ID: 1146525666

View in Genome Browser
Species Human (GRCh38)
Location 17:33565031-33565053
Sequence TTCGGGGATCTCAGCTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1093
Summary {0: 4, 1: 117, 2: 355, 3: 329, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146525666 Original CRISPR TTCGGGGATCTCAGCTCTGA AGG Intronic