31861186 ACACAGTCTGTCCAAGATATGGG + Intergenic
925596993 2:5564696-5564718 GTTCATTCTGCCCAAGTTAAGGG + Intergenic
927752308 2:25680377-25680399 GACCAGTCTGACCAACATAGTGG - Intergenic
931670153 2:64640424-64640446 GCTCAGGCTGGCCAAGGTCAGGG + Intronic
931740328 2:65236777-65236799 GATCAGCCTGACCAACATGATGG - Intronic
931907153 2:66854705-66854727 GCTCAGTGTGGACAAGAAAAGGG + Intergenic
932356681 2:71073280-71073302 TATCTGACTGACCAAGATAAGGG - Intronic
933586125 2:84181198-84181220 GCTCAATTTGACTAAGATTATGG + Intergenic
933769785 2:85735812-85735834 ACACAGTTTGGCCAAGATAAGGG - Intergenic
936082328 2:109440999-109441021 GCTCAGTCTGACCACTACAGAGG - Intronic
937333990 2:121049533-121049555 CCTCAGTCTGAAGAAGATACTGG - Intergenic
937383863 2:121407574-121407596 CCTCAGTCTGCCGCAGATAATGG + Exonic
940134679 2:150423005-150423027 TCTCACTCTGACCCAGATTAGGG - Intergenic
941164728 2:162073327-162073349 GCTCCGTCTTACCACGCTAAGGG - Intronic
944840818 2:203622004-203622026 GCTCAGCTTGACCAAGAAACTGG + Intergenic
1170091065 20:12590279-12590301 GATCAGCCTGACCAACATAATGG + Intergenic
1174685094 20:52447087-52447109 GCTGAGTCCAACCATGATAAGGG + Intergenic
1175067916 20:56305806-56305828 GGTTAGACTGACCAGGATAATGG + Intergenic
1175433071 20:58920887-58920909 GCTAAGGCTGAACAAGATGATGG + Intergenic
1176255369 20:64149339-64149361 CCTCACTTTGACCATGATAAGGG - Intergenic
1178333137 21:31718636-31718658 GCTCAGTCGGAGCAGGAAAATGG - Intronic
1179567164 21:42256380-42256402 CCACAGTCTGGCCAAGAGAATGG - Intronic
1181739783 22:24911673-24911695 GCCCAGTCTTACCATGAGAAAGG + Intronic
951898715 3:27635562-27635584 GCTAAGTATAACCAAGAAAAGGG + Intergenic
952404441 3:32992910-32992932 GCTCAGTCAGACCAAGAGCAGGG + Intergenic
953962149 3:47274381-47274403 GCTCAGGCTGCCCATGCTAAGGG - Intronic
955344970 3:58154139-58154161 GACCAGTCTGAGCAAGATAGTGG - Intronic
963874979 3:150465322-150465344 GCTCAATCTCAGCAAAATAAGGG + Exonic
966046940 3:175563759-175563781 GTACAGTCCGACCAAGGTAATGG + Intronic
976984709 4:91279447-91279469 ACTCAGTCAGACAAAGATAAAGG - Intronic
978891785 4:113837669-113837691 GCTAAGGCTGAACAAGAAAAGGG + Intergenic
983060229 4:163152388-163152410 ATCCAGTATGACCAAGATAAGGG + Intronic
988117503 5:26915902-26915924 CTTCACACTGACCAAGATAAAGG - Exonic
992794644 5:80244621-80244643 GATCAGCCTGACCAACATGAAGG + Intronic
1001113857 5:168922544-168922566 GAACAGGCTGACCAAGATTAAGG + Intronic
1001359733 5:171070112-171070134 GCTTAGTCTGACCTATAGAAAGG - Intronic
1003161292 6:3636740-3636762 GATCAGCCTGAACAACATAATGG - Intergenic
1004899655 6:20182539-20182561 CCTCAGTCTGCCCAAGGGAAGGG + Intronic
1006018840 6:31104639-31104661 GATCAGTCTGAGCAACATAGTGG + Intergenic
1007247993 6:40476135-40476157 GCCCAGTCTGACTAAGGTACAGG - Intronic
1009971977 6:70634346-70634368 GATCAGTCTGGCCAACATGATGG + Intergenic
1010571102 6:77475292-77475314 GCTCATTCTGAACTAGAAAAAGG + Intergenic
1011596140 6:89018513-89018535 TCTGATTCTGACCAAGAGAAAGG + Intergenic
1015054810 6:128887669-128887691 GACCAGCCTGACCAACATAACGG + Intronic
1018240187 6:161766738-161766760 GCTGAGTCTGACCAATTTCATGG + Intronic
1023658006 7:42445976-42445998 ACTCAGTCTGACAAAAATAAAGG - Intergenic
1025855224 7:65270333-65270355 ACTCACTCTGAGGAAGATAAAGG - Intergenic
1028777585 7:94696553-94696575 CATGAGTCTCACCAAGATAAAGG - Intergenic
1032132171 7:129239050-129239072 GCTCAGACTAACCAAAATCATGG + Intronic
1033935550 7:146580813-146580835 GCACAGACTGACCTAGGTAATGG - Intronic
1039465200 8:37780418-37780440 GCTCAATCAGATCTAGATAAGGG + Intergenic
1049263585 8:141653060-141653082 GCTCAGTGTGACCAGGATCAGGG + Intergenic
1049413070 8:142482168-142482190 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1049413083 8:142482238-142482260 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1049413090 8:142482284-142482306 GCTCAGTGTGACCAGGATCAGGG - Intronic
1049413102 8:142482354-142482376 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1049413128 8:142482496-142482518 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1049413137 8:142482542-142482564 GCTCAGCATGACCAGGATCAGGG - Intronic
1049413204 8:142482954-142482976 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1049413216 8:142483024-142483046 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1049413243 8:142483166-142483188 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1049413263 8:142483258-142483280 GCTCAGTGTGACCAGGATCAGGG - Intronic
1049413273 8:142483328-142483350 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1049413325 8:142483590-142483612 GCTCAGTGTGACCAGGATAAGGG - Intronic
1049413333 8:142483636-142483658 GCTCAGTGTGACCAGGGTCAGGG - Intronic
1051652322 9:19340994-19341016 GGTCAGTCTGACCAAGGATACGG + Exonic
1052434667 9:28410615-28410637 GCTCGTTATCACCAAGATAAAGG + Intronic
1058439488 9:104993722-104993744 GCTCAGGCTGATAAAGACAAAGG + Intergenic
1061129655 9:128701833-128701855 GCTCAGTCTGAGTAAGAGATGGG + Intergenic
1186307291 X:8275826-8275848 TCTCAGTATGACCCAAATAAAGG - Intergenic
1187232637 X:17437116-17437138 CCTCAGGCAGACCAAGCTAATGG - Intronic
1187519165 X:19998657-19998679 CCACAGTCTGATAAAGATAAAGG - Intergenic
1190148363 X:47919487-47919509 GCTCAAACTGACTAAGACAAAGG - Exonic
1190381933 X:49847511-49847533 GCCCAAGCTGACCAAGACAATGG - Intergenic
1195000419 X:100638025-100638047 GCTCTGTGTGACCAAGTCAATGG - Intronic
1202196875 Y:22306411-22306433 CCTCAGTCTGACCCAGACACCGG + Intergenic