ID: 1146521452

View in Genome Browser
Species Human (GRCh38)
Location 17:33528590-33528612
Sequence GAATAATGCTTGGGTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146521452 Original CRISPR GAATAATGCTTGGGTAAAGG TGG Intronic
901342737 1:8509992-8510014 GAATCTTGCTTGGGCAAAGGTGG + Intronic
904551226 1:31320491-31320513 GAATAATGATTGCCTAAAGCTGG - Intronic
906443908 1:45876642-45876664 GAATATTCCCTGGGAAAAGGAGG + Intronic
908472958 1:64462371-64462393 GAGTATTGCTTGGGTCTAGGAGG - Intergenic
908649388 1:66315070-66315092 GAATGATGTATGGGTAAAGGTGG - Intronic
910293600 1:85622621-85622643 GAGTAACGCTTGGGTAGGGGTGG + Intergenic
911018878 1:93366337-93366359 GAATAATGCTTCTGTGAACGTGG + Exonic
911489812 1:98550077-98550099 GAATAATGCTTCCTTAATGGTGG - Intergenic
913101538 1:115572226-115572248 GAAGATTGCTTGAGTACAGGAGG + Intergenic
913549919 1:119907371-119907393 GCAGAATGCTTGGGTGAGGGTGG + Intergenic
914235632 1:145808511-145808533 AAATAATGGTTGGGCAAAGGAGG - Intronic
914935493 1:151975713-151975735 GAATAATGCTTGGCATAAGTTGG - Intergenic
916636924 1:166681380-166681402 AAATAACTCTTGGGTAAAAGAGG - Intergenic
917907447 1:179601358-179601380 GTATACTGCTTGGGTGATGGGGG - Intronic
918685598 1:187410812-187410834 GAAAGATGCTTGGGTTATGGGGG + Intergenic
921664603 1:217853057-217853079 GAATACTGCTTGGCTTAAGTAGG + Intronic
921828696 1:219702844-219702866 GGAAAATGCATGGGTAAGGGAGG - Intronic
921959394 1:221018969-221018991 TAATCTTGCTTGGGTATAGGAGG - Intergenic
922030575 1:221793713-221793735 GAAAAATGCATGGGGAAAGAGGG + Intergenic
924116058 1:240748379-240748401 GAATAATGCTGGGGTGAACCTGG - Intergenic
924837399 1:247665653-247665675 AAATACTGCTGGGGAAAAGGTGG + Intergenic
924890692 1:248275551-248275573 GCAGAATGCATGGATAAAGGAGG + Intergenic
1063046977 10:2401707-2401729 GAATAATGTTTGCCTAATGGTGG + Intergenic
1063782572 10:9343185-9343207 GAACAATTTTTGGGAAAAGGAGG - Intergenic
1063877190 10:10492620-10492642 GAATAATGCTGCTGTAAACGTGG - Intergenic
1064881198 10:20056262-20056284 GAATAATACTTGGGACAAAGGGG - Intronic
1069046492 10:63749025-63749047 GAAAACTGCTTGAGAAAAGGTGG - Intergenic
1069704427 10:70448961-70448983 GAAGATGGCTTGGGTACAGGAGG + Intergenic
1070844664 10:79512521-79512543 GTAAAATGCCTGGGTAGAGGCGG + Intergenic
1070929139 10:80247787-80247809 GTAAAATGCCTGGGTAGAGGCGG - Intergenic
1072231527 10:93417848-93417870 GCAGAATGTTTGGATAAAGGGGG - Intronic
1073089381 10:100921678-100921700 GAATAATGCCTGAGCAAAGCAGG + Intronic
1073228805 10:101948493-101948515 GAATACTACCTGGGTGAAGGAGG + Intronic
1073862032 10:107755910-107755932 AAATAATGCATGGGTCAAAGAGG + Intergenic
1075922689 10:126226163-126226185 GCATAATCCCTGGGGAAAGGTGG + Intronic
1077310175 11:1885022-1885044 GAGTACTGGTTGGATAAAGGGGG - Intronic
1078179634 11:9000460-9000482 GAATGATGCTGGGGGAAAGATGG - Intronic
1079144331 11:17837370-17837392 GTGTGATGTTTGGGTAAAGGGGG + Intronic
1079413504 11:20211389-20211411 GAATATTGCTTGGGAACAAGGGG + Intergenic
1082870482 11:57940156-57940178 GAATAATGCTAGGGGAAGTGAGG - Intergenic
1083438089 11:62656828-62656850 GAATGATGCTTGGTAATAGGTGG - Intronic
1085389341 11:76174652-76174674 GAATAATGCATGGATAAACATGG - Intergenic
1086676407 11:89612593-89612615 GGATAATGCTTGAATAAAAGAGG - Intergenic
1087132078 11:94677342-94677364 GGATAATGATGGGGTAAAAGGGG - Intergenic
1087299304 11:96413719-96413741 GACTACTGCTTGGGAAAAGAAGG + Intronic
1088981868 11:114871427-114871449 GAAAAAGGTTTTGGTAAAGGAGG - Intergenic
1089551924 11:119285804-119285826 GAATATTGCTTGGGCCCAGGAGG + Intronic
1089897355 11:121944546-121944568 AAATAATTCTTGGGTCAAGGAGG - Intergenic
1090309439 11:125721775-125721797 GGATAATCCTGGGGAAAAGGAGG - Intergenic
1092058652 12:5529075-5529097 GAATAATCCTTTGGTTAAAGCGG - Intergenic
1092829986 12:12434191-12434213 GAAGATTGCTTGGGTCCAGGAGG + Intronic
1094342806 12:29431458-29431480 GAATATTGGTTGCTTAAAGGAGG - Intronic
1094739085 12:33268117-33268139 GAATAATGCTGCAGTAAATGTGG - Intergenic
1095632907 12:44398775-44398797 GAATAATGCTTTGCTAAGGCAGG + Intergenic
1098158170 12:67621855-67621877 GGATAAGGCTTTGGTAAATGGGG + Intergenic
1099046708 12:77729479-77729501 GAAAAAGGCATGGGAAAAGGAGG + Intergenic
1100325918 12:93539867-93539889 GTCTTATGCTTGGGCAAAGGTGG + Intergenic
1102574653 12:113848732-113848754 GAAAAACGCTTGGGAGAAGGTGG - Intronic
1103141464 12:118552416-118552438 GAATAATTCTTGGTTATGGGGGG + Intergenic
1106061352 13:26295770-26295792 TGTTAATGCTTGGGGAAAGGAGG - Intronic
1106712458 13:32352570-32352592 AAAGAATGCTTGGTTAAAGATGG + Intronic
1107979254 13:45718673-45718695 AAAGAATGCTTGCGTTAAGGAGG - Intergenic
1109190428 13:59316239-59316261 GGATCATGCTTGGGTCAAGCTGG + Intergenic
1109279760 13:60342322-60342344 CAATAATGTATGGGGAAAGGAGG - Intergenic
1109855205 13:68118225-68118247 GATTAATGCTTTGGGAAAGCTGG - Intergenic
1110831858 13:80041139-80041161 GAAAAATGCTGGGTTAAGGGGGG - Intergenic
1110965923 13:81697099-81697121 GAATAGTGCTTCGATAAACGTGG - Intergenic
1112932398 13:104758248-104758270 GAATAATGCTTCAGTGAATGTGG - Intergenic
1113527059 13:110988159-110988181 GAATTATCCTTGGGGAAACGGGG + Intergenic
1115856627 14:37636514-37636536 GAATAATCCATGGGTCAAAGAGG + Intronic
1118593917 14:67421438-67421460 GAATAAAGGTTGGGTGAATGGGG + Intergenic
1119251617 14:73160330-73160352 GAATAATGCTATGGTGAAAGTGG + Intronic
1119608145 14:76038853-76038875 GAATAATGGATGGGTCATGGTGG + Intronic
1120283350 14:82466355-82466377 GAATGATTCTTGGGTAAATAAGG + Intergenic
1125496880 15:40204724-40204746 GAGGAATGCTTGAGTACAGGAGG - Intronic
1126148703 15:45502473-45502495 GAAGATTGCTTGGGTCCAGGAGG - Intronic
1127873078 15:63089415-63089437 GGATAATGCTTGTGTAGAGATGG + Intergenic
1130373093 15:83304059-83304081 GAAAAATGCCTGGGAAAATGTGG + Intergenic
1130880620 15:88052709-88052731 GAAAAATCTTTGGGTAATGGAGG + Intronic
1134278890 16:12800929-12800951 AAATAATGCTTGGCTACTGGTGG - Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135917373 16:26617143-26617165 GTATACTGCTTGGGTGATGGGGG - Intergenic
1136101218 16:27997782-27997804 GGACACTGCTTGGGTAATGGGGG - Intronic
1137836732 16:51599130-51599152 GAAGATTGCTTGAGTACAGGAGG - Intergenic
1139010730 16:62630144-62630166 AAATAATTCTTAGGTAAAAGAGG - Intergenic
1139168825 16:64605298-64605320 AAATAATCCATGGGTAAAGGAGG + Intergenic
1143309252 17:5975012-5975034 GAACAATTATTGGGAAAAGGTGG - Intronic
1144283089 17:13746227-13746249 GAATAAAGCTTGGGAAAATGAGG - Intergenic
1145192996 17:20863594-20863616 CACTAATGCTTGGGTCAAGTGGG + Exonic
1145403408 17:22565598-22565620 CACTAATGCTTGGGTCAAGTGGG + Intergenic
1145723503 17:27094238-27094260 CACTAATGCTTGGGTCAAGTGGG - Intergenic
1146521452 17:33528590-33528612 GAATAATGCTTGGGTAAAGGTGG + Intronic
1146800824 17:35819713-35819735 GAATTATGCTTGGGTGTGGGGGG - Intronic
1150537768 17:66061476-66061498 GAATAATGCTGCAGTAAATGTGG - Intronic
1151166596 17:72209198-72209220 GAATCATGCCAGGGTATAGGGGG + Intergenic
1151850548 17:76687204-76687226 GAATGAAGCTTGGGTGCAGGCGG - Intronic
1153493743 18:5676310-5676332 GAATAATGCTGCGGTAAACATGG - Intergenic
1155440802 18:25860663-25860685 GAAAAAGGCTTTGGAAAAGGTGG - Intergenic
1156038176 18:32789353-32789375 TAATAATGCTTGGGAAAAGTCGG - Intergenic
1159062902 18:63534795-63534817 GTATAATGATTGGGTGGAGGAGG + Intergenic
1159257115 18:65961128-65961150 GAACAATGCTGGGGTAAAGGAGG + Intergenic
1164499021 19:28796784-28796806 GAATCATGCTTGGGGAAGGGAGG + Intergenic
1165216646 19:34279078-34279100 GAATAATGCTTCGGTGAACATGG + Intronic
1167812711 19:51848436-51848458 GAATAATGCTTCAGTAAATGTGG - Intergenic
925126285 2:1459707-1459729 GAATAATATTGGGGGAAAGGTGG + Intronic
927587713 2:24323559-24323581 CAATAATACATGGCTAAAGGTGG + Intronic
928835781 2:35542867-35542889 GAATAATGCATCAGTAAACGTGG - Intergenic
929449110 2:42024962-42024984 GGATGATGGTGGGGTAAAGGAGG - Intergenic
929784567 2:44979970-44979992 TGATAATGCTTGGATAAATGAGG - Intergenic
930764326 2:55069636-55069658 GAAGAATGCTTGGGTGGAGGAGG - Intronic
932451734 2:71814939-71814961 GGACAGTGCTTGGGTAAAAGAGG + Intergenic
933589465 2:84215760-84215782 AAATAATGGTTGGGTAAACCTGG - Intergenic
933893713 2:86791959-86791981 GGTGAATGCTTGGGTAGAGGCGG + Intronic
934607613 2:95709056-95709078 GATTATGGCTTGGGTAAAGGTGG - Intergenic
937999174 2:127719256-127719278 GAATAATACCTGGTTGAAGGGGG + Exonic
938046828 2:128129047-128129069 GAATGAAGCTCGGGTAATGGAGG + Exonic
939706555 2:145460734-145460756 GAAAAATGTGTGGGTAAGGGAGG - Intergenic
939934747 2:148277235-148277257 GAATAATATTTGGGTAATAGGGG + Intronic
940201451 2:151155778-151155800 CAATAGTTCTTGGGTACAGGTGG - Intergenic
941166498 2:162088705-162088727 GAAAAATGCTTGGGTCAGGGAGG - Intergenic
941285299 2:163604859-163604881 GAAGAATGGTTGGGGAATGGGGG + Exonic
941802155 2:169671824-169671846 GAATAGTGCCTGGCAAAAGGAGG + Intronic
945684914 2:212957614-212957636 GAATAAGGCTTGTGTAAGGAAGG + Intergenic
947784601 2:232804844-232804866 AAATAATCCATGGGTAAAAGAGG - Intronic
947798756 2:232913237-232913259 CAATAATCCCTGGGTCAAGGAGG - Intronic
948033840 2:234841740-234841762 GGATCATGCTTGGGTGAAGCAGG + Intergenic
1169456263 20:5755079-5755101 GAGAAATGCTTGAGTTAAGGGGG + Intronic
1170466821 20:16629774-16629796 GAATAGAGCTTGGAGAAAGGGGG + Intergenic
1170559195 20:17541306-17541328 GAATAGTGCTTGGCCAAAGATGG + Intronic
1171277751 20:23872758-23872780 GCATAGTGCATGGGCAAAGGAGG - Intergenic
1172066746 20:32226716-32226738 GAATTATCCTTGGGTCAGGGAGG - Intronic
1177204298 21:17994263-17994285 GCAGCATGCTTGGGTACAGGTGG + Intronic
1177804988 21:25866403-25866425 AAATAATTCTTGGATAGAGGTGG - Intergenic
1180882467 22:19215741-19215763 GAACAAAGCTTGGAGAAAGGTGG - Intronic
1182119919 22:27779855-27779877 GAACAATGCCTGGGGGAAGGAGG + Intronic
1183758456 22:39792873-39792895 GAATAATGCTTCAGTAAACACGG + Intronic
949260059 3:2095744-2095766 GAATAAGGCAGGGGTAATGGGGG + Intergenic
951501813 3:23396845-23396867 GCATAATGCTTGGCTACAGCAGG - Intronic
955933733 3:64082681-64082703 TGATAGTGCTTGGGAAAAGGAGG - Intergenic
960605105 3:119497082-119497104 GAATTATTCTGGGGTGAAGGAGG - Intergenic
963443401 3:145370696-145370718 GAATAAATCTTGGGAGAAGGTGG - Intergenic
963727652 3:148940034-148940056 GAATAAGGCTTGGGATAAAGTGG - Intergenic
964874852 3:161355401-161355423 GAATAATGCTTCTGTGAATGTGG - Intronic
965493185 3:169365470-169365492 AAATCATACTTGGGGAAAGGAGG - Intronic
970480533 4:16468505-16468527 TACTAATTCTTGTGTAAAGGGGG + Intergenic
971372078 4:26027828-26027850 GAAGAAAGCTTGTGTGAAGGTGG + Intergenic
975070133 4:70124737-70124759 GAATATTGCTGGGGTAAACATGG - Intergenic
975599444 4:76084017-76084039 GAATAACCCTGGGGTAAAAGAGG - Intronic
975759313 4:77603367-77603389 GAATAGTGCTAGGACAAAGGAGG + Intronic
977079986 4:92513464-92513486 GAATTATTTTTGAGTAAAGGTGG - Intronic
977570867 4:98628093-98628115 GCATACTGCTTGAGTTAAGGAGG - Intronic
978201148 4:106024688-106024710 GTATACTGCTTGGGTGATGGAGG - Intergenic
979050911 4:115931356-115931378 GAATATTACTTGTGTAATGGTGG + Intergenic
979457278 4:120941229-120941251 AAATACTGCAAGGGTAAAGGTGG - Intergenic
981204248 4:142019976-142019998 GAAGATTGCTTGGGAAAAAGAGG + Intergenic
981991867 4:150931340-150931362 TAATAATGCTTGGCTGACGGTGG + Intronic
983034746 4:162849751-162849773 GAAAAATTCTTGGGGAAAGCTGG + Intergenic
983655532 4:170079972-170079994 AAATAATGGCTGGGTAGAGGAGG + Intronic
983982892 4:174020902-174020924 GAATCATGCTTTGGTGAAGTAGG + Intergenic
984291531 4:177801276-177801298 GAATAATGCTGCAGTAAAGATGG + Intronic
985058039 4:186052165-186052187 GAATAAGGATTGGGAAAAAGAGG + Intergenic
992273578 5:75091257-75091279 GAATTATGCTTGGAGTAAGGTGG - Exonic
994141679 5:96348344-96348366 GAATAATGCTAGTTTGAAGGAGG + Intergenic
994612734 5:102065357-102065379 GACTCATCCTTGGGGAAAGGAGG + Intergenic
995098867 5:108273485-108273507 GAATAACTCTTGGATAAATGAGG + Intronic
995166789 5:109052949-109052971 AAATCATGCATGGGTAAAAGAGG - Intronic
996511648 5:124323081-124323103 GAAATATGATTGGATAAAGGGGG - Intergenic
997334598 5:133097932-133097954 GAATAGCTCTTGGGTACAGGTGG + Intronic
999630406 5:153564966-153564988 TAAAAATTCTTGGGCAAAGGAGG - Intronic
999970418 5:156855580-156855602 AAAAAATACTTGGGTACAGGAGG + Intergenic
1000031108 5:157402155-157402177 GAAGAATGCTTGGGTGGAGGTGG - Intronic
1000473850 5:161680292-161680314 TAATAATGCTAGAATAAAGGAGG + Intronic
1003609944 6:7603480-7603502 AAGAAATGCTTGGGAAAAGGAGG - Intronic
1004804404 6:19187110-19187132 AAATAATTCTTGGGTCAAAGAGG + Intergenic
1006057246 6:31394427-31394449 GATTAAGGCTGGGGTAAAGCTGG + Intergenic
1006069663 6:31489075-31489097 GATTAAGGCTGGGGTAAAGCTGG + Intergenic
1006693618 6:35911923-35911945 GAAAAATCTTTGGGTAAGGGAGG + Intronic
1007399394 6:41595136-41595158 GACTAGTGCTTGGGGACAGGGGG + Intronic
1008956850 6:57224811-57224833 AAATAATGCTTGTGTCAAAGTGG - Intergenic
1009867580 6:69416484-69416506 GTATACTGCTTGGGTGATGGGGG + Intergenic
1012589884 6:100968406-100968428 GAATAAATCTTGGGTAAATAAGG + Intergenic
1014931161 6:127337779-127337801 GAATAATGGTTGAGTATGGGAGG - Intronic
1016402676 6:143697774-143697796 GAATAAGTCATGGGTAAATGTGG - Intronic
1018636013 6:165860090-165860112 GTATACTGCTTGGGTGATGGGGG + Intronic
1019266895 7:122229-122251 GAACAATTCTTGGGTCAAGTGGG + Intergenic
1020049084 7:5070196-5070218 GACTAATGCTTTGCTGAAGGAGG + Intronic
1020472094 7:8549398-8549420 GAATAAAGCCTGGATAAATGAGG - Intronic
1023950901 7:44844160-44844182 GAATAATGCTTCTGTGAACGTGG - Intronic
1023971274 7:44992784-44992806 GAATAATCCTTAGGCCAAGGAGG + Intergenic
1024686807 7:51755004-51755026 TAACAATGCTTCGGCAAAGGAGG - Intergenic
1024877320 7:54040877-54040899 GAATAAAAACTGGGTAAAGGAGG - Intergenic
1027260273 7:76460031-76460053 GGAAAATGTTTGGATAAAGGAGG - Intergenic
1027311648 7:76958139-76958161 GGAAAATGTTTGGATAAAGGAGG - Intergenic
1027993730 7:85396837-85396859 AAAGAATGCTTGAGTTAAGGAGG + Intergenic
1031028089 7:116703374-116703396 GATTGATGAATGGGTAAAGGAGG - Intronic
1037354313 8:18000577-18000599 GAAGAAGGCTTGGGAGAAGGGGG + Intronic
1037369146 8:18155022-18155044 GAATAGTGCTTCAGTAAACGTGG - Intergenic
1037528401 8:19750171-19750193 GAATAAGGTTTGGGTACAAGGGG - Intronic
1038572900 8:28678377-28678399 GAGAGATGCTTGGGTAATGGGGG + Intronic
1041568177 8:59304417-59304439 AAGTAATGCCTGAGTAAAGGTGG - Intergenic
1042455492 8:68997406-68997428 GAGGAATGCTTGAGTCAAGGAGG + Intergenic
1045771897 8:105751541-105751563 GAATTATGCTTAGGGAAAGAAGG + Intronic
1048392864 8:133984743-133984765 GAATAATGCCTGGGTGAATTGGG + Intergenic
1049465013 8:142747113-142747135 GAATAATGTATGGCTAAAAGGGG + Intergenic
1051800939 9:20933287-20933309 GTATACTGCTTGGGTGATGGGGG - Intronic
1051901460 9:22047137-22047159 GAGCAATGCTTGAGCAAAGGAGG - Intergenic
1053068758 9:35088211-35088233 GAATAATGAATGGGACAAGGTGG + Intergenic
1053469452 9:38335759-38335781 GAAAGATGCTTTGGGAAAGGTGG + Intergenic
1053482755 9:38428197-38428219 GGAGAATGCTTGGGTAGATGTGG - Intergenic
1056073034 9:83008417-83008439 GGATACGGCTTGGGGAAAGGTGG - Intronic
1059000167 9:110340458-110340480 CAATAATGCTTTGTTATAGGGGG + Intergenic
1061819586 9:133218943-133218965 AAATGATGTTTGGGTAAAGAAGG + Intergenic
1061956770 9:133967452-133967474 GAATAGTGCTACGGTAAAGGTGG - Intronic
1186158696 X:6753064-6753086 ATATACTGCTTGGGTAATGGAGG - Intergenic
1188987092 X:36777664-36777686 AAGAAATGCATGGGTAAAGGTGG - Intergenic
1189864459 X:45311054-45311076 CAATAATTCTTGGGTCAAGTGGG - Intergenic
1190138756 X:47821724-47821746 AATTAATACTTGGGTTAAGGAGG + Intergenic
1191692591 X:63956321-63956343 GTATACTGCTTGGGTAATGGGGG + Intergenic
1192060445 X:67819726-67819748 GAATAATCCTTGTGTAGAGAAGG - Intergenic
1192439754 X:71165891-71165913 GAATAATCTTTGGGAAAATGAGG + Intronic
1199211691 X:145219559-145219581 GAAGTATGATTGGGTAAACGGGG - Intergenic
1199318268 X:146406725-146406747 GAATAAAGTCTGGGTAAAGAAGG - Intergenic
1201700826 Y:16879606-16879628 GAGAAATGCTTGAGTTAAGGGGG + Intergenic
1201933772 Y:19384022-19384044 GAATGATACTTGGGTAAATAAGG - Intergenic