ID: 1146524137

View in Genome Browser
Species Human (GRCh38)
Location 17:33551736-33551758
Sequence TTACATCGAAGGGATCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146524137_1146524140 1 Left 1146524137 17:33551736-33551758 CCATCAGGATCCCTTCGATGTAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1146524140 17:33551760-33551782 AGCCAGATATTGTCCTCACAAGG 0: 1
1: 0
2: 0
3: 9
4: 110
1146524137_1146524143 9 Left 1146524137 17:33551736-33551758 CCATCAGGATCCCTTCGATGTAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1146524143 17:33551768-33551790 ATTGTCCTCACAAGGGAACTTGG 0: 1
1: 0
2: 0
3: 17
4: 211
1146524137_1146524145 17 Left 1146524137 17:33551736-33551758 CCATCAGGATCCCTTCGATGTAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1146524145 17:33551776-33551798 CACAAGGGAACTTGGCAGCATGG 0: 1
1: 0
2: 0
3: 13
4: 233
1146524137_1146524141 2 Left 1146524137 17:33551736-33551758 CCATCAGGATCCCTTCGATGTAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1146524141 17:33551761-33551783 GCCAGATATTGTCCTCACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146524137 Original CRISPR TTACATCGAAGGGATCCTGA TGG (reversed) Intronic
902620195 1:17646322-17646344 TTTCATCAAAGAGATCCTGCCGG - Intronic
912976478 1:114335586-114335608 TTACAGAGAAAGCATCCTGAAGG + Intergenic
1064794119 10:18992013-18992035 TTACATCAAAGGGATTTTGTGGG - Intergenic
1080485190 11:32698546-32698568 TTACATTAGAAGGATCCTGAAGG - Intronic
1082005908 11:47418876-47418898 CTACATGGAAGGCATCCTGGAGG - Exonic
1085982321 11:81739441-81739463 TGACATGGAAGGGATCCAGTGGG - Intergenic
1088546837 11:110967741-110967763 GTAAATCGAAGTGATCCAGAAGG - Intergenic
1089619539 11:119714416-119714438 GTACATCACAGGGATCCTGCAGG - Intronic
1091107386 11:132935610-132935632 TTAAATCAAAGAGATGCTGAAGG - Intronic
1091913955 12:4254161-4254183 TCACATCAGAGAGATCCTGATGG - Intergenic
1092648502 12:10606363-10606385 TTAAATTTTAGGGATCCTGAAGG - Exonic
1114824313 14:26058438-26058460 TCACATGGAAGGGACTCTGAGGG + Intergenic
1124692658 15:31838698-31838720 TTACTCCTAAGTGATCCTGAGGG + Intronic
1128288712 15:66460515-66460537 CTACAACAAAGGGTTCCTGATGG + Intronic
1137446647 16:48536204-48536226 TGACATGCCAGGGATCCTGAGGG + Intergenic
1138708281 16:58940125-58940147 TGAAATGCAAGGGATCCTGATGG - Intergenic
1139169305 16:64611872-64611894 TTGCATCGCAGGGATCATGATGG + Intergenic
1146524137 17:33551736-33551758 TTACATCGAAGGGATCCTGATGG - Intronic
1148701766 17:49591620-49591642 TTTCAGGGAAGGGACCCTGATGG - Intergenic
1149586039 17:57787504-57787526 TTACATGGGCTGGATCCTGAAGG - Intergenic
1154120628 18:11649088-11649110 TTACATAGAAGCGATCCTTCAGG - Intergenic
1156613092 18:38750768-38750790 TTGCAACCAAGGGATCCAGAAGG + Intergenic
1165596606 19:37014925-37014947 ATACATCATAGGGATCCTTAGGG - Intronic
1168552280 19:57306680-57306702 TTACATTGAAGGGGTCCCTACGG - Intergenic
925877411 2:8324732-8324754 TTACATAGAAGGGAGAGTGAAGG - Intergenic
930752875 2:54949261-54949283 CTCCATGGAAGGGATGCTGAGGG - Intronic
932120982 2:69099917-69099939 TTACATTGAAAGCTTCCTGATGG - Intronic
933464774 2:82638693-82638715 TTACATGGAAGGGACCCAGTGGG + Intergenic
946576940 2:221085994-221086016 TTTCATAGTAGGGATCTTGAAGG + Intergenic
1177865484 21:26508014-26508036 TTACCTATGAGGGATCCTGAAGG + Intronic
1179051342 21:37891012-37891034 TTAAACACAAGGGATCCTGAGGG + Intronic
1183330139 22:37215018-37215040 TTACAGATAAGGAATCCTGAAGG - Intergenic
956787824 3:72656873-72656895 GTACATCTAAGGAACCCTGAGGG + Intergenic
957321060 3:78630768-78630790 CCACAACGATGGGATCCTGAAGG - Intronic
958513273 3:95077407-95077429 ATACATGGAAGGGATCCCAAAGG + Intergenic
959681738 3:109104348-109104370 CTACTTAGAAGGGAGCCTGATGG - Intronic
962972122 3:140411769-140411791 CTGCCTCGAAGGGATCCTTATGG - Intronic
972400821 4:38701985-38702007 TTACATTGCAGGGATGCAGAGGG - Intergenic
977227434 4:94409910-94409932 TTATATCTAAGTGATCCTCAGGG - Intergenic
978121536 4:105085316-105085338 TGACATCGAGGAGATCCTGCAGG - Intergenic
979700161 4:123657891-123657913 TGTCATGGAAGGGATCCCGAGGG - Intergenic
996746351 5:126849528-126849550 GTACATCCAAGTTATCCTGATGG + Intergenic
999422163 5:151454336-151454358 TTTCATCAAAGGGAGCCTAAGGG + Intronic
1000647218 5:163773451-163773473 TTACATCAAGGGCATCCTAATGG - Intergenic
1000844825 5:166266345-166266367 TTACATGAAAGAGATCGTGAAGG - Intergenic
1012054894 6:94393823-94393845 TCACCTCCAAGGGTTCCTGATGG - Intergenic
1018182620 6:161237424-161237446 TTACATCCAAGTGGTGCTGAAGG - Intronic
1019940388 7:4284640-4284662 TTACATCATAGAGATCCGGAAGG - Intergenic
1021430571 7:20554202-20554224 TTACATAGCAAGGAGCCTGAAGG + Intergenic
1023469959 7:40507041-40507063 TTCCTTTGAAGAGATCCTGATGG - Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1050945464 9:11511322-11511344 TTACATCTAAGTCATGCTGATGG - Intergenic
1051618380 9:19028071-19028093 CTACATGGAAGGCATCCTGGAGG + Intronic
1055415696 9:76080337-76080359 TTACAAAGAAGGGATTCTGAAGG - Intronic
1057572010 9:96211637-96211659 TTAAATGGGAGGGATACTGAGGG - Intergenic
1062398452 9:136362158-136362180 AAATATCGAAGAGATCCTGACGG - Exonic
1188423413 X:30016322-30016344 TTACTCCCAAGGGATTCTGATGG + Intergenic