ID: 1146520232

View in Genome Browser
Species Human (GRCh38)
Location 17:33520649-33520671
Sequence AGGGGCCCTGTCCGTGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146520232_1146520243 -3 Left 1146520232 17:33520649-33520671 CCTTACCCACGGACAGGGCCCCT 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1146520243 17:33520669-33520691 CCTCTTGGGGCTATGAAGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 168
1146520232_1146520238 -7 Left 1146520232 17:33520649-33520671 CCTTACCCACGGACAGGGCCCCT 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1146520238 17:33520665-33520687 GGCCCCTCTTGGGGCTATGAAGG 0: 1
1: 0
2: 1
3: 8
4: 140
1146520232_1146520239 -6 Left 1146520232 17:33520649-33520671 CCTTACCCACGGACAGGGCCCCT 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1146520239 17:33520666-33520688 GCCCCTCTTGGGGCTATGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 83
1146520232_1146520244 0 Left 1146520232 17:33520649-33520671 CCTTACCCACGGACAGGGCCCCT 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1146520244 17:33520672-33520694 CTTGGGGCTATGAAGGGTGGAGG 0: 1
1: 0
2: 5
3: 32
4: 296
1146520232_1146520245 13 Left 1146520232 17:33520649-33520671 CCTTACCCACGGACAGGGCCCCT 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1146520245 17:33520685-33520707 AGGGTGGAGGAGCAAGTGAGCGG 0: 1
1: 1
2: 3
3: 67
4: 764

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146520232 Original CRISPR AGGGGCCCTGTCCGTGGGTA AGG (reversed) Intronic
901260319 1:7866124-7866146 AGGGGCCCAGAGCGTGGGCATGG - Intergenic
905176698 1:36140657-36140679 AGGGGCCCAGTCCATGGGGAAGG + Intronic
906282881 1:44566124-44566146 AGGGTCCCTGCCCCTGGGGAAGG - Intronic
909708323 1:78613559-78613581 GCGGGGCCTGTCGGTGGGTAGGG + Intergenic
915166931 1:153953240-153953262 AGTGGCCCTGTCCCAGGGTTGGG - Intronic
915641262 1:157228760-157228782 AGGGGCCATGTCTGCAGGTAAGG + Intergenic
915668226 1:157464174-157464196 AGGGGCCATGTTTGTAGGTAAGG - Intergenic
915901776 1:159852038-159852060 AGGCCCCCTGTCCTTGGGAAGGG - Intronic
916013924 1:160731570-160731592 ATGGGGCCTGTCGGGGGGTAGGG - Intergenic
917475513 1:175365978-175366000 TGAGGTCCTGTCCTTGGGTACGG + Exonic
919601357 1:199626581-199626603 ACGGGGCCTGTCGGAGGGTAGGG + Intergenic
920500487 1:206482153-206482175 AAGGGCCCTGTTCGGGGGAAAGG + Intronic
920695543 1:208179111-208179133 AGAGGCCCTGTGGGTGGTTATGG + Intronic
920948611 1:210552697-210552719 AGGGGCCATGTCAGTGGGTGAGG + Intronic
921175035 1:212586048-212586070 TGGGGTCCTGCCCGTGGGCAGGG + Intronic
923298270 1:232616086-232616108 AGGGGCCATCTCCATGGCTATGG - Intergenic
1069356462 10:67592187-67592209 AGGGGTCCTGAAAGTGGGTAAGG - Intronic
1069604366 10:69730458-69730480 AGGGGCCCTCTGCGTGGGAAGGG - Intergenic
1071397576 10:85238574-85238596 AGGGGCCCTGTGGGTGGGGGCGG + Intergenic
1073116206 10:101093368-101093390 AGGGGCCCTGAAGGTGGGCAAGG - Intronic
1073253801 10:102138265-102138287 AGGGGCCCAGACAGTGGGAAAGG - Intronic
1073266268 10:102230314-102230336 AGGGGCGCGGTCTGTGTGTAGGG + Exonic
1075885512 10:125896265-125896287 AGTGGGCCTGCCCGCGGGTAAGG - Intronic
1076798034 10:132808236-132808258 AGGGGCCCTGCACGTGTGCAGGG + Intergenic
1080161943 11:29187227-29187249 AGTGGCCCTGTACATGGTTAGGG - Intergenic
1081993613 11:47350459-47350481 AGGGGCAGGATCCGTGGGTAGGG - Intronic
1082983194 11:59143005-59143027 AGGAGCGCTGTGGGTGGGTAGGG + Intronic
1083891279 11:65596869-65596891 AGGGACCCTGCCCTAGGGTATGG + Intronic
1084006722 11:66327009-66327031 AGGGGCCCTGGCCCTGGGTGGGG + Intergenic
1084172377 11:67406730-67406752 AGGGGCCCGGTGAGTGGGTGGGG + Intronic
1084357828 11:68651512-68651534 AGGGGCCCCTTTTGTGGGTAGGG - Intergenic
1084938742 11:72601191-72601213 AGGGGCTCTGTGAGGGGGTAGGG - Intronic
1085493790 11:76947877-76947899 ATTGGTCCTGTCCGTGGGTTTGG - Intronic
1089100674 11:115959608-115959630 GGGGGCCCTCCCCGTGAGTAGGG + Intergenic
1092714074 12:11370032-11370054 AGAGGCCCTGTCAGGGAGTAAGG + Intronic
1092717777 12:11409064-11409086 TGAGGCCCTGTCAGTGAGTAAGG + Intronic
1093740141 12:22676163-22676185 CCGGGGCCTGTCAGTGGGTAGGG - Intronic
1099378168 12:81919648-81919670 AGGGGCCATGACCGTGGGTGAGG - Intergenic
1100670154 12:96802832-96802854 CTGGGGCCTGTCGGTGGGTAGGG - Intronic
1103953459 12:124564636-124564658 TGGGGTCCTGTCTGTGGGAAGGG - Intronic
1104676413 12:130714899-130714921 AGGGGCCATGTGCGTGGGGGAGG + Intronic
1105854963 13:24364733-24364755 GGAGGCCCTGCCCGTGGGGAGGG + Intergenic
1110728362 13:78852621-78852643 GGAGGCCCAGTCCTTGGGTAGGG - Intergenic
1112326763 13:98446827-98446849 CAGGGCCCTGTGCGTGGGAAGGG - Intronic
1116754426 14:48928043-48928065 ACGGGTCCTGTCAGGGGGTAGGG + Intergenic
1117715829 14:58580041-58580063 ATGGGGCCTGTCAGTGGGTGGGG - Intergenic
1118372808 14:65152202-65152224 AGGGGACCTGTCTGGGGGTGGGG + Intergenic
1118607602 14:67515091-67515113 CGGGGCCGGGGCCGTGGGTAGGG + Exonic
1121318056 14:92973957-92973979 AGGGGCCCTGCCTGCGGGCAAGG - Intronic
1122937389 14:104966502-104966524 AGGGGCCCTGTCAGGTGGTGGGG - Intronic
1202872547 14_GL000225v1_random:177652-177674 AGTGGGCCTGCCCGCGGGTAAGG + Intergenic
1129224503 15:74160437-74160459 ATGGGGCCTGTCAGAGGGTAGGG - Intergenic
1131284394 15:91045110-91045132 AGGGGACCTGCCCCTGGGTTTGG + Intergenic
1131539079 15:93260963-93260985 AGGAGCCCTGTCCTTAGATAAGG + Intergenic
1131772751 15:95758034-95758056 CGGGGGCCTGTTGGTGGGTAGGG + Intergenic
1132751002 16:1457693-1457715 CGGGGGCCTGGCCGTGGGAAAGG - Exonic
1132850680 16:2023675-2023697 TGGGGCCCTGTCTGGGGGTGGGG - Intergenic
1133040231 16:3056760-3056782 AGGGGCCCCATCGGTGTGTAAGG + Intronic
1134061421 16:11201893-11201915 AGGGGACCTGGCCCTGGGGAGGG + Intergenic
1134242960 16:12519095-12519117 AGCAGCCCTGCCAGTGGGTAGGG - Intronic
1134635708 16:15790362-15790384 ATGTGCCCTATCCGTGGCTATGG + Intronic
1137436127 16:48455560-48455582 AGGGGCACTGTCTGTGGGCTGGG + Intergenic
1138275664 16:55732299-55732321 AGGGACCCTGTCCCTCGGGAGGG + Intergenic
1138580928 16:57940040-57940062 AGCGGCCCAGGCCGTGGGTGGGG - Intronic
1139166601 16:64573263-64573285 AGGGGCCATGGCCTTGGATAAGG - Intergenic
1139613607 16:68075876-68075898 AGGGGCACTGGGTGTGGGTAGGG - Intronic
1140181911 16:72728794-72728816 TGGGGGCCTGTCCGCGGGGATGG + Intergenic
1140649042 16:77066585-77066607 ATGGACCCTGTCAGAGGGTAGGG + Intergenic
1142255802 16:89013326-89013348 AGAGGCACTGTCGATGGGTATGG + Intergenic
1143634894 17:8158977-8158999 AGAGGCCCTGACCTTGGGCAGGG - Intronic
1144035401 17:11360617-11360639 CCGGGGCCTGTCCGGGGGTAGGG + Intronic
1144455115 17:15412438-15412460 CGGGCCCCTGTCCGGGCGTATGG + Intergenic
1144586630 17:16491611-16491633 AGGGGCCCCTTCCGCGGGGATGG - Intronic
1144692945 17:17280871-17280893 AGGGGCCCAGGCCGGGGGGAGGG + Intronic
1145912573 17:28551206-28551228 GGGGGGCCTCTCTGTGGGTATGG - Intronic
1146520232 17:33520649-33520671 AGGGGCCCTGTCCGTGGGTAAGG - Intronic
1146912994 17:36660016-36660038 AGGGGCCCTGTTCTGGGGAAAGG - Intergenic
1147456426 17:40541057-40541079 AGAGGCACTGTCCCTGGGCAGGG + Intergenic
1148440675 17:47710305-47710327 GGGGACCCTGTCCCTGGGCAGGG + Intronic
1149168782 17:53784757-53784779 ACGGGGCCTGTCGGTGGGTAGGG + Intergenic
1151173277 17:72266312-72266334 AGGGATCTTGTCCTTGGGTACGG - Intergenic
1155050174 18:22139791-22139813 AGGGGCCCCGTGGGTGGGTGAGG + Intergenic
1156440602 18:37183547-37183569 AGAGGCCCTGGGCTTGGGTAGGG - Intronic
1158073620 18:53503013-53503035 CTGGGGCCTGTCGGTGGGTAGGG - Intronic
1158620148 18:59025913-59025935 CGGGGACCTGTCAGGGGGTAGGG + Intergenic
1158692636 18:59674456-59674478 CTGGGGCCTGTCGGTGGGTAGGG + Intronic
1158812160 18:61050485-61050507 CCGGGGCCTGTCAGTGGGTAGGG - Intergenic
1160046381 18:75390963-75390985 AGGGACCCTGTTCTTGGGTGTGG + Intergenic
1160788269 19:911986-912008 TGGGCCCCTGTCCGCGGGTCGGG - Intronic
1161011188 19:1960059-1960081 TGGGGCCCTGGACGTGGGTGGGG - Intronic
1161449779 19:4338646-4338668 AGGGGCCCTGTGACCGGGTAAGG - Exonic
1163118038 19:15200078-15200100 AGGGGCTCTGGCCGCGGGGAGGG + Intronic
1163493017 19:17627996-17628018 AAGGTCCCTGGCGGTGGGTAGGG - Intronic
1167307135 19:48715694-48715716 AGGGGCCGTGCCCGAGGGCAAGG + Exonic
1167661733 19:50799427-50799449 AGGGGCCCTGGCTCTGGGGAGGG - Intronic
925263537 2:2548127-2548149 GGGGGCCCTGGCAGTGGGCAGGG - Intergenic
925976851 2:9147875-9147897 AGGGGCCTTGTCTGTGGCTTGGG - Intergenic
926222157 2:10943366-10943388 AGGGGCCCTGACTCTGGCTAAGG + Intergenic
927451513 2:23213138-23213160 GGGGGCCCTGTCCCAGGATAGGG + Intergenic
928617653 2:33055775-33055797 AGGGGACATGTACCTGGGTAGGG + Intronic
930870489 2:56166118-56166140 CCGGGACCTGTCAGTGGGTAGGG + Intergenic
931791340 2:65666648-65666670 TGGGGCCCTGGCCGTGGGGATGG + Intergenic
931998945 2:67866144-67866166 AGGGGCCCTTTCCCTGGGCAAGG - Intergenic
932182092 2:69656012-69656034 CTGGGGCCTGTCAGTGGGTAGGG + Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
934870277 2:97858584-97858606 AGGGCTCCTGTCAGTGGGTCAGG - Intronic
937130669 2:119510139-119510161 ACGGGGCCTGTCAGGGGGTAGGG - Intronic
940442068 2:153727899-153727921 CAGGGACCTGTCAGTGGGTAAGG - Intergenic
941513834 2:166446860-166446882 CAGGGACCTGTCGGTGGGTAGGG + Intronic
948629613 2:239293619-239293641 AGGTGCCCTGTGCGTTGGTCTGG - Intronic
949027364 2:241772874-241772896 AGGGACCCAGGCCGAGGGTAGGG - Intergenic
1168941318 20:1713467-1713489 AGGGGAGGTGTCCCTGGGTAGGG - Intergenic
1170518721 20:17160730-17160752 CCGGGACCTGTCAGTGGGTAGGG + Intergenic
1172126285 20:32627046-32627068 ATGGGCCCTGGCAGTGGGAATGG + Intergenic
1174133532 20:48362704-48362726 AGGGGCCCTGTGCCTTGGTCTGG - Intergenic
1174574564 20:51527283-51527305 AGGGGGCCTGGCAGTGGGTAGGG - Intronic
1174586425 20:51612120-51612142 AGTGGCCCTGTCCGAGGGCAAGG + Intronic
1176286127 21:5020515-5020537 AGGTGCCCTGTCGGTGCGTCCGG - Intergenic
1179236345 21:39550409-39550431 CCGGGGCCTGTCGGTGGGTAGGG - Intergenic
1179288485 21:39997973-39997995 GGGGACACTGTCCTTGGGTAGGG - Intergenic
1179421811 21:41242262-41242284 AGTGGACCTGACTGTGGGTAGGG + Intronic
1179492901 21:41752810-41752832 CCGGGCCCTGTCGGTGCGTAGGG + Intronic
1179871054 21:44242960-44242982 AGGTGCCCTGTCGGTGCGTCCGG + Intergenic
1180194390 21:46184209-46184231 AGGGGCCGTGGCCATGGGTTGGG - Intronic
1180285552 22:10741824-10741846 AGTGGGCCTGCCCGCGGGTAAGG - Intergenic
1180929473 22:19579179-19579201 AGGGGCCCTGTCCCTGGGGCTGG + Intergenic
1180939364 22:19647030-19647052 AGGGGCTCTGTGTATGGGTAGGG - Intergenic
1182674780 22:32030410-32030432 AGGGGCCCTCACCGTGTGGAAGG + Intergenic
1182980113 22:34661831-34661853 CTGGGGCCTGTCAGTGGGTATGG - Intergenic
1183302886 22:37066956-37066978 ATGGGGCCTGTCCGTGGTCAAGG + Exonic
1183493569 22:38129275-38129297 AGGGCCCTTGTGCTTGGGTAAGG + Intronic
1184068600 22:42134875-42134897 AGGTGCCCTGCACGTGGGTAAGG - Intergenic
1185077359 22:48690529-48690551 AGGGGCCCTGGCCCTGGCGATGG - Intronic
1185280117 22:49966364-49966386 AGGGGCCCAGTCCATAGGGAAGG - Intergenic
950299333 3:11862142-11862164 CTGGGGCCTGTCGGTGGGTAGGG - Intergenic
950590417 3:13932788-13932810 AGGGGCCGTGGCCATGGGCACGG - Intergenic
951329886 3:21353954-21353976 CTGGGGCCTGTCGGTGGGTAGGG + Intergenic
959867120 3:111283555-111283577 AAGGTCCCTGTCCTTGGGAAAGG + Intergenic
961166211 3:124765605-124765627 TAGGGCCCTGTCCCTGGGGAGGG - Intronic
962580242 3:136791437-136791459 TGGGGCTCTGACCATGGGTAGGG + Intergenic
964560944 3:157995417-157995439 ACGGGGCCTGTCAGGGGGTAGGG + Intergenic
966411781 3:179652914-179652936 AGGGGCCCTGCGCGTGGGCCGGG - Exonic
968045201 3:195620056-195620078 AGGGGCCCTGCTGGTGGGGAAGG - Intergenic
968135508 3:196217033-196217055 AGGGGGCCCGTCCGTCTGTAAGG + Intronic
968476883 4:814824-814846 AGGGGCCCCGGCCATGGGTCGGG + Intronic
969063281 4:4456583-4456605 AGGAGCCCTGTCAGCAGGTAAGG - Intronic
970628047 4:17911853-17911875 CGGGGACCTGGCCGTGGGGATGG + Intronic
971458974 4:26873778-26873800 AGGGGCTCTGTCAAGGGGTAAGG + Intronic
975121440 4:70732745-70732767 TGGGGACCTGTCGGTGGGTAGGG + Intronic
977205579 4:94161687-94161709 ATGGGACCTGTCCGGGGGTCGGG - Intergenic
979458273 4:120951037-120951059 CTGGGGCCTGTCAGTGGGTAGGG + Intergenic
979519400 4:121649388-121649410 AGGGGCCCTTTCTGTGGGATTGG - Intergenic
982452745 4:155572308-155572330 AGGGCCCGTGGCCGTGGGTTAGG + Intergenic
990876533 5:60492729-60492751 CGAGGGCCTGTCAGTGGGTAGGG + Intronic
995122161 5:108547626-108547648 AGGAGCCATGACCTTGGGTAGGG + Intergenic
999943078 5:156565700-156565722 CGGGGTCCTGTCGGTGGGTGGGG - Intronic
1000421202 5:161039890-161039912 CAGGGGCCTGTCAGTGGGTAGGG + Intergenic
1000421252 5:161040355-161040377 CGGGGGCCTGTCAGTGGGTAGGG + Intergenic
1007060625 6:38937191-38937213 CTGGGGCCTGTCGGTGGGTAGGG + Intronic
1007249563 6:40486522-40486544 AGCGGACCTGTGCCTGGGTAAGG + Intronic
1007800478 6:44388001-44388023 TGGGGCCCTTTCCGTGTGTCTGG + Intronic
1012082528 6:94779586-94779608 ATGGGACCTGTCAGTGGGTAGGG - Intergenic
1013025584 6:106268866-106268888 CGGGGGCCTGTCGGTGGGTTGGG + Intronic
1020364151 7:7362017-7362039 ATGGGGCCTGTCTGTGGGTGGGG + Intronic
1024512240 7:50213204-50213226 AGGGACCCTGTCCGTGGTCATGG + Intergenic
1027987918 7:85318562-85318584 CTGGGGCCTGTCAGTGGGTAGGG - Intergenic
1029169065 7:98617969-98617991 AGGGGGCCTGGCCCTGGGGAGGG + Intronic
1032635031 7:133697599-133697621 AGGGGCCTTGGCCATAGGTATGG + Intronic
1033639417 7:143246900-143246922 AGGGGCCCTGACCTTGGCTGAGG - Intronic
1034413047 7:150951162-150951184 AGGGTCCCTGTGGGTGGGTGGGG - Intronic
1036258360 8:7222186-7222208 AGAGGGCCTGTCCATGGGCAAGG - Intergenic
1036259421 8:7228330-7228352 AGCGGGCCTGTCCATGGGCAAGG - Intergenic
1036307204 8:7611194-7611216 AGCGGGCCTGTCCATGGGCAAGG + Intergenic
1036310414 8:7680782-7680804 AGCGGGCCTGTCCATGGGCAAGG - Intergenic
1036311463 8:7686900-7686922 AGCGGGCCTGTCCATGGGCAAGG - Intergenic
1036358046 8:8059181-8059203 AGCGGGCCTGTCCATGGGCAAGG + Intergenic
1036892901 8:12607765-12607787 AGCGGGCCTGTCCATGGGCAAGG - Intergenic
1039273945 8:35914272-35914294 CTGGGGCCTGTCGGTGGGTAGGG + Intergenic
1043321972 8:78998788-78998810 GGGGGGCCTGTCAGGGGGTAGGG - Intergenic
1043623507 8:82227416-82227438 AGTGGCCCTGCCACTGGGTAGGG - Intergenic
1047162149 8:122392550-122392572 CCTGGCCCTGTCCTTGGGTATGG - Intergenic
1049103635 8:140597512-140597534 AGGGGCCCTTTCCTGGGGGATGG + Intronic
1051181814 9:14419430-14419452 GTGGGCCCTGTCTGTGGGCATGG - Intergenic
1052003479 9:23317503-23317525 CCGGGGCCTGTCGGTGGGTAGGG - Intergenic
1053024856 9:34720969-34720991 AGGGACCGTGTCTGTGGGAAGGG - Intergenic
1053036163 9:34828125-34828147 AGGGGCCGTGGCTGTGGGAAGGG - Intergenic
1059421284 9:114194086-114194108 AGGGACCCTCTCTGTGGGTTTGG + Intronic
1061727929 9:132591240-132591262 AGCGGACCTGGCTGTGGGTATGG - Intergenic
1061764529 9:132873412-132873434 AGGGTCCCTGACAGTGGGGAGGG + Intronic
1061924918 9:133801268-133801290 AAGGGCCCTGGCCGTGGGACGGG + Intronic
1203731907 Un_GL000216v2:98890-98912 AGTGGGCCTGCCCGCGGGTAAGG - Intergenic
1187776783 X:22769156-22769178 CTGGGGCCTGTCGGTGGGTACGG + Intergenic
1193516244 X:82468427-82468449 CTGGGCCCTGTCGGTGGGTGGGG - Intergenic
1195177228 X:102322856-102322878 AGGGGCCCTGTCACTGGGAGCGG + Intronic
1195181636 X:102364237-102364259 AGGGGCCCTGTCACTGGGAGCGG - Intronic
1196141382 X:112266623-112266645 AGGGGCCCTGTTCCAGTGTATGG - Intergenic
1198309361 X:135414978-135415000 CTGGGGCCTGTCGGTGGGTAGGG + Intergenic
1199261983 X:145785344-145785366 CGGGGGCCTGTCAGTGGGTGGGG + Intergenic
1199712247 X:150477614-150477636 AGTGCCCCTGACCGTGGGTAGGG + Intronic
1199746388 X:150774451-150774473 AGGATCCCTGGCCGTGGGGAAGG + Intronic