ID: 1146530501

View in Genome Browser
Species Human (GRCh38)
Location 17:33604089-33604111
Sequence CTGCAGGCTGAAAGGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 457}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146530496_1146530501 16 Left 1146530496 17:33604050-33604072 CCTAGAAAATGTAGTCTAGTTAT 0: 1
1: 0
2: 2
3: 19
4: 249
Right 1146530501 17:33604089-33604111 CTGCAGGCTGAAAGGGAGCCTGG 0: 1
1: 0
2: 9
3: 52
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146530501 Original CRISPR CTGCAGGCTGAAAGGGAGCC TGG Intronic
900246781 1:1640025-1640047 CTGCGGCTTGAAAGGCAGCCTGG - Intronic
900258003 1:1707157-1707179 CTGCGGCTTGAAAGGCAGCCTGG - Intronic
900330068 1:2129750-2129772 ATGGAGGCTGAGAGGAAGCCTGG - Intronic
900547402 1:3236488-3236510 TTGCAGGCTGGAAGGGAGTGGGG + Intronic
900851863 1:5150140-5150162 CTGCAGTCTCCAAGGGAGGCTGG + Intergenic
900895673 1:5481392-5481414 GTGGAGGCTGAAAGGGGCCCTGG - Intergenic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
901115522 1:6840782-6840804 CAGGAGGCTGCAGGGGAGCCAGG + Intronic
901439242 1:9267475-9267497 CTGCAGGATGAAGGGCAGGCCGG + Exonic
901627486 1:10632214-10632236 CTCCAGGGAGAAATGGAGCCGGG - Intergenic
901758055 1:11453361-11453383 TTGCAGCCTGAACTGGAGCCTGG - Intergenic
904280178 1:29413463-29413485 CAGCAAGTAGAAAGGGAGCCAGG + Intergenic
904499718 1:30907152-30907174 CCCCAGGCTGAAAAGGACCCAGG - Intronic
904612014 1:31731094-31731116 CTGCAGGCTCAAAGTCCGCCGGG + Exonic
905414655 1:37795497-37795519 CGCCAGGCCGGAAGGGAGCCAGG - Intronic
905882024 1:41470187-41470209 CTACAGGCTGAGAGGCAACCAGG + Intergenic
906004054 1:42454060-42454082 CTGAAGGATGAAAGGGAGCCAGG + Intronic
907153069 1:52306788-52306810 CTGCAGCCTGGCAGAGAGCCAGG + Intronic
907464428 1:54625305-54625327 CTGCTGGCTGGAATGGAGCAGGG + Intronic
908271968 1:62430949-62430971 CTGCAGGCTTCAGAGGAGCCTGG + Intergenic
909828357 1:80154260-80154282 CTGTAGGCTGCATGGGAGCTGGG - Intergenic
910017157 1:82539803-82539825 CTGCACTCTGACAGGGAGCATGG - Intergenic
910243709 1:85116064-85116086 CAGCAAGGTGAAATGGAGCCAGG - Intronic
910565643 1:88639772-88639794 GTGCAGGCTGAAAGAGAGAAAGG + Intergenic
910758798 1:90716497-90716519 CTGAAGGCTGAAGGGGAGATTGG + Intronic
911104054 1:94116331-94116353 CTGCAGGCTGAAAACATGCCGGG + Intronic
911265912 1:95742972-95742994 CTGCAGGCTGCGTGGGAGCAGGG - Intergenic
911435091 1:97845896-97845918 CTGCAGCCTCACATGGAGCCGGG + Intronic
912457481 1:109807558-109807580 CTGCAGGGTGGAAGGCAGCCTGG + Intergenic
913680733 1:121185788-121185810 CCTGAGGCTGGAAGGGAGCCCGG - Intronic
914032565 1:143973430-143973452 CCTGAGGCTGGAAGGGAGCCCGG - Intergenic
914156881 1:145094537-145094559 CCTGAGGCTGGAAGGGAGCCCGG + Intronic
914225853 1:145719019-145719041 CTCCAGGCTGAAAGGGAAGAAGG - Intergenic
914789831 1:150867928-150867950 CCGCAGGCTGTATGGGAGGCAGG - Intronic
914866881 1:151437824-151437846 CTGAAGGCTTAAAGGGAAACTGG + Intronic
915311361 1:155007371-155007393 CTGCAGCCTGCAAGGGAGTGGGG - Intronic
915884614 1:159709449-159709471 CTGCAAGCTTAGTGGGAGCCAGG + Intergenic
916138720 1:161675358-161675380 CTGCCGGCTGGACTGGAGCCAGG + Intronic
916206181 1:162318413-162318435 ATGCAGACAGAAAGCGAGCCAGG - Intronic
918589209 1:186222004-186222026 CTGCAGGCTGCATGGGAGTAGGG + Intergenic
919237591 1:194866270-194866292 CTGCAGGCTGTACAGGAGCATGG - Intergenic
919520609 1:198582922-198582944 CTGCAGGCTGCATGGGAGCAGGG - Intergenic
919816662 1:201445129-201445151 CTGCAGGCAGAAAGGGAGGTAGG + Intergenic
920210700 1:204326178-204326200 CTGCCAGCTGAAACAGAGCCCGG + Intronic
920338266 1:205259270-205259292 CAGCAGGCTGACAGGGAGAAAGG - Intronic
920468045 1:206204314-206204336 CCTGAGGCTGGAAGGGAGCCCGG - Intronic
920915923 1:210257930-210257952 CTGCAGCTTGAGAAGGAGCCAGG - Intergenic
921324818 1:213979932-213979954 CAGTAGGCTGAGAGGGCGCCGGG + Intergenic
921762898 1:218937428-218937450 CTGCGGGCTGAGTGGGAGCTGGG - Intergenic
921958767 1:221012273-221012295 CTGCAGGATAAAATGGAGCCTGG - Intergenic
922613859 1:226949194-226949216 CTGGAGGCTGGAAAGGAGGCCGG + Intronic
922730016 1:227944931-227944953 CTGCAAGGTGCCAGGGAGCCAGG + Intronic
1063100098 10:2942794-2942816 TTGCAGCCTGATAGGGAGCGTGG - Intergenic
1063795263 10:9507442-9507464 CTGCAGGCTGGCAGGGGGGCAGG - Intergenic
1064032845 10:11894090-11894112 CTGCAGGCTGGAAGGGGCCACGG + Intergenic
1064428539 10:15251842-15251864 GTGCAGACTTAAAGGGAGCCAGG - Intronic
1064996326 10:21299812-21299834 CTGCAGGGTGAGTGGGAGACAGG + Intergenic
1065263827 10:23954597-23954619 AGGAAGGCAGAAAGGGAGCCAGG + Intronic
1065462330 10:25982079-25982101 CTGCAGGCTGTGTGGGAGCTGGG + Intronic
1065678936 10:28209115-28209137 CTGCAGGCTGTACAGGAGCATGG - Intronic
1065903649 10:30229366-30229388 CCACAGACTAAAAGGGAGCCTGG + Intergenic
1067098878 10:43320451-43320473 CTGCAGGCAAAAACGGAGGCAGG - Intergenic
1067161078 10:43825690-43825712 CTGCGAGCTGCGAGGGAGCCCGG - Intergenic
1067786641 10:49255051-49255073 CTGCAGGCTGAAAGGACCCTGGG - Intergenic
1067793596 10:49305202-49305224 ATGGAGGCTGCAAGGTAGCCAGG + Intronic
1069607890 10:69751573-69751595 CTGCAGGCAGGAAGGGAGAGGGG + Intergenic
1069827569 10:71263405-71263427 CTGATGACTGAAAGGCAGCCAGG + Intronic
1070128701 10:73641757-73641779 CTGAAGACTGAGAGGGAGACAGG + Exonic
1070279113 10:75036057-75036079 ATGCAGGCCAAAAGGGATCCAGG - Intergenic
1070572544 10:77650970-77650992 GTGCCAGCTGAAAGGGAGCCCGG + Intergenic
1070720329 10:78752493-78752515 CTGCTGCCTGGAAGGTAGCCTGG + Intergenic
1071087056 10:81876069-81876091 CAGCATCCTGAAAGGGAGACAGG - Exonic
1071278339 10:84076822-84076844 CTGCAGGCTGAACGGGAGAGTGG + Intergenic
1073415629 10:103379368-103379390 TTCCTAGCTGAAAGGGAGCCTGG + Intronic
1075481466 10:122786157-122786179 CCTCAGGGTGAAAGGGAGTCAGG + Intergenic
1075522240 10:123149840-123149862 CTGCAGGCTGGAGGCGAGGCAGG - Exonic
1076176342 10:128371006-128371028 CTGCAGGCTGTATGGGAAGCAGG + Intergenic
1076688325 10:132208135-132208157 CCCCAGGCTGAAGAGGAGCCAGG - Exonic
1076922615 10:133462658-133462680 CTGAAGGCACTAAGGGAGCCCGG - Intergenic
1076995248 11:294533-294555 CTGCAGGGAGAGAGGCAGCCTGG - Intronic
1079476991 11:20841475-20841497 CTCCAGGCTGATAAGGAGTCAGG + Intronic
1080561904 11:33471798-33471820 CTGCAGGCAGGAACAGAGCCAGG + Intergenic
1080595789 11:33773851-33773873 CTGAAGTCCGAAAGTGAGCCCGG + Intronic
1080646652 11:34192762-34192784 ATGCAGTCTGGAAGGGTGCCTGG + Intronic
1080923356 11:36731004-36731026 CTGCAGGCTGCTTGGGAGCTGGG + Intergenic
1081373264 11:42329848-42329870 CTGCAGGCTAAAAGGAAGCCTGG - Intergenic
1081594796 11:44451838-44451860 CTGCAGGATGAAGGGAAGCTGGG - Intergenic
1081609243 11:44549148-44549170 CTTCAAGATGAAAGGGAACCTGG - Intergenic
1082120890 11:48378594-48378616 CTGCAGGCTGTATGGGAGCAGGG - Intergenic
1083420466 11:62549674-62549696 CTGCAGGCTGGAACAGAGCTGGG + Intronic
1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG + Intergenic
1083696391 11:64445617-64445639 CTGCAGCCTGCAAGGGAGGCTGG - Intergenic
1084320440 11:68370442-68370464 CTGCAGGCTGGCAGGGGGCCTGG + Intronic
1084552284 11:69851940-69851962 CTCCAGGCAGAAAGGAAGGCGGG - Intergenic
1085151523 11:74256197-74256219 CTGCATGCTACAAGGGACCCTGG + Intronic
1085240656 11:75051196-75051218 CTGCGGGCTGCATGGGAGCAAGG - Intergenic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1086166273 11:83782589-83782611 CTGCAGGTGGAAAGGGAGAAAGG + Intronic
1086986503 11:93255814-93255836 CTGCCTGCTAAAAGGGAGCCAGG - Intergenic
1088606428 11:111537963-111537985 CATCAGGCTGCAAGGGAGGCTGG + Intergenic
1088625835 11:111729842-111729864 CTGGACGCTGAAAGGCAGGCGGG - Exonic
1089150045 11:116357365-116357387 CTGATGGCTGAGAGGGAGCAGGG - Intergenic
1090620124 11:128553200-128553222 CTCCAGGCTGATAGGGAGGAGGG + Intronic
1090973144 11:131660047-131660069 CTGTCGGCTGTAAGGAAGCCAGG - Intronic
1091051918 11:132380012-132380034 CTTCAGGATGATAGGAAGCCTGG - Intergenic
1091587170 12:1822908-1822930 AGGAAGGCTGAGAGGGAGCCCGG - Intronic
1092517242 12:9227397-9227419 CAGAAGGCTAAAAGGGAGCAAGG + Intergenic
1094025247 12:25955142-25955164 CTGCAGGCTTATAGGAAGCATGG + Intergenic
1094219629 12:27978001-27978023 TTTGAGGCTGAAAGGGACCCGGG - Intergenic
1094468434 12:30779561-30779583 CTCCAGGCTGTAATGGAGCCTGG - Intergenic
1095128005 12:38504859-38504881 CTGGAGGTTGGAAGGGAGACTGG + Intergenic
1095765210 12:45886846-45886868 CTGCAGGCAGCATGGGGGCCTGG + Intronic
1095826582 12:46536245-46536267 CTGTAGGCTGAGAGACAGCCTGG + Intergenic
1095899590 12:47314153-47314175 CTTCAGGCTGGGAGGGATCCTGG + Intergenic
1097019862 12:56012688-56012710 CTGCTGCCTGTCAGGGAGCCTGG + Intronic
1097071181 12:56356029-56356051 CTGGAGGTGGAAAGGGAGACGGG - Intronic
1097537385 12:60889334-60889356 CTGCAGGCTGCATGGGAGCTGGG - Intergenic
1097821173 12:64130646-64130668 CTTCAGGATGATAGGGAGCATGG + Intronic
1098268395 12:68746424-68746446 CAGCAGGTTGAACAGGAGCCCGG - Exonic
1099239301 12:80119391-80119413 CTGCAGGGTGAACTGAAGCCAGG - Intergenic
1099475726 12:83105425-83105447 CTGCAGGCTGTATGGAAGCATGG + Intronic
1101650519 12:106673306-106673328 CCGCTGGCTGGAGGGGAGCCAGG - Intronic
1102006210 12:109590748-109590770 CTGCAGGGTGAAGAGGAGGCAGG - Intronic
1104393892 12:128415198-128415220 CTGCCGGCTGAAGGGGGACCTGG + Exonic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104684482 12:130775908-130775930 CTGCATGAAAAAAGGGAGCCCGG + Intergenic
1106477451 13:30110741-30110763 CTGCAGGTGGCAAGGGAGCAAGG - Intergenic
1106704608 13:32267227-32267249 CTGCGGGCTGAAAGGCGGCAAGG - Exonic
1107741302 13:43453229-43453251 CTGCAGGGTTACAGGTAGCCTGG - Intronic
1108056217 13:46488069-46488091 CTGCAGGCTGTAAGGAAGCATGG + Intergenic
1109562900 13:64076123-64076145 CTTCATGCTGACAGGGGGCCTGG + Intergenic
1109744895 13:66612674-66612696 CTGCCCACTGAAGGGGAGCCTGG + Intronic
1110145435 13:72184979-72185001 TTGCAGGCTGCAAGGGACCCAGG - Intergenic
1112475729 13:99729750-99729772 GTGCAGGCTGAAAGTGGTCCAGG - Intronic
1113378606 13:109784699-109784721 CTGCTGGACGACAGGGAGCCGGG + Exonic
1113473517 13:110563043-110563065 GTGCTGGCTGAGAAGGAGCCGGG - Intergenic
1113511677 13:110860483-110860505 CTGCGGGCTGTAAGGAAGCTTGG - Intergenic
1113530906 13:111026206-111026228 CTGCGGGCTGTAAGGAAGCTTGG + Intergenic
1113758012 13:112827522-112827544 CTGCTGGCTTGAAGGGAGCTAGG + Intronic
1113864782 13:113513929-113513951 CCACAGGCTGAGATGGAGCCGGG + Intronic
1113976126 13:114228843-114228865 CTGCGGGGTGAAGGGAAGCCTGG - Intergenic
1114277725 14:21162625-21162647 CTACAGGCTGGGAGGGAACCCGG + Intergenic
1114344630 14:21781747-21781769 CTTCAGCCTGGCAGGGAGCCAGG + Intergenic
1114670681 14:24409259-24409281 CTACAGGCTGGAGGTGAGCCGGG + Exonic
1114739014 14:25075267-25075289 CTTCAGGCTGAGAATGAGCCTGG + Intergenic
1115994444 14:39181197-39181219 CCTCAGGCTGAGAGGGAGGCTGG - Exonic
1117057778 14:51930729-51930751 CTGCAGGCTGTAAGGAAGCATGG + Intronic
1118475127 14:66109430-66109452 CTGCCCTCTGATAGGGAGCCAGG + Intergenic
1118572540 14:67207997-67208019 CGGCAGGCTGTGTGGGAGCCAGG - Intronic
1118783209 14:69024184-69024206 CCCCAGGCTGAAAAGGAGCTGGG - Intergenic
1118846766 14:69553362-69553384 CTCCTGGCTGAAAGGGAGGCTGG - Intergenic
1119147653 14:72331559-72331581 CTGCGGTCTCAAAGGGACCCTGG - Intronic
1119173374 14:72551381-72551403 CTGCAGGGTAAAAGGCAGTCTGG - Intronic
1120263024 14:82212479-82212501 CTGCAGGCTGAAGAAGAGCATGG - Intergenic
1121973225 14:98378546-98378568 CTACATGGTGAAAAGGAGCCAGG + Intergenic
1122057927 14:99117747-99117769 CTGCAGGGTGTAAGGATGCCAGG + Intergenic
1122743573 14:103885488-103885510 CTGCCAGCTGTCAGGGAGCCTGG + Intergenic
1122961546 14:105096211-105096233 GTGCAGGCTCCAAGGGGGCCTGG - Intergenic
1123008981 14:105338165-105338187 CAGCAGGCGGAAGGGGAGGCTGG - Intronic
1123130717 14:105983360-105983382 TTGCAGGCTCCAAGGGGGCCGGG - Intergenic
1123214283 14:106792103-106792125 TTGCAGACTGCAAGGGACCCTGG - Intergenic
1124628578 15:31324983-31325005 CTGCTGGCTGGAAAGGGGCCAGG + Intergenic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125342659 15:38689897-38689919 GTGAATGCTGAAAGGCAGCCAGG - Intergenic
1125744558 15:41989610-41989632 CTGCAGGCAGGAGGGGGGCCCGG - Intronic
1126907600 15:53384591-53384613 CTGCAGGCTGCTAGGCTGCCAGG - Intergenic
1127263035 15:57339548-57339570 CTCCAGGCTGTAAGGAAGCATGG - Intergenic
1127289181 15:57554971-57554993 CGGCAGGTTGAAAGGAGGCCAGG - Intergenic
1127694622 15:61433178-61433200 CTGCAGGCTGCATGAGAGCTAGG - Intergenic
1127699270 15:61481245-61481267 CTGGAGGCTGAGAGGGGCCCAGG + Intergenic
1128335035 15:66780332-66780354 CTCCAGGCCGGAAGGGATCCTGG + Intronic
1128415979 15:67446636-67446658 CTGCTGGCTGAAAGGCACCCTGG - Intronic
1128702724 15:69815905-69815927 CTGCAGTCTGGAAGGTAGACAGG - Intergenic
1128757938 15:70195992-70196014 CTGAAGGCTGGAAGGAAGGCAGG + Intergenic
1129116978 15:73369815-73369837 CTGCAGACTGGAAGGGAGTGGGG - Intergenic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129242279 15:74258888-74258910 CAGCAGGGTGTAAGGGGGCCAGG - Intronic
1129607798 15:77033252-77033274 CTGCAGCCTGACAGGGCACCAGG - Intronic
1129712224 15:77826209-77826231 CTGCAGCCTGAAGGGGCTCCTGG + Intergenic
1129779215 15:78258984-78259006 CTGGAGGTTGAGAAGGAGCCAGG - Intergenic
1129951299 15:79593981-79594003 CTGCAGGCTGGAAAGGAGTTGGG - Intergenic
1130044238 15:80431499-80431521 GGACAGGCTCAAAGGGAGCCAGG - Intronic
1130082777 15:80748867-80748889 CACCAGGCTGCAAGGGAGGCTGG + Intronic
1130152567 15:81322687-81322709 CTGCAGGCCTGAAGGGAGGCGGG - Intronic
1131016540 15:89062160-89062182 CTGAAGGCTGAAAGGAAAGCTGG + Intergenic
1132333787 15:101030292-101030314 CTGCGGGCTGGAAGGGAGGGTGG - Intronic
1132457853 16:33935-33957 CAGGAGGCTGAAAGGGTGCAGGG + Intergenic
1132579283 16:677723-677745 CTGCAGGCTGAGAGGCCCCCCGG - Intronic
1132601838 16:776244-776266 CTGCAGCCTGAAAGGAGCCCCGG + Intronic
1133437682 16:5793702-5793724 TTCCAGGCTGGGAGGGAGCCTGG + Intergenic
1135068208 16:19329367-19329389 TTGCAGGTTGCAAGGGAGCCAGG - Intergenic
1135195891 16:20394309-20394331 GGGCAGGCTGAGAGGCAGCCTGG - Intronic
1135792053 16:25405857-25405879 GAGGAGGCAGAAAGGGAGCCAGG + Intergenic
1136032598 16:27514450-27514472 CTGCTTGTAGAAAGGGAGCCTGG - Intronic
1137693862 16:50448309-50448331 CTGCAGCCTGAAAGGGACAGCGG - Intergenic
1137694821 16:50454539-50454561 CTGCAGGCTGACACCCAGCCAGG - Intergenic
1138192029 16:55021634-55021656 CTACAGGCTGTGTGGGAGCCGGG + Intergenic
1138590660 16:57998042-57998064 CTGCAGGCAGCAGGAGAGCCAGG - Exonic
1140537060 16:75719530-75719552 CTGCAGGGTGGCAGCGAGCCTGG + Intronic
1141103726 16:81216186-81216208 CTGCAGGCAGGCAGGGAGACAGG + Intergenic
1141785755 16:86199603-86199625 CTTCAGCCTGAAATGAAGCCGGG + Intergenic
1141978579 16:87534930-87534952 CTGCAGGCTGTATGGGAAGCAGG - Intergenic
1142906886 17:3049403-3049425 CTGCGGGCTGAACGGGAGGCTGG + Intergenic
1143253040 17:5536941-5536963 CTGAAAGCACAAAGGGAGCCGGG + Intronic
1143315293 17:6027504-6027526 CTCTGGGCTGAAAGGAAGCCAGG + Intronic
1144152355 17:12461824-12461846 CTGCAGGCTGTAAGGTCGCAGGG - Intergenic
1144590597 17:16520603-16520625 GTGCAGGTTGATAGGGAGGCTGG + Intergenic
1145209787 17:21004500-21004522 CTGCAGGAACTAAGGGAGCCTGG + Intronic
1145240306 17:21237066-21237088 CTGCAGGCCCCAAGGGATCCAGG - Intergenic
1145880215 17:28347653-28347675 CTCCAGGCTGAGAGGGAAACAGG + Exonic
1146125126 17:30225316-30225338 TTGCAGGCAGAAAGGGCCCCGGG - Intronic
1146530501 17:33604089-33604111 CTGCAGGCTGAAAGGGAGCCTGG + Intronic
1146943978 17:36861858-36861880 CTGCAGGCAGACTGGGAGCTGGG + Intergenic
1147469211 17:40642475-40642497 CTACAGGCTGGGAGGGAACCCGG - Exonic
1147583448 17:41639254-41639276 CTGCAGGGTGGGAAGGAGCCTGG - Intergenic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148558115 17:48590665-48590687 GGCCAGGCTGAAAGGGAACCAGG + Intronic
1151124158 17:71827033-71827055 TTGCAGGCTGAATGGGAACGTGG + Intergenic
1151404855 17:73879690-73879712 CTACAGGCTCAATGGGACCCCGG - Intergenic
1151745375 17:76009019-76009041 CAGCCGGCTGAGCGGGAGCCTGG - Exonic
1151829390 17:76540704-76540726 CAGCAGGCGGACAGGGAGCAGGG - Intronic
1152212521 17:79009953-79009975 CTGCAGGCTGGAGGGGCGCGAGG + Intergenic
1152380690 17:79941051-79941073 GTGCAGGCTGCAGGGGATCCGGG + Exonic
1152472918 17:80500237-80500259 CTGCCGGCAGGAAGGGAGCGTGG - Intergenic
1152531126 17:80919892-80919914 CTGCAGGCTGCGAGTGAGCCGGG + Intronic
1152961855 18:84658-84680 CAGGAGGCTGAAAGGGAGTGGGG + Intergenic
1153337674 18:3941344-3941366 CTGCAGCCTGAACTGCAGCCAGG - Intronic
1155573846 18:27224013-27224035 CTGCAGGCTCCATGGGAGCTGGG - Intergenic
1155833240 18:30544399-30544421 CTGAAGGAGGCAAGGGAGCCAGG - Intergenic
1156310775 18:35919671-35919693 CTGGAGGCTGTGAGTGAGCCAGG + Intergenic
1157282710 18:46356675-46356697 CTGAAGGTTGAGAGGGTGCCTGG + Intronic
1158511073 18:58091123-58091145 ATGCAAGCTGAGAGAGAGCCAGG + Intronic
1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG + Intergenic
1160533187 18:79577257-79577279 CTGCTGCCTGAGAGGGAGCGTGG + Intergenic
1160544156 18:79641825-79641847 CAGGAGGCTGGGAGGGAGCCTGG - Intergenic
1161680564 19:5677838-5677860 ATGCAGGCTGCCAGGTAGCCTGG + Intronic
1162217630 19:9149534-9149556 CTGAAGGATGAGAGGGGGCCAGG + Intronic
1162995677 19:14333642-14333664 GGGCAGGCAGAAACGGAGCCTGG - Intergenic
1163469621 19:17488825-17488847 CTGCAGGGGGAGGGGGAGCCGGG - Intronic
1163686973 19:18717297-18717319 CTTCAGGCTGTGTGGGAGCCAGG + Intronic
1163700668 19:18785175-18785197 CTGCAGGCAGATCGGGACCCAGG - Intronic
1164698840 19:30267667-30267689 CTGAAGGCAGACAGGGAGTCAGG - Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1166129905 19:40739934-40739956 CTGGAGGCTGACAGGGAGGCAGG - Exonic
1166686072 19:44797043-44797065 CAGCAGGCTGACAGGGACCTCGG + Intronic
1167402200 19:49280262-49280284 TTGCAAGCTGCAAGGCAGCCTGG + Intergenic
1167441639 19:49512717-49512739 CCGCAGGCAGGAAGGGAGCGAGG + Exonic
1168281864 19:55310218-55310240 CTGCAGGCTAACAGGGTGCCTGG + Intronic
925039345 2:718521-718543 CTGCTGGCTGGGAGGGAGCAGGG - Intergenic
925161846 2:1690159-1690181 CTGCTGGGTGAAAGGGTCCCCGG + Intronic
925441930 2:3895454-3895476 TTGCAGGCTGCATGGGAGCAGGG - Intergenic
925756785 2:7140554-7140576 CTGCAGGCTGCAAGGGAAGCAGG - Intergenic
926045985 2:9709953-9709975 CAGCTAGCTGCAAGGGAGCCTGG - Intergenic
926429348 2:12769895-12769917 CTGTGAGCTGAAAGGCAGCCCGG - Intergenic
926683045 2:15678412-15678434 TTGCTGGCAGAAAGGGAGTCAGG - Intergenic
927084439 2:19660460-19660482 GTGGAGGGTGAAGGGGAGCCAGG - Intergenic
927176841 2:20415814-20415836 CTGCAGGCTGCATGGGAGTGGGG - Intergenic
927468585 2:23355280-23355302 CTCCAGGGTGAAAAAGAGCCGGG + Intergenic
927825901 2:26310152-26310174 CTGCGGGCTGCAAGTGAGGCAGG + Intronic
927893997 2:26769738-26769760 TTTCAGGCTGAAGGGGAGCTGGG + Intronic
927939735 2:27095999-27096021 CAGCAGGCTGCAAGGGGGCTGGG + Intronic
928783096 2:34848693-34848715 CTGCAGGCTGCATGGGAGTGGGG - Intergenic
929071715 2:38038140-38038162 TTGCTGGCTGAAATGGAGCCTGG - Intronic
929631388 2:43466333-43466355 CTGTAGGGGCAAAGGGAGCCAGG - Intronic
929876028 2:45797294-45797316 CTGCAGGGTGAAGGGGAGGGAGG + Intronic
930222559 2:48759916-48759938 CTGCAGGATGATAGGAAGCTGGG + Intronic
930593093 2:53353529-53353551 CTGCAGGCTGTGTGGGAGCAGGG + Intergenic
930837378 2:55808622-55808644 CCCCAGACTGCAAGGGAGCCTGG + Intergenic
931246618 2:60497886-60497908 CTGCAGGATGGAAGTGAGCCAGG + Intronic
931775844 2:65539715-65539737 CTGCAGGCTGGACGGGGGCCAGG + Intergenic
932406220 2:71513946-71513968 CTGATGGCTGAAGAGGAGCCTGG - Intronic
932447688 2:71790868-71790890 CTGCAGGCAGAGAGGCTGCCAGG - Intergenic
932612871 2:73212759-73212781 CTGCAGGCTTGAGGGGACCCAGG + Intergenic
934717775 2:96553301-96553323 CTGCAGGCCGGATGGGAGCAGGG + Intergenic
934852212 2:97708458-97708480 CTCCTGGCTCAAAGGGAGCTTGG - Intergenic
935073816 2:99720508-99720530 CTGCAGGCTGTATGGGAAGCAGG - Intronic
935372889 2:102365924-102365946 CTGCACACAGAAAGGGACCCTGG + Intronic
935628074 2:105187513-105187535 CTGCAGGCTGAAATGAAGCCGGG + Intergenic
935698524 2:105790458-105790480 CTGCAGGCAGCCTGGGAGCCCGG + Intronic
937528063 2:122795436-122795458 CTGCAGGGTGAAAGAGTTCCTGG - Intergenic
937995439 2:127690795-127690817 CAGCTGGCTGAAAGGGGCCCTGG - Intergenic
938165046 2:129018788-129018810 CTGCAGGCAGGAAAGGGGCCTGG + Intergenic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
938564991 2:132510506-132510528 GGGCAGGCTGAAACAGAGCCTGG + Intronic
939938509 2:148321385-148321407 CTGCAGGCTGCATGAGACCCAGG - Intronic
940084512 2:149843541-149843563 CTGCAGACTGAAAGTGTCCCAGG - Intergenic
940345261 2:152622111-152622133 CTACCGGGGGAAAGGGAGCCAGG - Intronic
942491095 2:176490445-176490467 CTGCGGGCTGAGAGCGAGGCGGG + Intergenic
942786446 2:179707405-179707427 CTGTGGGCTGCAAGGAAGCCTGG + Intronic
946166749 2:217869177-217869199 CTGCAGGAAGACAGGGTGCCAGG + Intronic
947317491 2:228877363-228877385 CTCCTAGCTGCAAGGGAGCCAGG + Intronic
947524581 2:230870425-230870447 CTGCAGGCTGGAGCGGAGCTGGG + Intronic
947828745 2:233124445-233124467 ATGGAGGCTGAAAGGGTCCCAGG + Intronic
948752959 2:240143095-240143117 CTCCAGGGTGCAGGGGAGCCGGG - Intronic
948799572 2:240425863-240425885 CTGCTGGGTGGGAGGGAGCCAGG + Intergenic
948817821 2:240522017-240522039 CTGCAGGCTGGTGGGGAGCCTGG + Intronic
948901732 2:240959769-240959791 CTTCAGGGTGAAAGTGGGCCTGG + Intronic
1168887144 20:1267381-1267403 CTGCAGACTGAAAGAGAGGCCGG + Intronic
1169196841 20:3687818-3687840 CTGCAAGCTACAAGGGAGACTGG - Exonic
1169498043 20:6133463-6133485 GTGCAGGATGAGAGGGATCCAGG - Intergenic
1169835160 20:9869818-9869840 CAGCTAGCTGAAAGGGAGGCTGG + Intergenic
1170620708 20:17993637-17993659 CTGCTGGCGGGAAGGGAGGCAGG - Intronic
1172768019 20:37361420-37361442 CTGCAGGCTTGAACGGGGCCAGG + Intronic
1172807464 20:37622702-37622724 CTGAGGGCAGAAAGGGGGCCTGG + Intergenic
1172842864 20:37912550-37912572 GTGCAGGCTGAGAGGGAGCCTGG + Intronic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1174287629 20:49483818-49483840 CTCCAGGCTGGAGGGGAGCGGGG - Intergenic
1174406136 20:50304617-50304639 CTGGGGGGTGAAAGGGAGCCTGG - Intergenic
1176171257 20:63697366-63697388 CTGCTGGCTGAGAAGGTGCCTGG - Exonic
1178485954 21:33020280-33020302 CTGCAGGCCCCCAGGGAGCCCGG + Intergenic
1179189268 21:39108962-39108984 CAGCAGGAAGCAAGGGAGCCCGG + Intergenic
1180590415 22:16932500-16932522 CTGAAGGCAGAAAGTGAGGCAGG + Intergenic
1181063122 22:20291422-20291444 CTGCAGGCTGGGAGGGGCCCTGG - Intergenic
1181150205 22:20877851-20877873 GTGCAGGCTGAAAGGTGGCCAGG + Intronic
1181463032 22:23096504-23096526 CTGCAGCCAGAAAGGGAACCAGG + Intronic
1181804988 22:25369395-25369417 CTGCAGGCTGGCAGGGGGCCTGG - Intronic
1182109877 22:27715530-27715552 CTGCAGGCAGACAGGAAGCAGGG + Intergenic
1182428333 22:30286428-30286450 CTGGAGGCTGATCGGGAGCAGGG - Intronic
1182856194 22:33519533-33519555 CTGGAGCCTGAGAGGGAACCTGG - Intronic
1183099487 22:35575170-35575192 CTGGAGGCTGAGAGGGACTCAGG - Intergenic
1183514680 22:38257959-38257981 CTGCAGCCTGGAACTGAGCCAGG - Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184164022 22:42716945-42716967 CAGCTGGCAGACAGGGAGCCAGG - Intronic
1184275579 22:43407797-43407819 CTGCAGACTGCACAGGAGCCCGG + Intergenic
1184473569 22:44709117-44709139 CTCCAGGCTGGATGGGGGCCTGG + Intronic
1185051725 22:48557567-48557589 CAGGAGGCTGAGTGGGAGCCTGG + Intronic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
949509675 3:4757304-4757326 CTGCAAGCTGAAGGGCTGCCAGG - Intronic
950621798 3:14211956-14211978 CTGTAGCCTGAAAGGAATCCTGG + Intergenic
950715312 3:14843628-14843650 CTGCTGGCTGGAAGGAACCCTGG + Intronic
952540492 3:34362542-34362564 CTGCAGCTTGAAAAGAAGCCAGG + Intergenic
952733474 3:36664671-36664693 CTGCAGGCTGACAGGAAGCATGG - Intergenic
953459942 3:43074002-43074024 CAGGAGGCTGCAAGGGAGCCTGG - Intergenic
954920114 3:54183363-54183385 TTGCAGGCTGAGAGGGAACTGGG + Intronic
955564242 3:60226620-60226642 GTCCAGGCTGAAAGGAAGCATGG + Intronic
956362515 3:68464223-68464245 CTGCAAGCTAAAAGAGAGCCAGG - Intronic
956612891 3:71142590-71142612 CTGCAGGCTGACAGCCAGCAAGG + Intronic
958435231 3:94088110-94088132 CTGAAGGATGAAAAGGAGCAGGG - Intronic
958784572 3:98583715-98583737 CTGACTGCTGAAAGGGAGACCGG + Intronic
958856687 3:99393973-99393995 CTGCAGGCCCAAAGGGAACACGG + Intergenic
959361724 3:105402573-105402595 GTGCAGGCTGCATGGGAGCGGGG + Intronic
960997336 3:123348790-123348812 CACCAGCCTGATAGGGAGCCTGG - Intronic
961035621 3:123639565-123639587 ATGCAGGCAGAATGTGAGCCAGG + Intronic
961373891 3:126449815-126449837 ATGCAGACTGAAAGGGAGCCGGG + Intronic
961442879 3:126963095-126963117 GTTCAGGCAGGAAGGGAGCCCGG + Intergenic
961649391 3:128409954-128409976 CAGCAGGCTAGCAGGGAGCCTGG - Intergenic
961812042 3:129527630-129527652 CTCCAGTCTGAAGGGGAGGCTGG - Intergenic
962461492 3:135618515-135618537 ATGTGGGCAGAAAGGGAGCCTGG - Intergenic
962852407 3:139317970-139317992 CTGCAGGATGATACAGAGCCAGG + Intronic
965137259 3:164787220-164787242 CTGCAAGGTGAAAGTGAGGCTGG + Intergenic
965184538 3:165446395-165446417 CTGCAGGCTGCATAGGAGCAGGG + Intergenic
966302573 3:178495792-178495814 CTGCAGACTGTAAGGAAGCATGG - Intronic
966400537 3:179542815-179542837 CTGCAGGCTGTAAGGAAGCATGG + Intergenic
967316007 3:188153175-188153197 CTCAGGGCTAAAAGGGAGCCAGG + Intergenic
968438726 4:610564-610586 CTGAAGGCTGTGAGGCAGCCAGG + Intergenic
968478474 4:823835-823857 CAGCAGGTTGGAAGGGGGCCTGG + Intronic
968515741 4:1014967-1014989 CCTGCGGCTGAAAGGGAGCCCGG - Intronic
968674758 4:1871481-1871503 CGGCAGGCTGGGAGGGGGCCGGG - Intronic
969464076 4:7344405-7344427 CTGCTGGCTGGAAGGGAGATGGG + Intronic
970078939 4:12257835-12257857 CAGCAGGCAGAAAGAGTGCCTGG - Intergenic
970542563 4:17094502-17094524 ATGCAGGCTGAAGGGGAGCCTGG + Intergenic
970641854 4:18075638-18075660 GCACAAGCTGAAAGGGAGCCTGG - Intergenic
971050432 4:22855646-22855668 CTGCAGGCTGCATGGGAGTGGGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972379920 4:38510127-38510149 CTGCAGGTTGACCTGGAGCCTGG + Intergenic
973762573 4:54133036-54133058 CTCCTAGCTGCAAGGGAGCCTGG - Intronic
975031758 4:69629202-69629224 CTCCAGGTAGAAAGGGAGCCAGG + Intronic
975243817 4:72094629-72094651 CTGCAGGCTGCATAGGAGCTGGG - Intronic
976100574 4:81558489-81558511 CCGCATGGTGAAAGGGAGCATGG + Intronic
976619605 4:87114715-87114737 CTGCAGGGGGAAAGGGAGCCAGG + Exonic
976697563 4:87934515-87934537 CTGCAGGCTGTATGTGACCCAGG - Intergenic
976887827 4:90007728-90007750 CTGTAGGCTGCAAGGGAGCTGGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977839332 4:101682430-101682452 CTGCATGGTGGACGGGAGCCTGG + Intronic
977976140 4:103268989-103269011 CTACAGGCTGCATGGGAGCTGGG - Intergenic
978761814 4:112361399-112361421 CTGTAGGCTGCCAGGAAGCCGGG + Intronic
980274744 4:130634580-130634602 CTGCAAGCTAAAAGGGATCGGGG + Intergenic
980861077 4:138500188-138500210 TTGCAGGCTGTATGGGAGCTGGG - Intergenic
985798484 5:1984187-1984209 CTGCAGGCTGACACGGCGGCCGG - Intergenic
985848055 5:2368487-2368509 CTGCTGGCTGGAGGGGTGCCAGG - Intergenic
985857772 5:2443485-2443507 TTGGAGGATGAAAGGTAGCCAGG - Intergenic
986064469 5:4222300-4222322 CTGCAGGAAGAAAGGGAGGGTGG - Intergenic
986167239 5:5285279-5285301 CTGCAGGTGGAAAGGCAGCATGG - Intronic
986601147 5:9474330-9474352 CTGCTGGCTTAAAGGGATTCTGG + Intronic
986639215 5:9855458-9855480 ATGCAGGCAGAAATGGAGTCAGG + Intergenic
988669205 5:33362796-33362818 CTGCAGTCTGAGAAGGAGGCAGG + Intergenic
988789582 5:34594924-34594946 ATTCAGGCAGGAAGGGAGCCAGG - Intergenic
988866479 5:35340532-35340554 CTGCAGTCTCAAAGGGAGGCTGG + Intergenic
992956076 5:81909754-81909776 ATACAGTATGAAAGGGAGCCAGG - Intergenic
994094302 5:95835053-95835075 CTGCTGCCTGCACGGGAGCCTGG + Intergenic
996627364 5:125586308-125586330 CTGGATGCTGAAAGAGAGCTCGG + Intergenic
997592063 5:135080332-135080354 ATGCAGGCTGACAGGAAGCATGG + Intronic
997825499 5:137103359-137103381 CTGCAAGCTTCAAGGGAGGCTGG - Intronic
998548833 5:143056777-143056799 CTAAAGGCTGAAAGGAACCCGGG - Intronic
999240874 5:150126726-150126748 CTGCAGGCTGATGGGGAGGTGGG - Intronic
999283201 5:150378547-150378569 CACCTAGCTGAAAGGGAGCCTGG + Intronic
999450738 5:151676036-151676058 CTGGATGCTGAAAGGGAACAGGG - Intronic
999458685 5:151739524-151739546 CAGCACGCTGATGGGGAGCCAGG + Intergenic
999473232 5:151874762-151874784 CTGAAGGGTGAGAAGGAGCCAGG + Intronic
1001385779 5:171337286-171337308 CTCCAGGCTTTGAGGGAGCCTGG - Intergenic
1001636125 5:173211551-173211573 CTGGAGGCTGAGAAGGGGCCGGG + Intergenic
1003535712 6:6973712-6973734 CTGGAGGCTGGAAGGTAGCTGGG - Intergenic
1003630534 6:7782360-7782382 CTGGAGGCTGAAAGAGAGGTGGG + Intronic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1004340046 6:14800056-14800078 CACCAAGCTGCAAGGGAGCCTGG - Intergenic
1004792931 6:19048904-19048926 CAGCAGGCAGAAAGGCAGCAAGG - Intergenic
1005008044 6:21309823-21309845 CTGGAAGCTGAAAGGCAGCGGGG - Intergenic
1005100940 6:22172072-22172094 CTGCAAGGTGAAAGCGAGGCTGG - Intergenic
1006022284 6:31124333-31124355 CTGCAGGCGGACACGGTGCCTGG + Intronic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006285294 6:33088704-33088726 CAGCAGGATCAAAGGCAGCCAGG + Intergenic
1006466292 6:34196721-34196743 CTGCATTGTGAAAGGGAGCGGGG + Intergenic
1006620497 6:35360650-35360672 GCAGAGGCTGAAAGGGAGCCAGG + Intronic
1006784329 6:36655156-36655178 GTGCTGGCTGAAAGGGGCCCTGG + Intergenic
1006933550 6:37701851-37701873 ATGCAGGCTGCATGGGAGCAGGG + Intergenic
1008028259 6:46663399-46663421 TTGAAGGCTGAAGGGGACCCTGG - Intronic
1008042307 6:46815395-46815417 CTGCGGGCTGCATGGGAGCAGGG - Intronic
1009050932 6:58275782-58275804 CTGCAGGCTGACAGGCAAACTGG + Intergenic
1010685244 6:78846808-78846830 CTGCAGGCTGAAGTGCAGGCTGG + Intergenic
1014482063 6:121951126-121951148 CTGCAGGCTGTGTGGGAGCAGGG - Intergenic
1014656205 6:124107699-124107721 CTGGAGGCTGAAAGAGAGGTGGG - Intronic
1017218571 6:151938876-151938898 TTGCAGGATGAAAGAGAGCTTGG + Intronic
1018003601 6:159600875-159600897 GAGCAGGCTGATAGGAAGCCTGG + Intergenic
1018596709 6:165488767-165488789 CTGCAGGCTCCACGGGAGCTGGG + Intronic
1018681778 6:166270982-166271004 TTGGTGGCTGAAAGGCAGCCTGG - Intergenic
1018986030 6:168637941-168637963 CTGGATGCTGAGCGGGAGCCAGG + Intronic
1019929517 7:4214563-4214585 CTGCAGGCTGAGGGGCGGCCAGG + Intronic
1021777423 7:24067477-24067499 TTGGGGGCTGAAAGGGAGCAAGG + Intergenic
1022130388 7:27399654-27399676 CTGCGGAATAAAAGGGAGCCAGG - Intergenic
1022644937 7:32221046-32221068 CCTCAGGAGGAAAGGGAGCCAGG - Intronic
1022712118 7:32861789-32861811 CTGCAGTCTGTAAGAGGGCCTGG + Intergenic
1023692517 7:42805911-42805933 CTGTAGGCTGCATGGGAGCTGGG + Intergenic
1023834228 7:44059018-44059040 CAGCAGGCTGAGGGGGAGCCTGG + Intronic
1023862687 7:44225597-44225619 CTGCAGGCTCAAAGGGGCACTGG - Intronic
1024367325 7:48535813-48535835 CTGCAGGCTGTATGGCAGCGGGG - Intronic
1024627803 7:51223188-51223210 CAGCAGGCTGCAAGGGCGGCAGG + Intronic
1027218603 7:76200176-76200198 CTGCTCACTGAAAGGGGGCCAGG + Intergenic
1028197725 7:87926750-87926772 CTGCAGGCTGTGTGGGAGCAGGG + Intergenic
1029007362 7:97224581-97224603 ATTCTGGCTGAAAGGGAGTCTGG + Intergenic
1029489959 7:100865792-100865814 CTGCAGGCTCAGAGAAAGCCGGG - Exonic
1029665747 7:101993964-101993986 CTGCAGCATGAATGGCAGCCAGG - Intronic
1032458835 7:132094367-132094389 CTGGAGGCTCAAGGGGAGGCTGG - Intergenic
1032527560 7:132591058-132591080 CTCCAAGCTGCAAGGGAGGCTGG + Intronic
1033535054 7:142304425-142304447 CTGGAAGCTGGAAGGGAGTCTGG - Intergenic
1033598017 7:142870379-142870401 CTGCAGGCTGGCGGGGACCCAGG + Exonic
1033990153 7:147273115-147273137 CTGCAGGCTGGGAGTGGGCCAGG - Intronic
1034001591 7:147419236-147419258 CTGCAGGCTGGAAGACAGCAGGG - Intronic
1034137311 7:148782909-148782931 CTCCGGGCTGCGAGGGAGCCCGG - Intronic
1034229964 7:149516224-149516246 CTGCAGGCTGCATGGGAGCAGGG - Intergenic
1036942215 8:13062869-13062891 ATGCAGAGTGAAAGGGGGCCCGG - Intergenic
1037884629 8:22589573-22589595 CTGCAGGGTGGGAGGCAGCCAGG - Intronic
1038908732 8:31937703-31937725 CTGCAGGCTGCATGGGAGTGGGG + Intronic
1039771691 8:40694201-40694223 CTGCAGGCAGTAAGGGAGGATGG + Intronic
1039811113 8:41049142-41049164 CTGCTGGCTGCATGGGAGCTGGG + Intergenic
1044903312 8:96972193-96972215 TTGCAGGCTGCATGGGAGCAGGG + Intronic
1045065186 8:98437900-98437922 CTGCCTGCTGAAGGGAAGCCAGG + Intronic
1047189576 8:122665892-122665914 AAGAAGGCTGAAAGTGAGCCTGG - Intergenic
1048167341 8:132075169-132075191 CTGCAGGCTGAGAGTAAGGCTGG + Intronic
1049051954 8:140204749-140204771 CTGCAGGCTGCAAGGAAGCCTGG - Intronic
1049216181 8:141409426-141409448 CTGCAGGCAGACTGGGTGCCGGG - Intronic
1049388301 8:142355182-142355204 CGGCAGGCTGCATGGGTGCCGGG - Intronic
1049397852 8:142409930-142409952 CTCCAGGCTGAAAGGGCCCCAGG - Intergenic
1049566019 8:143339627-143339649 CTGTAGGTTGCCAGGGAGCCTGG - Intronic
1051162422 9:14223140-14223162 CTGCAGGCTGCATGTGACCCAGG - Intronic
1051273171 9:15374725-15374747 CTGCTGGCTGCATGGGAGCTAGG + Intergenic
1051516834 9:17939143-17939165 CTGGAGACTGAAAGGAAGCAAGG - Intergenic
1052253465 9:26426837-26426859 CTGCAGGCTGTGTGGGAGCGGGG + Intergenic
1053154663 9:35768599-35768621 CTCCAGGCTGAGAGAGACCCTGG + Intergenic
1056054272 9:82804375-82804397 CTGTACTTTGAAAGGGAGCCAGG + Intergenic
1056307606 9:85305397-85305419 ATGCCGGCTGCAAGGGAGCATGG + Intergenic
1056348645 9:85725049-85725071 CTGCAGGGTGCAGGGGAGTCTGG - Intronic
1056402589 9:86242322-86242344 TTGCAGGCTCAAAGGAAGACAGG + Intronic
1057496005 9:95561858-95561880 GTGCTGGCTGTAAGGGAGTCCGG + Intergenic
1058100644 9:100914975-100914997 TTGCAGGCTGCAAGGAAGCCTGG + Intergenic
1059219256 9:112597179-112597201 CTGCAGACTGAAGAGGAGTCTGG - Intronic
1060701130 9:125748874-125748896 CTGCAGGCGGGGAGGGGGCCCGG + Intronic
1060987063 9:127825819-127825841 CTGCATGCTGGAAGCCAGCCAGG - Exonic
1061203001 9:129148048-129148070 GGGCAGGGTGAAAAGGAGCCTGG - Exonic
1061210203 9:129187258-129187280 CAGCTAGCTGCAAGGGAGCCTGG + Intergenic
1061235021 9:129337137-129337159 CTGGAGGCAGGAGGGGAGCCGGG + Intergenic
1061412765 9:130430224-130430246 CTGCAGGCTGCAGGGGAACCTGG + Intronic
1061506710 9:131035814-131035836 CTGGGGGCTGAGAGGGACCCAGG - Intronic
1061531807 9:131219913-131219935 CTGCAGGATGATATGGGGCCTGG + Intronic
1061667801 9:132170457-132170479 CTGCAGGCCGAGAAGGAGGCAGG + Intronic
1061669952 9:132183023-132183045 CTTCAGGCTGGAAGGGCTCCAGG - Intronic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1061968312 9:134028953-134028975 CTGCAGGCTGCAAACAAGCCAGG - Intergenic
1062035406 9:134380512-134380534 CTGCAGGCTGGGAGGTAGACAGG + Intronic
1062107843 9:134765517-134765539 CAGCAGGCTGGGAGGGAGTCTGG + Intronic
1062131662 9:134897964-134897986 CAGCAGGCTGAAGGGGACCAGGG + Intergenic
1062331906 9:136048637-136048659 CTGCAGGCGGAGAGGGAGCCAGG + Intronic
1062630127 9:137459608-137459630 CTGCAGGATCACAGGGAGGCCGG + Intergenic
1062657885 9:137613568-137613590 CTGCAGGGTGGAAGGCAGCCAGG + Intronic
1062736288 9:138139446-138139468 CAGGAGGCTGAAAGGGAGTGGGG - Intergenic
1185784172 X:2875866-2875888 CTGCAGGCTGAGGGGAAGGCTGG - Exonic
1185954398 X:4473605-4473627 CTGTAGGATGAAATGGAGGCTGG - Intergenic
1187588824 X:20693363-20693385 CTGTGGGCTGCAAGGGAGCAGGG + Intergenic
1190003279 X:46710006-46710028 CTCCAGGGAGAAAGGGAGGCCGG + Intronic
1192184350 X:68936564-68936586 AGGCAGGCTGAAAGGCAGACTGG + Intergenic
1192609623 X:72554569-72554591 CTGCAGGCTGCATGGGAGCGGGG + Intronic
1192620283 X:72672356-72672378 CAGCATGATGAACGGGAGCCAGG - Intronic
1193937093 X:87636662-87636684 CTGCAGGCTGCATGGGAGCTGGG + Intronic
1194484553 X:94471521-94471543 TGGCAGCCTGAAAGGCAGCCAGG + Intergenic
1194532799 X:95071890-95071912 CTGCAGGTTGCATGGGAGCTGGG + Intergenic
1195237066 X:102911166-102911188 CTGCAGGCTGCATGGGAGCAGGG + Intergenic
1195520200 X:105821687-105821709 CTGGAGGCTGGAAGGGATGCAGG + Intergenic
1196008862 X:110865172-110865194 CTGCAGGCAAGAAGGGAGCTTGG + Intergenic
1197545171 X:127815635-127815657 CTGCAGGCTGCATGGGGGCTGGG + Intergenic
1197708133 X:129648367-129648389 CAGCAGGGTGGAAGGGAGACTGG + Intronic
1200114805 X:153765355-153765377 CTGCCAGCTGTGAGGGAGCCCGG + Intronic
1200142603 X:153909485-153909507 CTGCAGACTGCAGGGGAGTCTGG - Exonic
1200184841 X:154175540-154175562 TGGGAGGGTGAAAGGGAGCCAGG - Intergenic
1200190494 X:154212678-154212700 TGGGAGGGTGAAAGGGAGCCAGG - Intergenic
1200196245 X:154250480-154250502 TGGGAGGGTGAAAGGGAGCCAGG - Intergenic
1200201900 X:154287598-154287620 TGGGAGGGTGAAAGGGAGCCAGG - Intronic
1201468273 Y:14309190-14309212 CGGCGGGCTGAAGGGAAGCCAGG - Intergenic
1201742584 Y:17340077-17340099 CTGTAGGATGAAATGGAGGCTGG - Intergenic