ID: 1146530952

View in Genome Browser
Species Human (GRCh38)
Location 17:33607347-33607369
Sequence CACATTAGGGACCACCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146530947_1146530952 6 Left 1146530947 17:33607318-33607340 CCCTGAGGGTGTAAGGCAGGGAG 0: 1
1: 1
2: 1
3: 20
4: 330
Right 1146530952 17:33607347-33607369 CACATTAGGGACCACCTACTAGG 0: 1
1: 0
2: 0
3: 5
4: 85
1146530948_1146530952 5 Left 1146530948 17:33607319-33607341 CCTGAGGGTGTAAGGCAGGGAGG 0: 1
1: 0
2: 3
3: 32
4: 317
Right 1146530952 17:33607347-33607369 CACATTAGGGACCACCTACTAGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146530952 Original CRISPR CACATTAGGGACCACCTACT AGG Intronic
901202831 1:7476327-7476349 AGCTTTAGGGACCACCAACTAGG - Intronic
901567997 1:10134811-10134833 CACTTTAGGTCCCAGCTACTTGG + Intronic
903023727 1:20412117-20412139 CAGTTTAGGGGCCACCTCCTTGG + Intergenic
906615555 1:47230934-47230956 GACATTCGGGATCACCTCCTGGG - Intronic
910846714 1:91611481-91611503 CACTATAGTGACCTCCTACTAGG + Intergenic
1063461596 10:6218191-6218213 CACATTGGTGACCACTCACTGGG - Intronic
1066505505 10:36038431-36038453 CACATGAGGGTCCACCTGCCTGG - Intergenic
1070119281 10:73559917-73559939 AAAATTAGCCACCACCTACTGGG + Intronic
1075995571 10:126873769-126873791 CACAGCAGGGACCACTGACTCGG - Intergenic
1077871567 11:6266584-6266606 CACATTAGGGATCAGGGACTTGG + Intronic
1088298226 11:108324895-108324917 GAAATGAGGGACCCCCTACTGGG - Intronic
1089979813 11:122763105-122763127 CACAGGAGGGACCACATTCTTGG - Intronic
1104323083 12:127770601-127770623 GACATTAGGGATCATCTACTTGG + Intergenic
1107245947 13:38294054-38294076 CACCTGTGGGCCCACCTACTTGG + Intergenic
1109848372 13:68027580-68027602 CTCATAAAGGACCCCCTACTAGG - Intergenic
1110181886 13:72626649-72626671 CACATTAGGGAGCACCCCATGGG + Intergenic
1110620030 13:77584994-77585016 CCCATTACAGAACACCTACTAGG - Intronic
1110929462 13:81196486-81196508 CACATTAGGGCCTACCTATATGG + Intergenic
1113922103 13:113919058-113919080 CACTTTGGGGACCAGCTTCTGGG - Intergenic
1114038944 14:18658386-18658408 CACATTTGGTCCCAACTACTTGG + Intergenic
1114403904 14:22435982-22436004 CACATCAGGGACCACTTTCTTGG - Intergenic
1117537825 14:56718743-56718765 CACATTAGAAATCACCTACGGGG + Intronic
1119546120 14:75472807-75472829 CACCATAGGGACCACGTACAGGG - Intronic
1119643161 14:76329766-76329788 CTAATTAGGGAACACCTGCTGGG - Intronic
1124126498 15:26942252-26942274 CAGATTATGCACCAGCTACTGGG - Intronic
1125097324 15:35869959-35869981 AACACTAGGAACCACCTACTTGG - Intergenic
1126207019 15:46057528-46057550 CACATGAGTGACCACCTGATGGG - Intergenic
1128321401 15:66697220-66697242 CAAATTACGGAGCTCCTACTGGG - Intergenic
1129179110 15:73860529-73860551 CACATTGGGGACCACCTCTCTGG - Intergenic
1129693502 15:77727514-77727536 CACCTTAGGTACCTCATACTAGG - Intronic
1130728448 15:86465590-86465612 CAGTTTAGAGACCTCCTACTGGG - Intronic
1132085705 15:98906782-98906804 CACATTAGTGACCACCAAACCGG - Intronic
1133910324 16:10060034-10060056 CACAGCAGGGACCACCTGATAGG + Intronic
1134640257 16:15824401-15824423 CACCTGTGGTACCACCTACTTGG - Intronic
1146530952 17:33607347-33607369 CACATTAGGGACCACCTACTAGG + Intronic
1147727236 17:42573681-42573703 CACCTCAGGGAGCACCCACTGGG - Intronic
1155749365 18:29400672-29400694 CCAATTAGGGACCACATGCTTGG + Intergenic
1156255824 18:35395400-35395422 CACATTTGGGCTCAGCTACTCGG - Intergenic
1157562990 18:48661658-48661680 AACATTAGGGGCCACCTGCTTGG + Intronic
1164786077 19:30932132-30932154 CACTTTAGTGACCAAGTACTCGG + Intergenic
929485664 2:42351855-42351877 CCCATTAGGGACTTCCTATTAGG + Intronic
933292752 2:80455677-80455699 CACATTAGTCACCACCATCTTGG - Intronic
940460357 2:153957208-153957230 CAAAATTGGGACCATCTACTTGG + Intronic
941486273 2:166086288-166086310 CTCATAAGAGACCACCCACTAGG + Intronic
942508994 2:176675632-176675654 CACATTGGGGGCCACCTCCATGG - Intergenic
1179037506 21:37771613-37771635 CACTTCTGGGACCACCTACAGGG - Intronic
1179413846 21:41182288-41182310 AACTTCAGGGAACACCTACTTGG - Intronic
1181477837 22:23179844-23179866 CACACTAGGGACCACCCAGCAGG - Intronic
1184695201 22:46135123-46135145 CACACCAGTGACCACCTCCTAGG - Intergenic
953700058 3:45188485-45188507 AAAATTAGGTACCACTTACTCGG + Intergenic
955968397 3:64412561-64412583 CACAGTAGGGACCACAAAGTAGG + Intronic
961357788 3:126349870-126349892 CACAATAGGCACCACCCTCTTGG + Intronic
962069896 3:132022416-132022438 CCCATGAGGGGCCACCTCCTGGG - Intronic
964594362 3:158406969-158406991 CTCAGTAGGGTCCTCCTACTCGG - Intronic
965677946 3:171219401-171219423 CACATAATGCAGCACCTACTAGG + Intronic
967574219 3:191071470-191071492 CACATTAGTGCCCACTTGCTTGG - Intergenic
970606525 4:17686814-17686836 CACATGAGGTCCCAGCTACTCGG + Intronic
976650101 4:87424933-87424955 CACATTAGTTACCAGGTACTTGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
985227757 4:187781021-187781043 CACAGCAGGGACCCCCTATTAGG + Intergenic
992145927 5:73847871-73847893 CTTATTAGGGAGCACCTACCGGG - Intronic
995668704 5:114575038-114575060 CACATGAGGGACCTCCCACCAGG - Intergenic
997205590 5:132047232-132047254 CAGAGTAGGGACCACGAACTGGG + Intergenic
1001552556 5:172614397-172614419 CACATTTGTAACCAGCTACTTGG - Intergenic
1003487169 6:6589776-6589798 CAGATTAGGGCCCACCTCCATGG + Intronic
1003647288 6:7924163-7924185 CACATTCAGGACCTTCTACTGGG + Intronic
1006466553 6:34198049-34198071 CACAGCAGTGACCACCCACTTGG + Intergenic
1009491612 6:64299460-64299482 CACACGAGGCACCACCTGCTGGG - Intronic
1017439901 6:154454921-154454943 CACATTTGGGAACACGTTCTGGG - Intronic
1017487813 6:154919234-154919256 AATATTAGGGACCACATACTTGG - Intronic
1022140767 7:27491551-27491573 CAGAATAGGGACCCCCAACTGGG - Intergenic
1023137556 7:37068005-37068027 AACATTAGAGACCAAATACTGGG + Intronic
1023960371 7:44921604-44921626 CACCTGGGGGAGCACCTACTGGG + Intergenic
1024747403 7:52424504-52424526 CACATGTGGTACCAGCTACTCGG - Intergenic
1026259958 7:68746575-68746597 CTCTTTAGGGACCACAGACTGGG - Intergenic
1035033555 7:155880662-155880684 CACAATTGGGACCACCTTCCTGG - Intergenic
1036550692 8:9812898-9812920 CATTTTAGGAAGCACCTACTGGG - Intergenic
1039131250 8:34266769-34266791 CAGATTAGGAACCACTTTCTAGG - Intergenic
1040359530 8:46651964-46651986 CACATGGGGCACCACCTTCTGGG - Intergenic
1045248562 8:100464454-100464476 CACACTAGGGGCCACTTCCTTGG - Intergenic
1045730204 8:105229823-105229845 AACATTAAGGAGTACCTACTAGG + Intronic
1048603223 8:135941234-135941256 GACATTAGGGAACTCCTACATGG - Intergenic
1049947847 9:615063-615085 CACCTTTGGTACCAGCTACTCGG - Intronic
1052634614 9:31086139-31086161 CACATCAGGGACCATTTACCAGG + Intergenic
1057193295 9:93099231-93099253 CTCTTTAGTGAGCACCTACTGGG + Intronic
1058256764 9:102776411-102776433 CACATGAGGTCCCAGCTACTCGG - Intergenic
1189492938 X:41483761-41483783 CCCATTAGGGAACTCCTGCTAGG - Intergenic
1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG + Intergenic
1193904908 X:87230672-87230694 CACCTGTGGGACCAGCTACTTGG + Intergenic
1196273784 X:113742476-113742498 CACATTAATGAATACCTACTGGG - Intergenic
1198568506 X:137930848-137930870 CAAACTAGGGCACACCTACTTGG - Intergenic